![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 1, 134-145, January 2002
Department of Biological Chemistry, University of California, Irvine, Irvine, California 92697-1700
Submitted March 13, 2001; Revised October 16, 2001; Accepted October 24, 2001| |
ABSTRACT |
|---|
|
|
|---|
The mechanism for apical growth during hyphal morphogenesis in Candida albicans is unknown. Studies from Saccharomyces cerevisiae indicate that cell morphogenesis may involve cell cycle regulation by cyclin-dependent kinase. To examine whether this is the mechanism for hyphal morphogenesis, the temporal appearance of different spindle pole body and spindle structures, the cell cycle-regulated rearrangements of the actin cytoskeleton, and the phosphorylation state of the conserved Tyr19 of Cdc28 during the cell cycle were compared and found to be similar between yeast and serum-induced hyphal apical cells. These data suggest that hyphal elongation is not mediated by altering cell cycle progression or through phosphorylation of Tyr19 of Cdc28. We have also shown that germ tubes can evaginate before spindle pole body duplication, chitin ring formation, and DNA replication. Similarly, tip-associated actin polarization in each hypha occurs before the events of the G1/S transition and persists throughout the cell cycle, whereas cell cycle-regulated actin assemblies come and go. We have also shown that cells in phases other than G1 can be induced to form hyphae. Hyphae induced from G1 cells have no constrictions, and the first chitin ring is positioned in the germ tube at various distances from the base. Hyphae induced from budded cells have a constriction and a chitin ring at the bud neck, beyond which the hyphae continue to elongate with no further constrictions. Our data suggest that hyphal elongation and cell cycle morphogenesis programs are uncoupled, and each contributes to different aspects of cell morphogenesis.
| |
INTRODUCTION |
|---|
|
|
|---|
Candida albicans is a polymorphic fungal pathogen that
undergoes reversible morphogenetic transitions among budding,
pseudohyphal, and hyphal growth forms (Odds, 1985
). Its ability to
switch between yeast and hyphal growth forms is directly related to its
virulence, because mutants defective in hyphal growth are less virulent
in mouse models than are their wild-type counterparts (Leberer et al., 1997
; Lo et al., 1997
; Gale et al.,
1998
). Hyphae may be suited to breach barriers in the host, whereas the
yeast form is more easily disseminated within the host. Therefore,
understanding the mechanisms for this morphogenetic switch should
provide insight into the pathogenicity of this fungus.
During hyphal growth in C. albicans, cell surface expansion
is restricted to a small region at the hyphal tip. This apical growth
zone is active during the entire hyphal growth period (Staebell and
Soll, 1985
). In contrast, yeast-form cells expand from a small area in
a mostly apical manner only at the initial stage of budding. When the
bud has reached a critical size, apical growth shuts down and general
(isotropic) expansion takes place (Staebell and Soll, 1985
). The
localization of the actin cytoskeleton in yeast and hyphal cells
reflects these differences in morphogenesis. Polarization of the actin
cytoskeleton to the hyphal tip is observed in all hyphal cells
(Anderson and Soll, 1986
). However, in yeast-form cells, the cortical
actin patches are observed at the area of apical expansion only in
small budded cells but not in large budded cells (Anderson and Soll,
1986
). It has been suggested that the actin cytoskeleton is essential
for polarized apical growth because chloropropham, a drug affecting
actin microfilament organization, has been shown to inhibit hyphal
growth (Yokoyama et al., 1990
, 1994
). The mechanism for
polarization of the actin cytoskeleton to the hyphal tips remains
unknown, partially because C. albicans is an obligatory
diploid with no sexual cycle, a fact that has hindered genetic studies
in this organism.
Several lines of evidence from Saccharomyces cerevisiae
indicate that cell morphogenesis and change in actin organization may
be regulated by cyclin-dependent kinase (CDK) (Lew and Reed, 1993
;
Johnson, 1999
). Increasing the levels of G1
cyclins promotes apical growth, whereas increasing the levels of B-type
cyclins leads to isotropic growth (Lew and Reed, 1993
). Moreover, a
delay in the activation of B-type cyclin/CDK activity, for any number of reasons, causes cell elongation. Based on this, Lew and Reed (1995)
have proposed a model in which cyclin-CDK activities control apical and
isotropic growth. They further hypothesized that cell elongation during
pseudohyphal growth in S. cerevisiae might be caused by a
delay in the apical-isotropic switch (Lew and Reed, 1993
, 1995
). In
agreement with this, a grr1 mutant, which has stable
G1 cyclins, has enhanced pseudohyphal growth
(Barral et al., 1995
; Blacketer et al., 1995
), as
do strains mutated for B-type cyclins (Lew and Reed, 1993
; Ahn et
al., 1999
). Furthermore, pseudohyphal S. cerevisiae
cells exhibit symmetric cell division and have a longer
G2 phase than do yeast-form cells (Kron et
al., 1994
).
In S. cerevisiae, activation of the morphogenesis checkpoint
promotes cell elongation (Lew, 2000
). This pathway, consisting of
several protein kinases, can sense defects in the actin cytoskeleton and/or in the septin ring structure and up-regulate the Swe1 kinase (McMillan et al., 1998
; Barral et al., 1999
;
McMillan et al., 1999
). In turn, Swe1 phosphorylates Cdc28
at Tyr19 and delays the activation of Cdc28/B-type cyclin and the cell
cycle transition from G2 to M (Sia et
al., 1996
). This delay leads to cell elongation, and it has
recently been proposed that the delay is a potential mechanism for
regulating pseudohyphal growth in S. cerevisiae (Edgington
et al., 1999
).
To explore the mechanisms for the regulation of cell polarity during hyphal development in C. albicans, we set out to examine whether regulation of the cell cycle is involved in hyphal elongation. Our results indicate that unlike the models proposed for S. cerevisiae pseudohyphal growth, hyphal elongation in C. albicans is not regulated primarily by cell cycle controls.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid and Strain Construction
A C. albicans green fluorescence protein (GFP)
integration plasmid, pHL471, was constructed by cloning a
HindIII-PstI GFP fragment from pYGFP3 (Cormack
et al., 1997
) into the HindIII-PstI site of plasmid pHL159, which contains the CaURA3 gene at
the XbaI-BamHI sites of pBluescript SK (Liu
et al., 1994
). The DNA sequence preceding the GFP in the
polylinker of pHL471 is GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGC
TTT ATT AAA ATG. The underlined region is from pYGF3,
and the ATG in bold is the start codon for GFP. Polymerase chain
reaction (PCR) primers
p130-5'CGGGGTACCAACATTATAGAACTATGATGAGAG and
p131-5'CCGGGTACCATCATGGCGGCATCTTCTAATCGGG were
used to amplify CaTUB2, by using genomic DNA as template.
The PCR fragment was cloned into the unique KpnI site of
pHL471 by using the sites (underlined) included in the primers,
resulting in plasmid pHL472, in which the CaTUB2 was fused
in frame to GFP. pHL472 was digested with BspmI (a unique
site in CaTUB2) and transformed into C. albicans CAI4 (Fonzi and Irwin, 1993
) for integration at TUB2. Each
Ura+ transformant analyzed contained a functional
TUB2-GFP fusion based on the characteristic appearance of
microtubule spindles. These strains grew at a slightly slower rate than
wild-type strains. One of the TUB2-GFP strains, HLY1541 was
used in this study. Wild-type C. albicans strain SC5314
(Fonzi and Irwin, 1993
), the progenitor of CAI4, was also used.
Cell Cultures
Routine culture of C. albicans was performed
essentially as described for S. cerevisiae (Sherman, 1991
).
Cells were grown to log phase or to saturation in YPD medium at 30°C
then diluted into YPD-based yeast-inducing (YPD at 30°C) and
hyphal-inducing medium (YPD + 10% newborn calf serum [Sigma, St.
Louis, MO] at 37°C), or into Lee's (Lee et al., 1975
;
Buffo et al., 1984
) yeast-inducing (30°C, pH 4.5) or
hyphal-inducing (37°C, pH 7.0) medium with 1% mannitol (Loeb
et al., 1999b
).
Cell Synchronization
Cell synchronization was performed as previously described (Loeb
et al., 1999b
). Unbudded G1 cells were
released into YPD-based yeast and hyphal-inducing media, and aliquots
of cells were taken for direct visualization by microscope, fixed in
formaldehyde for actin staining or in ethanol for DNA staining, or
frozen in liquid nitrogen for biochemical studies.
Fluorescence-activated Cell Sorting (FACS) Analysis
Synchronous cells were fixed in ethanol, washed with Tris buffer (0.2 M Tris-HCl pH 7.5), sonicated, and then incubated overnight at 37°C in Tris buffer containing 1 mg/ml RNase. The cells were then stained with Tris buffer containing 0.05 mg/ml propidium iodide (Sigma) for 15 min on ice, washed with Tris buffer, and resuspended in Tris buffer containing 0.01 mg/ml propidium iodide. Flow cytometric analysis was performed using a Becton Dickinson FACScan fluorescence system equipped with Cell Quest acquisition and analysis software. Analysis was done on a collection of 10,000 gated events.
Kinase Assays and Western Analysis
Crude protein extracts were prepared as described previously
(Surana et al., 1993
) by using buffer A (Wu and Russell,
1997
) without pepstatin. The affinity precipitation of Cdc28 was done by incubating 20 µl of p13SUC1-Sepharose beads
(Calbiochem, San Diego, CA) with total protein extracts (50-150 µg)
in buffer A for 2 h at 4°C with gentle agitation. Suc1 is known
to bind to CDKs with high affinity (Ducommun and Beach, 1990
). Kinase
assays were performed essentially as described by Surana et
al. (1993)
. Western analysis was performed on total protein
extracts or the Suc1 precipitate (50-100 µg), separated on 12.5%
SDS-PAGE. A 1:250 dilution of PSTAIRE primary antibody (Santa Cruz
Biotechnology, Santa Cruz, CA) in phosphate-buffered saline (PBS) + 0.05% Tween + 5% dry milk was used. Tyr19 was visualized with a
phospho-cdc2 (Tyr15) antibody (New England Biolabs, Beverly, MA).
Membranes were blocked with TBS + 0.1% Tween (TTBS) + 5% dry milk
overnight and incubated with a 1:1000 dilution of the phospho-cdc2
(Tyr15) antibody in TTBS + 5% bovine serum albumin overnight.
Anti-rabbit-Ig-horseradish peroxidase (Amersham Biosciences, Piscataway, NJ) was used as a secondary antibody at 1:1000 in TTBS + 5% dry milk. All Western analyses were visualized using enhanced
chemiluminescence (Amersham Biosciences).
Microscopy
A Zeiss Axioplan2 microscope with a 100× objective and a
digital camera (Sensys Photometrics, Tucson, AZ) were used for all microscopy. The temperature of the microscope stage was maintained at
37°C during time-lapse microscopy by Airtherm (World Precision Instruments, New Haven, CT). Visualization of
-tubulin-GFP was performed on cells in growth media or after resuspension in water. To
stain DNA of live C. albicans cells, cultures were grown in the presence of 1 µg/ml 4'6-diamidino-2-phenylindole (DAPI) for at
least 16 h (40 h gave better results) then diluted into fresh medium containing 1 µg/ml DAPI and photographed directly in the medium. Calcofluor staining of the chitin ring was done as previously described (Loeb et al., 1999b
). Rhodamine-phalloidin
staining of actin was performed based on the protocol described by
Adams and Pringle (1991)
. Cells were spun and then resuspended in 3.7% formaldehyde in PBS for 1 h, washed with PBS, and incubated with buffer B (100 mM sodium phosphate pH 7.4, with 1.2 M sorbitol) containing 2 µl/ml
-mercaptoethanol for 20 min. Cells were then stained with 1 µg/ml rhodamine-phalloidin (Sigma) or 1:20
dilution of Alexa488-phalloidin (Molecular Probes, Eugene, OR) in
buffer B for 30-45 min in the dark, washed, and resuspended in freshly made mounting medium (1× PBS, pH 9 with 1 mg/ml
o-phenylenediamine) containing a 1:50,000 dilution of 1 mg/ml DAPI. For double labeling of chitin and actin, cells were stained
first with calcofluor, washed with PBS, and then stained with
phalloidin as described above.
| |
RESULTS |
|---|
|
|
|---|
Hyphal Germ Tube Emergence Can Occur before Cell Cycle Events of G1/S Transition
Using GFP-tagged tubulin, four major spindle structures were
observed in C. albicans yeast-form cells. The structures
looked very similar to those seen in S. cerevisiae
(Kilmartin and Adams, 1984
; Carminati and Stearns, 1997
) and were named
accordingly. A spindle pole body (SPB) was observed as a very faint
spot that colocalized with the nucleus (Figure
1A, a). The SPB had astral microtubules
emerging from it. A duplicated spindle pole body (DSPB) was seen as a
very bright, concentrated, nuclear-associated spot (Figure 1A, b). A
short spindle (SS) was seen as a very bright, nuclear-associated rod
(Figure 1A, c). The nucleus of cells containing a short spindle was
usually located near the mother-bud neck (Figure 1A, c, bottom), with
astral microtubules from one end of the spindle oriented into the bud.
A long mitotic spindle (MS) spanned much of the length of the mother
and daughter cells in large budded cells (Figure 1A, d and e) and was
associated with elongating or separated nuclei (Figure 1A, d and e,
bottom). Mitotic spindles were fainter than short spindles.
|
The appearance of these structures was correlated with other cell cycle
events, such as DNA replication, budding and chitin ring formation,
nuclear migration, and separation (Figures 1, A and C). Elutriated
cells were initially unbudded and had an SPB with 2N DNA content
(Figure 1C). After 90 min of growth in YPD, DSPBs started to appear.
The appearance of DSPBs coincided with budding and chitin ring
formation and was followed by a shift in DNA content toward 4N at 120 min, as seen from FACS analysis in Figure 1C. Therefore, in C. albicans yeast-form cells, SPB duplication, bud emergence, and DNA
replication all happen at the G1/S transition as
in S. cerevisiae (Lew and Reed, 1995
).
Similar spindle structures were observed in hyphal cells (Figure 1B),
although some of the SS and MS were longer than in yeast-form cells, as
previously reported (Akashi et al., 1994
). As in yeast-form cells, the temporal appearance of these structures during the cell
cycle was correlated with other cell cycle events (Figure 1, B and D).
Nuclear migration started before SPB duplication (Figure 1B, b). After
90-100 min in YPD + 10% serum, DSPBs began to appear (Figures 1B, c).
This coincided with the appearance of the chitin rings in germ tubes
and was followed by a shift in DNA content toward 4N at 120 min (Figure
1D).
Strikingly, hyphal germ tubes emerged at ~30 min, which was ~70 min before SPB duplication, chitin ring formation, and DNA replication in hyphal cells (Figure 1D), events that coincided with budding in yeast-form cells. Therefore, germ tube formation is not the same as budding and is not an indication of the G1/S transition but of hyphal induction. Closer observation of differential interference contrast (DIC) and GFP-tubulin images revealed that budding cells (with a duplicated SPB) have a constriction at the mother-bud junction (Figure 1E, b), whereas hyphal cells (with an unduplicated SPB) have no constriction at the mother-germ tube junction (Figure 1E, a).
Spindle structures have been visualized previously in C. albicans by using antibodies to tubulin. However, no SPBs were
observed in unbudded cells. Thus, it was assumed that what we interpret herein as a DSPB was the SPB and that cells spend a substantial part of
the cell cycle with no microtubule-organizing center (Barton and Gull,
1988
). Our observations indicate that the spindle cycle in C. albicans is very much like the spindle cycle in S. cerevisiae.
It was reported previously that C. albicans hyphal cells
only divide from the tip, whereas subapical cells seem to be cell cycle
arrested (Gow, 1997
). Consistent with this, all of ~5000 unbranched
subapical hyphal cells we examined had a single nucleus and an
unduplicated SPB (Figure 1B, g-j), whereas the apical cells exhibited
dynamic changes in spindle structures.
Progression of Cell Cycle Is Similar in Yeast and Hyphal-Apical Cells
To investigate further possible cell cycle changes during hyphal
morphogenesis, we compared the percentages of the different spindle
structures among asynchronous yeast and hyphal-apical cells in two
hyphal-inducing conditions (Figure 2).
DSPBs and SS were counted together as one category (DSPB),
corresponding to the S/G2 phase of the cell
cycle. If hyphal formation is due to modulating the length of a
specific phase of the cell cycle, one would expect a difference in the
percentage of cells in that phase when comparing asynchronous
yeast-form and hyphal-form cells. Approximately 5% more cells in
S/G2 and 5% fewer cells in
G1 were observed in the apical cells of hyphae
compared with yeast-form cells. The percentages of mitotic cells were
identical (Figure 2). It has been reported that S. cerevisiae pseudohyphal cells have a 12-15% longer
G2 phase than that of yeast-form cells (Ahn et al., 1999
). Considering that hyphal elongation in
C. albicans is much more dramatic than that of pseudohyphae
in S. cerevisiae, the statistically significant 5% change
in S/G2 length is unlikely to account for the
majority of apical growth observed in hyphal cells.
|
In addition, synchronous elutriated GFP-tubulin cells were released
into yeast- and hyphal-inducing YPD-based media, and the percentage of
cells with each spindle structure was counted. As shown in Figure
3A, for both yeast-form and hyphal-apical
cells, the appearance of DSPBs peaked at 170 and 270 min after release, the appearance of mitotic spindles peaked at 200 and 290 min after release, and the reappearance of unduplicated SPBs peaked at 220 min
after release. This suggests that cell cycle dynamics is similar for
yeast-form and hyphal-apical cells. To examine cell cycle dynamics in
an alternative hyphal growth condition, we also tried to release
synchronous G1 cells into Lee's medium. However,
based on the counting of tubulin structures, elutriated
G1 cells did not enter the first cell cycle in
synchrony, although germ tubes did emerge before the appearance of
DSPBs, as in YPD + serum (our unpublished data).
|
Hyphal Tip-associated Polarization of Actin Cytoskeleton Persists, whereas Cell Cycle-modulated Actin Assemblies Appear and Disappear during Hyphal Growth
Temporal changes in the actin assemblies of yeast and hyphal
cells were studied by fixing and staining cells from the experiment of
Figure 3. The actin organization observed in yeast-form cells was very
similar to that described in S. cerevisiae. These included the concentration of cortical actin patches at the future bud site
(Figure 4A, b), which often persisted for
some time after the bud had emerged (Figure 4A, c); cortical actin
patches concentrated in the emerging bud (Figure 4A, c and d); a
fainter actin ring at the neck of large budded cells (Figure 4A, e);
and a congregation of cortical actin patches on both sides of the neck
during septation (Figure 4A, f) (Kilmartin and Adams, 1984
; Bi et
al., 1998
). The actin assemblies observed in hyphal cells were
also similar. They included a bright ring of cortical actin patches
close to the tip of a growing hypha (Figure 4B, c and d). This ring
appeared before and at the initiation of nuclear migration (Figure 4B, c and d, bottom), and some probably persisted to SPB duplication (Figure 3, A and B, bottom). The actin ring colocalized with the chitin
ring in the germ tube at the future septum site (Figure 4C, a). The
ring of cortical actin patches disappeared later in the cell cycle
(Figure 4B, e). A faint actin ring located toward the middle of the
hypha (Figure 4B, f and g) appeared at nuclear separation (Figure 4B,
f, bottom) coincided with the appearance of mitotic spindles (Figure 3,
A and B, bottom), and also colocalized with the chitin ring (Figure 4C,
b). Thus, it was defined as a mitotic actin ring. This ring is followed
by the appearance of actin repolarization around a dark gap that
presumably corresponds to the septum (Figures 3B, bottom; and 4B, h).
Actual visualization of these actin structures was more convincing
under the microscope than what we were able to capture in the
single-focus-plane images. The appearance of these different actin
assemblies in both yeast-form and hyphal-form cells occurred with
similar dynamics (Figure 3B), which supports the notion that the timing
of cell cycle in the hyphal apical cells is not altered.
|
In addition to these cell cycle-modulated actin assemblies,
cortical actin patches and cables are persistently polarized to the
hyphal tip, a localization that appeared slightly before the evagination of germ tubes (Figures 3, A and B, bottom; and 4B). Polarization of the actin cytoskeleton at the tips of hyphae was reported previously and is probably required for hyphal elongation (Anderson and Soll, 1986
; Yokoyama et al., 1990
). We
observed that the actin polarization at the hyphal tip appeared 30 min after hyphal induction in G1 cells, ~70 min
before SPB duplication, DNA replication, and chitin ring formation, and
that it persisted throughout the cell cycle (Figures 3B, bottom; and
4B). Such actin polarization was not observed in the yeast cells
collected at the same time interval after release (Figure 4A). The
persistent polarization of cortical actin patches and actin cables to
the hyphal tip in the apical cell of each hypha was in sharp contrast to the dynamic rearrangement of cell cycle-regulated actin assemblies in the same cells (Figures 3B and 5B). These observations suggest that
the hypha-tip-associated actin polarization is regulated independently
of the cell cycle.
Cells in Phases Other than G1 Can Be Induced to Form Hyphae
It has been reported that there is a point of
phenotypic commitment in the cell cycle for setting the mode of
mycelial outgrowth: small budded cells initiate hyphae as extensions of
the buds, whereas large budded cells only evaginate in the next cell
cycle (Mitchell and Soll, 1979
). This suggests that later stages of the
cell cycle may prohibit hyphal evagination. To address this question,
time-lapse microscopy was used to follow hyphal emergence from
log-phase yeast-form cells. Cells with a large bud were able to form
polarized evaginations, which tapered off into long hyphae without
constrictions as an extension of the bud (Figure
5A). However, the bud size alone could
not inform us of the exact cell cycle stages at the point of hyphal
induction. To further address this issue, we examined cell shape,
spindle, and SPB structure of log-phase cells that had been transferred
to a hyphal-inducing medium for 30-50 min. Distinct cell shapes seemed
to associate with different spindle structures as soon as hyphal
elongation was visible. Hyphae from unbudded G1
cells had a narrow evagination from a single mother cell (Figure 5B,
a). S/G2 cells had a small, elongated bud (Figure
5B, b). Mitotic cells exhibited large, elongated buds of tapering
appearance or dumbbell-shaped buds (Figure 5B, c). Budded cells with
elongated G1 daughter and mother cells were also
observed (Figure 5B, d). The further along the cells were in the cell
cycle at the time of hyphal induction, the wider the initial hyphal
evagination seemed to be (Figure 5B). Because hyphal induction should
happen before observable changes in cell shape, these cells might have
been in M phase or just before M phase at the time of hyphal induction
(Figure 5B, d). However, in hyphal-induced large budded cells
containing a mitotic actin ring, tip actin polarization was visible
presumably indicating the initiation of hyphal formation. Such
polarization was never observed in similar cells grown in yeast medium
(Figure 5C). Our data suggest that C. albicans can be
induced to initiate hyphal formation in later stages of the cell cycle,
perhaps even in mitotic cells.
|
The tapering appearance of an elongated bud with DSPBs (Figure 5B, b)
is reminiscent of the elongated bud caused by a
G2 delay in S. cerevisiae. However,
both FACS analysis and spindle counting of the hyphal cells did not
reveal any cell cycle shift toward G2 (our
unpublished data). Furthermore, no new constrictions appeared in
the hyphae evaginated from budded cells (Figure 5A). Thus, hyphal
evaginations from cells past G1, although
reminiscent of pseudohyphal cells, are actually true hyphae growing on
already existing buds. It is interesting to note that although
G1 cells randomly initiate germ tubes, as
previously reported (Chaffin, 1984
), all budded cells we observed grow
hyphal germ tubes at the tip of the existing bud rather than from the mother.
The chitin ring is a marker for the position of the septum between a
mother and daughter in hyphal cells (Soll and Mitchell, 1983
). We have
observed that in elutriated G1 cells, the
distance of the first chitin ring from the base of the germ tube was
relatively constant (Figure 5D, a), whereas in nonelutriated
G1 cells, the distance varied greatly (Figure 5D,
c). Because the elutriated G1 cells are mostly
uniform in size, whereas nonelutriated G1 cells
are varied in size, the position of the first chitin ring possibly
reflects the time elapsed between hyphal induction and formation of the
first chitin ring (at the G1/S transition), which would be expected to occur earlier in cells that were larger at the
time of hyphal induction. The observed variation suggests that the cell
cycle program is responsible for septum positioning and is independent
of the hyphal program. In cells that were presumably already budded at
the time of hyphal induction, the first chitin ring was always at the
site of the constriction from the mother cell (Figure 5D, b).
Similar Dynamics of Cdc28-Tyr19 Phosphorylation and Dephosphorylation in Yeast and Hyphal Cells
In parallel to the cell biology studies, we also carried out
biochemical experiments to address how CDK is regulated in yeast and
hyphal cells. A C. albicans CDC28-like gene, whose deduced protein sequence is 79% identical to that of S. cerevisiae
Cdc28, was identified by functional complementation in S. cerevisiae (Sherlock et al., 1994
). To assay CDK
activity in C. albicans, p13Suc1-agarose-conjugated beads were used to
pull down the CDK/cyclin complex from cell extracts. H1 histone kinase
activity associated with the precipitated fractions in synchronous
cells showed cyclic levels during progression of the cell cycle, as
expected for a CDK (Figure 6A). From
total extracts, Suc1 precipitated only one of the several polypeptides
recognized by an antibody against PSTAIRE (Figure 6B, lanes 1 and 2). A
phospho-specific antibody against human Cdc2-P-Tyr15 peptide recognized
one major band in the total protein extract of C. albicans
(Figure 6B, lane 4). This same polypeptide was also pulled down by Suc1
beads (Figure 6B, lane3) and migrated, as a 34-kDa polypeptide,
identical to the PSTAIRE-recognized polypeptide in the Suc1 precipitate
(Figure 6B, lane 1). A search of the recently completed C. albicans genome sequence by using the CaCdc28 sequence indicates
that there are no other kinases that are of the exact same size as
CaCdc28 with a high degree of identity at both the conserved Tyr19 and
PSTAIRE regions. Thus, it is likely that Cdc28 is the only CDK in
C. albicans, and the Suc1-associated, anti-Cdc2-P-Tyr15 and
anti-PSTAIRE-recognized 34-kDa protein is likely to be the C. albicans CDK, Cdc28. Western analysis of total protein extracts
indicates that the phosphopeptide antibody can recognize the CaCdc28
only from active growing cells but not from stationary phase cells
(Figure 6C), which is consistent with the phosphospecificity of the
Cdc2-P-Tyr15 antibody if the phosphopeptide antibody recognizes only
the Tyr19-phosphorylated form of Cdc28 from growing C. albicans cells.
|
Phosphorylation at Tyr19 of Cdc28 by Swe1p has been shown to increase
cell elongation and filamentation in S. cerevisiae
(Edgington et al., 1999
). To examine whether a change in
Cdc28-Tyr19 phosphorylation is involved in hyphal induction in C. albicans, we first used the anti-Cdc2-P-Tyr15 antibody to follow
the levels of CaCdc28-Tyr19 phosphorylation in asynchronous C. albicans cultures during the yeast-to-hyphal transition. Cells
released into either a yeast- or hyphal-inducing medium from an
overnight culture started to show detectable Tyr19 phosphorylation
2 h after release (our unpublished data), and levels of
Tyr19 phosphorylation were fairly similar between yeast and hyphal
cells (our unpublished data).
We then examined synchronous C. albicans cells released into
a yeast- or hyphal-inducing YPD-based medium. In both populations, the
Tyr19 phosphorylation state was cell cycle regulated, whereas the
CaCdc28 protein level (as monitored by anti-PSTAIRE) was roughly unchanged (Figure 7). The regulation of
the Tyr19 resembles Schizosaccharomyces pombe more than
S. cerevisiae. If hyphal cell elongation involves regulating
Cdc28-Tyr19 phosphorylation, we would expect a delay in
dephosphorylation of Tyr19 in synchronous hyphal cells compared with
synchronous yeast cells. However, the yeast-form and hyphal cells
displayed similar dynamics of phosphorylation and dephosphorylation of
Tyr19 (Figure 7). That the cyclic pattern was more evident in hyphal
cell than in yeast-form cells can probably be attributed to the
different pattern of cell division: In yeast-form cells, mother cells
always bud before daughters, whereas in hyphal filaments only daughters
enter the cell cycle. These data suggest that C. albicans
hyphal cells, unlike S. cerevisiae cells, do not use the
Swe1 checkpoint to mediate cell elongation. These data also further
support the view that the cell cycle timing in yeast and hyphal-apical
cells is similar.
|
| |
DISCUSSION |
|---|
|
|
|---|
Subapical Cells in Hyphal Filaments Appear to Be Arrested in G1, Leading to Linear Filament Formation
C. albicans cells can switch from unicellular yeast
growth to an alternate growth program that generates linear chains of elongated cells with no constrictions at the site of the septa. Previous studies have shown that the subapical cells in a linear hypha
are transiently arrested, probably in G1, and
that they are highly vacuolated (Kron and Gow, 1995
; Gow, 1997
). Our
studies suggest that the subapical cells are arrested, with an
unduplicated SPB (Figure 1B, g-j). Only the apical cells continue to
cycle as indicated by dynamic changes in the microtubule structure and rearrangement of the actin cytoskeleton. This type of asymmetric distribution of cell fate is a well known mechanism in development of
multicellular organisms, as well as in the unicellular S. cerevisiae, where the asymmetric distribution of the
ASH1 mRNA to the daughter restricts mating-type switching to
the mother cell only (Sil and Herskowitz, 1996
). This asymmetric
distribution of the ASH1 mRNA depends on proteins of the
actin cytoskeleton (Bobola et al., 1996
; Jansen et
al., 1996
). By analogy, the constant actin polarization observed
at the apical tip of the C. albicans hypha could be a means
for asymmetric distribution of transcripts for factors important for
cell fate determination.
Hyphal Cell Elongation Does not Appear to Be Regulated through Alterations of Cell Cycle Progression
It has been proposed that cell polarity during hyphal
morphogenesis is regulated by a change in cell cycle (Kron and Gow, 1995
; Lew and Reed, 1995
). Several recent publications on the relationship between pseudohyphal growth and Cdc28 activity in S. cerevisiae are supportive of this view (Ahn et al.,
1999
; Edgington et al., 1999
; Loeb et al.,
1999a
). However, several lines of evidence in this study suggest that
the model does not apply to the elongation of true hyphae in C. albicans. Counting microtubule structures in asynchronous cells
showed that there were only 5% more cells with DSPBs in hyphal-apical
cells than in yeast-form cells (Figure 2), a difference that is too
small to account for the dynamic hyphal-associated apical growth.
Moreover, in synchronous cultures, the dynamics of the spindle cycle in
yeast-form and hyphal-apical cells is almost identical (Figure 3A).
Because SPB duplication coincides with DNA replication and budding
and/or chitin ring formation, the dynamics of these cell cycle events
must also be almost identical in yeast and hyphal-apical cells. In
addition, the timing of cell cycle-regulated actin assemblies, such as
the ring of cortical actin patches at the presumptive mother-bud neck and the mitotic actin ring, are almost identical between yeast-form and
hyphal-apical cells (Figure 3B). Comparison of these cell cycle events
between yeast-form and hyphal cells is summarized in an illustration
(Figure 4D). Finally, we have shown that phosphorylation and
dephosphorylation of the conserved Tyr19 of CaCdc28 are cyclic, and the
dynamics of these modifications is similar in yeast and hyphal cells
(Figure 7). All these data suggest that yeast and hyphal tip cells
exhibit similar cell cycle dynamics. Thus, hyphal elongation does not
appear to be regulated through altering cell cycle progression, at
least in the two conditions examined. Consistent with this, deletion of
a G1 cyclin gene did not affect hyphal initiation
or development in a serum-containing medium, and it affected only
sustained hyphal elongation, but not initial germ tube formation, in
Lee's medium (Loeb et al., 1999b
). Our conclusion herein
does not exclude the possibility that alterations in cell cycle through
mutations or reagents that alter cell cycle progression can cause cell
elongation in C. albicans. In fact, C. albicans cells became elongated when treated with hydroxyurea under yeast growth
conditions (our unpublished observation).
Cell Cycle-regulated Morphogenesis and Hyphal Morphogenesis Programs Are Uncoupled, and Each Contributes to Different Aspects of Cell Morphology
Several lines of evidence suggest that cell cycle-regulated morphogenesis programs and hyphal morphogenesis are uncoupled. The timing of several cell cycle events examined in this study is not altered in hyphal tip cells compared with yeast-form cells. Germ tube formation can occur before the G1/S transition, or in other stages of the cell cycle, and hyphal elongation persists throughout the cell cycle. In addition, cell cycle-modulated actin organization comes and goes, whereas hyphal-associated actin tip-polarization persists in hyphal cells. Consistent with the model of separate pathways, the distance of the first chitin ring from the base of each hypha differs greatly in asynchronous G1 cells but is relatively constant in synchronous G1 cells.
Hyphae initiated from G1 cells did not have a
constriction at their bases, and their first chitin ring is in the germ
tube, whereas hyphae formed from budded cells inherit a constriction and the chitin ring at the mother-daughter neck. In budded cells, the
shape of the daughter, whether it is tapered or dumbbell shaped, is
also correlated with the cell cycle stage at the time of hyphal induction. Furthermore, evaginations on budded cells are initiated at
the distal end of the daughter, whereas G1 cells
evaginate randomly in relation to the cell axis (Chaffin, 1984
). These
observations suggest that strong hyphal-associated apical growth is
probably added onto already existing cell cycle-regulated structures,
such as the bud neck and the actin cytoskeleton that determines apical or isotropic growth, at the onset of hyphal induction. The combination of the cell cycle-regulated apical and isotropic growth with the hyphal-associated apical growth may have given rise to the different cell shapes we observed (Figure 5B). After the initial cell cycle, hyphal-associated apical growth takes over in shaping the cells. Despite this, other cell cycle-regulated structures such as chitin rings continue to appear in hyphal cells in a timely manner. The addition of a chitin ring to a germ tube or a hyphal filament supports,
from a different view, the concept that both programs contribute to
cell morphogenesis in hyphae (Figure 8).
|
Potential Mechanisms for Hyphal-associated Polarization of Actin Cytoskeleton
Hyphal-associated polarization of the actin cytoskeleton is
located exclusively at the tip of each hypha (Anderson and Soll, 1986
).
It coexists with the cell cycle-regulated actin assemblies in the
apical cells of each hypha (Figure 4B), and both contribute to cell
shape. It is likely that both cell cycle and hyphal-associated programs
can regulate a common signaling module, which in turn controls the
polarization of the actin cytoskeleton. This setting is reminiscent of
that in S. cerevisiae where the polarization of the actin
cytoskeleton during both mating and budding is mediated by altering the
distribution of Cdc24, the guanine-nucleotide exchange factor of the
RhoGTPase Cdc42, whose activation is required to orient the actin
cytoskeleton toward the incipient bud site or toward pheromone during
mating (Johnson, 1999
; Gulli and Peter, 2001
). Germ tube formation in
C. albicans resembles cell polarity establishment during
mating in S. cerevisiae in that both establish cell polarity
in the absence of an active G1 cyclin/CDK. Given that Cdc42 plays a vital role in cell morphogenesis and hyphal development in C. albicans (Whiteway, 2000
), it is likely
that C. albicans may use mechanisms similar to that of
forming mating projections in S. cerevisiae for regulating
hyphal elongation.
| |
ACKNOWLEDGMENTS |
|---|
We are in debt to the anonymous reviewers and the monitoring editor for critiques. We thank Drs. Steve Kron, David Pellman, and Chris Greer for comments on the manuscripts; Dr. Cormack for providing the C. albicans GFP construct; Dr. Melanie Oakes for assistance with microscopy; Amber Neben for help with FACS analysis; Dr. Giora Maymon for help with statistical analysis; and Avi Hazan for help with graphics. This work was supported by grants from the Burroughs Welcome Fund (BWF-0462) and from the National Institutes of Health (GM-55155).
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: H4LIU{at}UCI.edu.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.01-03-0116. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.01-03-0116.
| |
ABBREVIATIONS |
|---|
Abbreviations used: DSPB, duplicated spindle pole body; GFP, green fluorescence protein; MS, mitotic spindle; SPB, spindle pole body; SS, short spindle.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Trunk, P. Gendron, A. Nantel, S. Lemieux, T. Roemer, and M. Raymond Depletion of the Cullin Cdc53p Induces Morphogenetic Changes in Candida albicans Eukaryot. Cell, May 1, 2009; 8(5): 756 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lu, C. Su, X. Mao, P. P. Raniga, H. Liu, and J. Chen Efg1-mediated Recruitment of NuA4 to Promoters Is Required for Hypha-specific Swi/Snf Binding and Activation in Candida albicans Mol. Biol. Cell, October 1, 2008; 19(10): 4260 - 4272. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Sherwood and R. J. Bennett Microtubule Motor Protein Kar3 Is Required for Normal Mitotic Division and Morphogenesis in Candida albicans Eukaryot. Cell, September 1, 2008; 7(9): 1460 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brand, A. Vacharaksa, C. Bendel, J. Norton, P. Haynes, M. Henry-Stanley, C. Wells, K. Ross, N. A. R. Gow, and C. A. Gale An Internal Polarity Landmark Is Important for Externally Induced Hyphal Behaviors in Candida albicans Eukaryot. Cell, April 1, 2008; 7(4): 712 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Wolyniak and P. Sundstrom Role of Actin Cytoskeletal Dynamics in Activation of the Cyclic AMP Pathway and HWP1 Gene Expression in Candida albicans Eukaryot. Cell, October 1, 2007; 6(10): 1824 - 1840. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wang, S. Lane, Z. Tian, A. Sharon, I. Hazan, and H. Liu Temporal and Spatial Control of HGC1 Expression Results in Hgc1 Localization to the Apical Cells of Hyphae in Candida albicans Eukaryot. Cell, February 1, 2007; 6(2): 253 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Court and P. Sudbery Regulation of Cdc42 GTPase Activity in the Formation of Hyphae in Candida albicans Mol. Biol. Cell, January 1, 2007; 18(1): 265 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pardini, P. W. J. De Groot, A. T. Coste, M. Karababa, F. M. Klis, C. G. de Koster, and D. Sanglard The CRH Family Coding for Cell Wall Glycosylphosphatidylinositol Proteins with a Predicted Transglycosidase Domain Affects Cell Wall Organization and Virulence of Candida albicans J. Biol. Chem., December 29, 2006; 281(52): 40399 - 40411. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C.G. Rida, A. Nishikawa, G. Y. Won, and N. Dean Yeast-to-Hyphal Transition Triggers Formin-dependent Golgi Localization to the Growing Tip in Candida albicans Mol. Biol. Cell, October 1, 2006; 17(10): 4364 - 4378. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Huang, H. Wang, S. Chou, X. Nie, J. Chen, and H. Liu From the Cover: Bistable expression of WOR1, a master regulator of white-opaque switching in Candida albicans PNAS, August 22, 2006; 103(34): 12813 - 12818. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Clemente-Blanco, A. Gonzalez-Novo, F. Machin, D. Caballero-Lima, L. Aragon, M. Sanchez, C. R. V. de Aldana, J. Jimenez, and J. Correa-Bordes The Cdc14p phosphatase affects late cell-cycle events and morphogenesis in Candida albicans J. Cell Sci., March 15, 2006; 119(6): 1130 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Finley and J. Berman Microtubules in Candida albicans Hyphae Drive Nuclear Dynamics and Connect Cell Cycle Progression to Morphogenesis Eukaryot. Cell, October 1, 2005; 4(10): 1697 - 1711. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hanaoka, T. Umeyama, K. Ueno, K. Ueda, T. Beppu, H. Fugo, Y. Uehara, and M. Niimi A putative dual-specific protein phosphatase encoded by YVH1 controls growth, filamentation and virulence in Candida albicans Microbiology, July 1, 2005; 151(7): 2223 - 2232. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Crampin, K. Finley, M. Gerami-Nejad, H. Court, C. Gale, J. Berman, and P. Sudbery Candida albicans hyphae have a Spitzenkorper that is distinct from the polarisome found in yeast and pseudohyphae J. Cell Sci., July 1, 2005; 118(13): 2935 - 2947. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Bensen, A. Clemente-Blanco, K. R. Finley, J. Correa-Bordes, and J. Berman The Mitotic Cyclins Clb2p and Clb4p Affect Morphogenesis in Candida albicans Mol. Biol. Cell, July 1, 2005; 16(7): 3387 - 3400. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Li, Y. M. Wang, X. De Zheng, H. Y. Liang, J. C. W. Tang, and Y. Wang The formin family protein CaBni1p has a role in cell polarity control during both yeast and hyphal growth in Candida albicans J. Cell Sci., June 15, 2005; 118(12): 2637 - 2648. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Atir-Lande, T. Gildor, and D. Kornitzer Role for the SCFCDC4 Ubiquitin Ligase in Candida albicans Morphogenesis Mol. Biol. Cell, June 1, 2005; 16(6): 2772 - 2785. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bachewich and M. Whiteway Cyclin Cln3p Links G1 Progression to Hyphal and Pseudohyphal Development in Candida albicans Eukaryot. Cell, January 1, 2005; 4(1): 95 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Walther and J. Wendland Polarized Hyphal Growth in Candida albicans Requires the Wiskott-Aldrich Syndrome Protein Homolog Wal1p Eukaryot. Cell, April 1, 2004; 3(2): 471 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wightman, S. Bates, P. Amornrrattanapan, and P. Sudbery In Candida albicans, the Nim1 kinases Gin4 and Hsl1 negatively regulate pseudohypha formation and Gin4 also controls septin organization J. Cell Biol., February 16, 2004; 164(4): 581 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Knechtle, F. Dietrich, and P. Philippsen Maximal Polar Growth Potential Depends on the Polarisome Component AgSpa2 in the Filamentous Fungus Ashbya gossypii Mol. Biol. Cell, October 1, 2003; 14(10): 4140 - 4154. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Barelle, E. A. Bohula, S. J. Kron, D. Wessels, D. R. Soll, A. Schafer, A. J. P. Brown, and N. A. R. Gow Asynchronous Cell Cycle and Asymmetric Vacuolar Inheritance in True Hyphae of Candida albicans Eukaryot. Cell, June 1, 2003; 2(3): 398 - 410. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bachewich, D. Y. Thomas, and M. Whiteway Depletion of a Polo-like Kinase in Candida albicans Activates Cyclase-dependent Hyphal-like Growth Mol. Biol. Cell, May 1, 2003; 14(5): 2163 - 2180. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hazan and H. Liu Hyphal Tip-Associated Localization of Cdc42 Is F-Actin Dependent in Candida albicans Eukaryot. Cell, December 1, 2002; 1(6): 856 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Bensen, S. G. Filler, and J. Berman A Forkhead Transcription Factor Is Important for True Hyphal as well as Yeast Morphogenesis in Candida albicans Eukaryot. Cell, October 1, 2002; 1(5): 787 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-J. Hu, C. Bai, X.-D. Zheng, Y.-M. Wang, and Y. Wang Characterization and Functional Analysis of the Siderophore-Iron Transporter CaArn1p in Candida albicans J. Biol. Chem., August 16, 2002; 277(34): 30598 - 30605. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Warenda and J. B. Konopka Septin Function in Candida albicans Morphogenesis Mol. Biol. Cell, August 1, 2002; 13(8): 2732 - 2746. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||