![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 1, 195-210, January 2002





Division of Rheumatology and Immunology, Brigham and
Women's Hospital, Boston, Massachusetts 02115;
Cancer
Genetics, Columbia University, New York, New York 10032; and
§Max Delbrueck Center for Molecular Medicine, D-13092
Berlin, Germany
| |
ABSTRACT |
|---|
|
|
|---|
Environmental stress-induced phosphorylation of eIF2
inhibits
protein translation by reducing the availability of
eIF2-GTP-tRNAiMet, the ternary complex that joins initiator
tRNAMet to the 43S preinitiation complex. The resulting
untranslated mRNA is dynamically routed to discrete cytoplasmic foci
known as stress granules (SGs), a process requiring the related
RNA-binding proteins TIA-1 and TIAR. SGs appear to be in
equilibrium with polysomes, but the nature of this relationship is
obscure. We now show that most components of the 48S preinitiation
complex (i.e., small, but not large, ribosomal subunits, eIF3, eIF4E, eIF4G) are coordinately recruited to SGs in arsenite-stressed cells. In
contrast, eIF2 is not a component of newly assembled SGs. Cells
expressing a phosphomimetic mutant (S51D) of eIF2
assemble SGs of
similar composition, confirming that the recruitment of these factors
is a direct consequence of blocked translational initiation and not due
to other effects of arsenite. Surprisingly, phospho-eIF2
is
recruited to SGs that are disassembling in cells recovering from
arsenite-induced stress. We discuss these results in the context of a
translational checkpoint model wherein TIA and eIF2 are functional
antagonists of translational initiation, and in which lack of ternary
complex drives SG assembly.
| |
INTRODUCTION |
|---|
|
|
|---|
Stress granules (SGs) are discrete cytoplasmic foci at which
untranslated mRNAs accumulate in cells subjected to environmental stress (Nover et al., 1983
, 1989
; Scharf et al.,
1998
; Kedersha et al., 1999
, 2000
). In mammalian cells, the
assembly of SGs is initiated by the phosphorylation of eIF2
(Kedersha et al., 1999
), a translation initiation factor
that loads the initiator tRNA onto the small ribosomal subunit
(reviewed by Berlanga et al., 1998
; Gray and Wickens, 1998
).
Phosphorylation of eIF2
inhibits protein translation and promotes
the accumulation of untranslated mRNA (Farrell et al., 1977
;
Srivastava et al., 1998
). The related RNA-binding proteins
TIA-1 and TIAR act downstream of the phosphorylation of eIF2
to
recruit these untranslated mRNAs to SGs (Kedersha et al.,
1999
). By sequestering untranslated mRNA from the translational machinery, SGs have been proposed to determine the duration of stress-induced translational arrest (Kedersha et al., 1999
).
Because heat-shock transcripts are excluded from the SGs found in
heat-shocked plant cells (Nover et al., 1983
), this
mechanism might explain, in part, the preferential translation of
heat-shock transcripts in stressed cells.
Although the sequestration of mRNA at SGs is likely to contribute to
stress-induced translational arrest, SGs are not passive repositories
of untranslated mRNA. The different effects of drugs that stabilize or
destabilize polysomes (i.e., emetine and puromycin, respectively) on
the assembly of SGs indicate that mRNA can move between polysomes and
SGs (Kedersha et al., 2000
). Although the rate at which mRNA
moves in and out of SGs has not been directly measured,
poly(A)+ binding protein I (PABP-I), a marker of
poly(A)+ RNA, rapidly shuttles in and out of SGs
(~50% of SG-associated PABP-I is replaced every 20 s). The
shuttling of TIA-1 is ~10 times faster than that of PABP-I (~50%
of SG-associated TIA-1 is replaced every 2 s). Given these
kinetics, and considering that a dominant negative mutant of TIA-1
prevents SG assembly altogether (Kedersha et al., 1999
), it
appears that TIA-1 escorts untranslated mRNA to SGs. The dynamic
shuttling of SG-associated mRNA and protein led us to postulate that
SGs may be sites of mRNA triage at which untranslated mRNAs are sorted
and processed for either reinitiation, degradation, or packaging into
stable nonpolysomal messenger ribonucleoprotein (mRNP) complexes
(Kedersha et al., 2000
).
The ability of phospho-eIF2
to drive mRNA from polysomes to SGs
suggests that impaired translational initiation might contribute to the
assembly of SGs. The highly dynamic nature of SG proteins revealed by
measuring fluorescent recovery after photobleaching of green
fluorescent protein (GFP)-TIA-1 and GFP-PABP suggested that biochemical
purification of intact SGs might be impossible. We therefore used
immunofluorescence microscopy to determine whether known translation
initiation factors are components of SGs. With the exception of eIF2,
components of the 48S preinitiation complex (i.e., eIF3, eIF4E, eIF4G,
and small, but not large, ribosomal subunits) are selectively recruited
to arsenite- or eIF2
(S51D)-induced SGs. SGs can also be induced by
energy starvation under conditions that do not induce eIF2
phosphorylation, suggesting that the proximal trigger for SG assembly
may be the reduced availability of
eIF2-GTP-tRNAiMet rather than eIF2
phosphorylation per se. We propose a model wherein eIF2-deficient 48S
complexes assembled in stressed cells are recruited by TIA-1/TIAR into SGs.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines
COS7 and DU145 cell lines were obtained from American Type Culture Collection (Rockville, MD) and cultured in DMEM with 10% fetal bovine serum, in a CO2 incubator using 7% CO2.
Antibodies and Reagents
Anti-TIA-1/R hybridoma (3E6) was raised in our laboratory as
described previously (Taupin et al., 1995
). Antibodies
against hemagglutinin (HA) were obtained from Berkeley Antibody
(Berkeley, CA). Antibodies against phospho-eIF2
and HSP27 were
obtained from StressGen Biotechnologies (British Columbia, Victoria,
Canada). A different polyclonal antibody against phospho-eIF2
was
obtained from Research Genetics (Huntsville, AL) and gave similar
results to those obtained with the StressGen antibody. Monoclonal
antibodies against eIF4E, eIF4G, and eIF5 were obtained from
Transduction Laboratories (Lexington, KY). Polyclonal affinity-purified
goat antibodies against TIA-1, eIF-2
, and eIF4G, and rabbit
antibodies against eIF5 were obtained from Santa Cruz Biotechnology
(Santa Cruz, CA). Rabbit antibody against PHAS-I (eIF4E-BP) was
obtained from Zymed Laboratories (South San Francisco, CA). Human
auto-antisera against ribosomal P antigen was obtained from
ImmunoVision (Springdale, AR). Affinity-purified goat polyclonal
antibody against eIF3 was a kind gift from John Hershey (University of
California, Davis, Davis, CA). Anti-HuR was a kind gift from Imed
Gallouzi (Yale University, New Haven, CT). Anti-heterogeneous nuclear
ribonucleoprotein (hnRNP) C and anti-PABP (monoclonal 10E10) were a
kind gift from Gideon Dreyfuss (University of Pennsylvania, School of
Medicine, Philadelphia, PA). Anti-eIF-2
monoclonal antibody
was a kind gift from Dr. Richard Panniers (National Institutes of
Health, Bethesda, MD). Antibodies against eIF2B
were generously
provided by Scot Kimball (Pennsylvania State University College of
Medicine, Hershey, PA). Affinity-purified antibodies against small
ribosomal subunit proteins S3a and S19 were described previously
(Lutsch et al., 1990
). Affinity-purified antibodies against
ribosomal proteins L5 and L37 were prepared from antisera obtained from a rabbit (L5) or a sheep (L37) immunized with purified proteins from
rat liver ribosomes. Antisera were fractionated by 35% ammonium sulfate precipitation, dialyzed against phosphate-buffered saline (PBS), and purified against ribosomal proteins bound to Sepharose. The
bound antibodies were eluted using 3.0 M sodium thiocyanate in PBS,
dialyzed against PBS, and tested for subunit specificity by
immunoblotting against purified ribosomal subunits.
Secondary antibody conjugates (donkey anti-mouse, rabbit, goat, or
human; all ML grade) conjugated to Cy2 or Cy3 were obtained from
Jackson Immunoresearch Laboratories (West Grove, PA). Sodium arsenite, oligomycin, 2-deoxyglucose, carbonyl cyanide
p-trifluoromethoxyphenylhydrazone (FCCP), emetine,
diphenyleneiodonium chloride (DPI), and puromycin were purchased from
Sigma (St. Louis, MO).
Immunofluorescence and In Situ Fluorescence Staining
Cells were grown on coverslips, treated with arsenite or other
drugs as indicated in the figure legends, fixed, and stained for either
protein as described previously (Kedersha et al., 1999
), or
processed for fluorescent in situ poly(A)+ RNA
detection in combination with immunofluorescence protein detection. For
in situ staining, cells were fixed in 4% paraformaldehyde, postfixed
and permeabilized in absolute methanol, and equilibrated with 50 mM
Tris buffer pH 7.5. Cells were hybridized to an end-labeled biotinylated oligo-dT (50 nucleotides; Invitrogen, Carlsbad, CA) by using a commercially available kit (mRNA Locator-Hyb kit; Ambion, Austin, TX), at 45° for 4 h. After washing with buffers supplied in the kit, the cells were equilibrated with 2× SSC containing 0.1%
Triton X-100 (Sigma), supplemented with goat antibodies against anti-TIA-1 (Santa Cruz Biotechnology) and containing Alexa-594-labeled strepavidin (Molecular Probes, Eugene, OR) diluted 1/2000. After a 1-h
incubation, cells were washed in 2× SSC and then incubated for 1 h in donkey anti-goat Cy antibody (1/200 dilution) and 0.5 µg/ml
Hoechst dye. Cells were washed and mounted, and specimens were viewed
using a Nikon Eclipse 800 microscope. Images were digitally captured
using a charge-coupled device-SPOT RT digital camera and compiled using
Adobe Photoshop software (version 5.5; Adobe Systems, Mountain View, CA).
Sucrose Gradient Analysis
DU145 cells were plated and used within 48 h of plating, at ~90% confluence. Monolayers were washed with Hanks' balanced salt solution, incubated in Hanks' balanced salt solution containing 10 µg/ml cycloheximide for 5 min, and then scrape harvested and centrifuged. Pellets were lysed in 0.5 ml of ice-cold lysis buffer (140 mM KCl, 1 mM dithiothreitol, 20 mM Tris pH 8, 5 mM MgCl2, 0.5% NP-40, 0.5 U/ml RNAsin [Promega, Madison, WI], 10 mM cycloheximide) containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 5 µM leupeptin, 5 mM benzamidine, 5 µg/ml aprotinin), phosphotase inhibitors (1.0 mM sodium vanadate and 50 mM sodium fluoride), and 0.5 mM GMP-PNP (Roche Molecular Biochemicals, Indianapolis, IN). The cells suspension was mechanically disrupted using 12 strokes of a Teflon-glass homogenizer at low speed on ice. Nuclei were pelleted at low speed, and the postnuclear supernatant was subjected to microfuge centrifugation for 20 min at 14,000 × g. The resulting supernatant was then layered onto preformed 10-47% linear sucrose gradients (made up in 140 mM KCl, 1 mM dithiothreitol, 20 mM Tris-HCl pH 8, 5 mM MgCl2) over a 60%-0.5-ml sucrose cushion in 11-ml tubes. Centrifugation was performed at 40,000 rpm for 2 h 45 min by using a Beckman SW40Ti rotor. Gradients were eluted from the top by using a Brandel elution system (Brandel, Gaithersburg, MD). The eluate was continuously monitored at 254 nm using an ISCO UA5 UV monitor (ISCO, Lincoln, NE). Fractions were collected from the top of the gradient. Aliquots of individual fractions were acetone precipitated to remove sucrose and to concentrate the samples, resuspended in SDS-sample buffer, and processed for Western blot analysis.
Plasmid Construction
The plasmids encoding wild-type and the mutant eIF2
(S51D)
were a gift from Dr. Randal Kaufman (University of Michigan, Ann Arbor,
MI). The coding region of each plasmid was cloned in frame into the
pMT2-HA vector by using a polymerase chain reaction (PCR) strategy. The
coding region was amplified from PETF-VA-eIF2
wt or PETF-VA-eIF2S51D
mutant for 30 cycles (94°C for 1 min, 50°C for 1 min, and 74°C
for 1 min) using Tli polymerase (Promega) and primers with
EcoRI and XbaI cloning sites
(GGGAATTCATGCCGGGTCTAAGTTGTAGATTTTA and GCTCTAGATTAATCTTCAGCTTTGGCT),
respectively. The inserts were cut with EcoRI and
XbaI and cloned in-frame with an HA tag in pMT2 that was
similarly cut. The plasmid encoding pCDNA3-HA-eIF2
was obtained by
using PCR to amplify the coding region from pGEX-2T-eIF2
, a generous
gift from Drs. Supratik Das and Umadas Maitra (Albert Einstein College
of Medicine, Yeshiva University, Bronx, NY) with the primers
CGCGGATCCATGTCTGGGGACGAGATG and CCGGAATTCTTAGTTAGCTTTGGCACG. The PCR
product was cloned into pCDNA3 in-frame with the N-terminal HA tag at
the BamHI and EcoRI sites. The plasmid encoding
pCDNA3 HA-eIF3p48/int6 was constructed by in-frame ligation into pcDNA3 N-terminal HA of the ClaI modified, high-fidelity pfu
polymerase-amplified open reading frame (ORF), starting from the second
codon, by using human PBL cDNA and the primers
AGAGAGATCGATCCTACTGGAGACTTTGATTCG and AGAGA GATCGATAC-CGAGTACACAGTGGCAGCT. The final clones were verified by sequencing.
COS Cell Transfections
COS7 cells were transfected using SuperFect (QIAGEN, Valencia, CA) according to the manufacturer's instructions. Cells plated in six-well plates (2 × 105 cells/well plated 20 h before transfection) were transfected for 2-4 h then trypsinized and replated into parallel plates for immunofluorescence (24-well plates containing 11-mm coverslips).
| |
RESULTS |
|---|
|
|
|---|
Small, but not Large, Ribosomal Subunits Are Components of SGs
Stress-induced phosphorylation of the translation initiation
factor eIF2
has profound effects on protein translation. Although the translation of most mRNAs is reduced, the translation of mRNAs encoding heat-shock proteins and stress-induced transcription factors
(e.g., GCN4 in yeast and ATF4 in mammals; Hinnebusch, 1996
, 1997
;
Harding et al., 2000
) is enhanced in response to
phospho-eIF2
. In plant cells, the untranslated mRNAs that accumulate
in heat-stressed cells are concentrated at discrete cytoplasmic foci
known as heat-shock granules (Nover et al., 1989
). In
mammalian cells, poly(A)+ RNA accumulates at
similar cytoplasmic foci in response to environmental stress (Kedersha
et al., 1999
). It remains to be determined whether mammalian
SGs are sites at which untranslated mRNAs are sequestered from the
translational machinery or sites at which selected mRNAs are
actively translated during stress. To distinguish between these
possibilities, we used two-color immunofluorescence microscopy to
determine whether ribosomes are components of mammalian SGs. Arsenite-stressed DU145 cells were probed using antibodies reactive with TIA-1/R and either ribosomal protein S3/3a (Figure
1A), ribosomal protein S19 (Figure
1B), ribosomal protein L5 (Figure 1D), ribosomal protein L37 (Figure
1E), or ribosomal protein Po (Figure 1F). As found previously, arsenite
treatment causes most of the cytoplasmic TIA-1 and TIAR to accumulate
at SGs in these cells (Figure 1, A, B, D-F; top, green). In paired
views of the same fields, antibodies specific for small ribosomal
subunit proteins S3/3a and S19 (Figure 1, A and B; middle, red) reveal
that a significant fraction of the small ribosomal subunits accumulates
at the TIA-1/R+ SGs (yellow arrows; merged views
are shown in the bottom panels). The subset of small ribosomal subunits
present in SGs is also coincident with eIF3 (Figure 1C, green),
suggesting that the small ribosomal subunits found at SGs are
components of preinitiation complexes. Consistent with this notion,
components of the large ribosomal subunit (L5, L37, and Po) do not
accumulate at TIA-1/R+ SGs (Figure 1, D-F;
middle, red). The merged views (Figure 1, bottom) confirm the absence
of large ribosomal proteins at TIA-1/R+ SGs
(arrowheads reveal green SGs). These results suggest that small, but
not large, ribosomal subunits are components of mammalian SGs.
|
To address the issue of whether TIA-1 associates with small
ribosomal subunits using biochemical means, we fractionated lysates from DU145 cells cultured in the absence or presence of arsenite (0.5 mM, 30 min) on 10-47% sucrose gradients, and analyzed individual fractions for the presence of small and large ribosomal subunits, eIF3,
eIF4E, and TIA-1 by immunoblotting. Control cell
lysates yielded UV254 absorbance profiles
containing the expected peaks corresponding to 40S and 60S ribosomal
subunits as well as intact 80S ribosomes (Figure 1G). Fractions at
higher densities contain polysomes that include both small and large
ribosomal subunits (fractions 12-16). In lysates prepared from
arsenite-treated cells, polysomes have completely dispersed, and the
80S peak has correspondingly increased. The major fraction of both
eIF4E and TIA-1 is found in the soluble material which does not enter
the gradient, but substantial amounts of each protein cosediment with
the fractions containing 40-60S ribosomal subunits (Figure 1, G and H,
fractions 4-6). As expected of a protein component of a particle with
a mass of ~600,000 (Hershey et al., 1996
), eIF3p110 is not
found among soluble proteins at the top of the gradient (i.e., fraction 1). Roughly half of eIF3 appears in fractions 2 and 3, apparently not
associated with preinitiation complexes. Most of the remaining eIF3 is
present in fractions 4 and 5, coincident with small ribosomal subunits.
Surprisingly, the distribution of all of these proteins within the
sucrose gradient is not significantly altered by arsenite-induced oxidative stress, despite their relocalization into SGs (Figure 1,
A-C). Although we do not know whether SGs maintain their structural integrity during cell fractionation and sucrose gradient
centrifugation, the only fractions that contain all SG constituents are
fractions 4 and 5, which sediment at ~50S. If a subset of SG
components survives sucrose gradient centrifugation, these components
are likely to migrate at the position expected of the 48S preinitiation complex.
Components of 48S Preinitiation Complex Are Selectively Recruited to SGs
The absence of large ribosomal subunits eliminates the possibility
that SGs are sites of privileged translation during stress. Because only the eIF3-colocalized fraction of the total detectable small ribosomal subunits was associated with SGs, we reasoned that the
SG-associated small ribosomal subunits might represent 48S
preinitiation complexes (which include mRNA and the small, but not the
large, ribosomal subunit). We therefore used immunofluorescence microscopy to compare the subcellular localization of TIA-1 or TIAR+ SGs and individual components of the
translation initiation apparatus in arsenite-stressed (0.5 mM, 1 h) DU145 cells. In the survey shown in Figures
2 and 3,
the top panels show the localization of TIA-1/R+
SGs (green). In paired views of the same fields, the middle panels show
the localization of the indicated translation initiation factors (red).
The bottom panels show the merged images. Arrows indicate
TIA-1+ SGs to which initiation factors are
recruited in the paired views, whereas arrowheads indicate
TIA-1+ SGs to which the indicated translation
initiation factors are not recruited. This analysis reveals that eIF3,
eIF4E, eIF4G, the RNA-binding protein HuR, and
poly(A)+ RNA are highly concentrated at SGs,
whereas eIF-2
, eIF5, PHAS-I/eIF4E-BP1, HSP27, and eIF2B
do not
accumulate at SGs. HSP27, which was previously shown to be present in
heat-shock-induced SGs, is not a component of arsenite-induced SGs
(Figure 3B, red). To ensure antibody specificity, two different
commercial antibodies were used against eIF-4E and eIF-4G and gave
identical results (our unpublished data). To confirm that eIF3, but not
eIF2, is a component of SGs, we constructed expression vectors encoding
HA-eIF2
, HA-eIF2
, and HA-p48/int-6 (a subunit of eIF3), so as to
detect these different subunits by using the same anti-HA antibody. In
COS transfectants, immunofluorescence microscopy with anti-HA revealed
that each of these recombinant proteins is distributed between nuclear
and cytoplasmic compartments (Figure 4,
A-C; top, green). The subcellular localization of TIA-1 is shown in
paired views of the same fields (Figure 4, A-C; middle, red). The
merged views (Figure 4, A-C) are shown in the bottom panels. In
untreated cells, there is little or no colocalization of either
HA-eIF2
or HA-eIF2
with TIA-1 (Figure 4, A and B). In contrast,
HA-p48 eIF3 accumulates at cytoplasmic foci that include TIA-1 in
~50% of the transfected cells (Figure 4C, arrows). In response to
arsenite-induced oxidative stress, HA-p48eIF3 (Figure 4F, arrows), but
not HA-eIF2
(Figure 4D, arrowheads) or HA-eIF2
(Figure 4E,
arrowheads), is recruited to TIA-1+ SGs (Figure
4, D-F; middle, red) in 100% of the transfected cells. These results
confirm that eIF3, but not eIF2, is a component of SGs and supports the
concept that SGs are sites at which eIF2/ternary complex-deficient
preinitiation complexes accumulate during stress.
|
|
|
Coordinate Recruitment and Dispersal of eIFs during Assembly and Disassembly of SGs
The above-mentioned compositional analysis suggested that
poly(A)+ mRNA is recruited to SGs as a component
of a modified 48S preinitiation complex. If this is true, individual
components of the mRNP complex should be coordinately recruited
to, and dispersed from, assembling and disassembling SGs. In cells
pulsed with a sublethal dose of arsenite, SGs that assemble in response
to the initial stress spontaneously disperse as cells recover (Kedersha
et al., 1999
). We used this system to determine whether SG
components are coordinately recruited to, and dispersed from, SGs.
DU145 cells were pulsed with a sublethal dose of arsenite (1.0 mM, 30 min) and then allowed to recover in media without arsenite. Cells were
fixed at different times and SG composition was assessed by using
immunofluorescence. Nascent SGs are small and dispersed throughout the
cell; they later coalesce into larger, perinuclear structures as
previously shown using GFP-TIA-1 in live cells (Kedersha et
al., 2000
). In unstressed cells, eIF3 is diffusely present in the
cytoplasm (Figure 5A; red), whereas
TIA-1/R is distributed between the nucleus and the cytoplasm in a
micropunctate pattern (Figure 5, row A; detected using an antibody that
sees both TIA-1 and TIAR, shown in green). In cells subjected to
arsenite treatment, eIF3 (red) is recruited to SGs with similar
kinetics as TIA-1/R (green) during both stress and recovery (Figure 5,
B-F). Even during the earliest stages of SG assembly (i.e., after 30 min of exposure to arsenite; Figure 5B), eIF3 is present in the
smallest SGs, coincident with SGs containing TIA-1/R (Figure 5B,
arrows); this colocalization appears yellow in the merged view. After
the removal of arsenite, eIF3 and TIA-1/R continue to accumulate at
SGs, which become less numerous but progressively enlarge over the
first 2 h of the recovery phase. During the 3rd h of recovery, SGs
are disassembled, allowing TIA-1/R and eIF3 to return to their original
subcellular locales (Figure 5F). Thus, eIF3 is recruited to SGs in
parallel with TIA-1/R during SG assembly and disassembly, and is
recruited to SGs very early during their assembly. Similar time course
experiments were performed to determine whether
poly(A)+ RNA, eIF4E, PABP, and the ELAV protein
HuR are coordinately recruited to SGs with TIA-1 and TIAR. As shown in
the abbreviated analysis in Figure 6,
each of these mRNP components is coordinately recruited to, and
dispersed from, SGs. Similar results were seen with eIF4G and small
ribosomal subunit S3 (our unpublished data). These results suggest that
poly(A)+ RNA moves in and out of SGs as a
component of a modified 48S preinitiation complex.
|
|
Recruitment of Translation Initiation Factors to eIF2
(S51D)-induced SGs
Arsenite has complex effects on cells that are not limited to the
activation of eIF2
kinases (Bernstam and Nriagu, 2000
). We therefore
determined the composition of SGs that are assembled in COS cells
transfected with a phosphomimetic mutant of eIF2
(i.e., S51D), which
was previously shown to induce the assembly of
TIA-1+ SGs (Kedersha et al., 1999
).
Like arsenite-induced SGs, HA-tagged eIF2
(S51D)-induced SGs are
dispersed by cycloheximide or emetine (our unpublished data),
suggesting that they are in dynamic equilibrium with polysomes as are
arsenite-induced SGs. As shown using antibodies reactive with the HA
tag (Figure 7A; red), recombinant
HA-eIF2
(S51D) is distributed diffusely throughout the cell, but a
minor fraction of it is clearly localized to the
TIA-1+ SGs that it induces (Figure 7A; green;
white arrow points out SG). HA-eIF2
(S51D)-induced SGs strongly
recruit ribosomal protein S3a (Figure 7B; red), eIF3 (Figure 7D; red),
eIF4E (Figure 7E; red), and eIF4G (Figure 7F; red), because these
proteins are clearly concentrated at SGs, which appear yellow in the
merged views shown at the bottom of each column (yellow arrows).
Weaker, partial recruitment of ribosome Po antigen (Figure 7C; red) and
eIF5 (Figure 7G; red) is observed (white arrows), in contrast to
results obtained with arsenite-induced SGs (Figures 1F and 2E,
respectively), suggesting that these factors may be minor or transient
SG components that are only detectable when eIF2
is continuously
phosphorylated. HSP27 (Figure 7H; red) and eIF2B (our unpublished
data) are not recruited to HA-eIF2
(S51D)-induced SGs. These
results confirm earlier studies (Kedersha et al., 1999
)
reporting that HSP27 is a component of SGs induced by heat shock, but
not by other stimuli. Although HSP27 has been reported to coaggregate
with eIF4G and form insoluble cytosolic heat-shock granules, these were
reported to exclude eIF4E, eIF3, and PABP (Cuesta et al.,
2000
) based on sedimentation, suggesting that heat-shock granules are
distinct from SGs. The RNA-binding protein HuR was reported to form
cytosolic aggregates in response to heat shock (Gallouzi et
al., 2000
), leading us to examine its recruitment to SGs. We find
that HuR is recruited to HA-eIF2
(S51D)-induced
TIA-1+ SGs (Figure 7I; red, yellow arrows) and is
also recruited to arsenite-induced TIA-1+ SGs
(Figure 3D; red). As expected, the nonshuttling hnRNP C is not
recruited to HA-eIF2
(S51D)-induced SGs (Figure 7J; red) nor to
arsenite-induced SGs (our unpublished data). Thus, the minimal
"core" SG induced by expression of phosphomimetic eIF2
contains
eIF3, eIF4E, eIF4G, and HuR in addition to the previously reported
TIA-1, TIAR, PABP-I, and poly(A)+ RNA (Kedersha
et al., 1999
).
|
The association of small, but detectable, amounts of
phosphomimetic HA-eIF2
(S51D) with the SGs that it induces (Figure
7A) suggested that phospho-eIF2
, which constitutes a subset of total eIF2
, might be selectively recruited to SGs (as opposed to total eIF2
, which did not appear to be a component of arsenite-induced nascent SGs as shown in Figures 2A and 4D). To examine this
possibility, we used antibodies specific for phospho-eIF2
to monitor
to its localization during SG assembly/disassembly (Figure
8). In the absence of stress, the
phospho-eIF2
antibodies reveal nonspecific nuclear staining (Figure
8A; red). This weak nuclear staining was detected using antibodies from
two different commercial sources and probably represents weak
cross-reactivity against the very abundant nuclear phosphoproteins
(e.g., histones). Although 30 min of arsenite treatment (Figure 8B)
clearly elevates the cytoplasmic phospho-eIF2
signal, there is no
colocalization with TIA-1+ SGs (Figure 8B, white
arrows; SGs appear green in the merged field). After 30 min of
recovery, TIA-1+ SGs increase in size (Figure 8C;
green, arrows), but very little phospho-eIF-2
is present at the SGs
(Figure 8C; red). As recovery progresses, and the total amount of
phospho-eIF-2
decreases, the residual phospho-eIF2
is
quantitatively found at SGs (Figure 8, D and E). The levels of
cytoplasmic phospho-eIF2
detected by immunofluorescence parallel
those shown by Western blot on identically treated samples (Figure 8G),
and similar results were obtained using antibodies from two different
commercial sources. It therefore appears that although eIF2
phosphorylation initiates SG assembly, little if any phospho-eIF2
is
physically present within nascent SGs. It is only during recovery, when
the amount of total phospho-eIF2
is reduced relative to the amount
produced during the initial 30-min exposure (Figure 8G, compare lane E with lane B) and only a minor percentage of the cells have SGs, that
phospho-eIF2
is localized to the SG. That this result is real and
not due to some nonspecific effects of the antibody is supported by the
detection of a small but consistent amount of phophomimetic
HA-eIF2
S51D at SGs (Figure 8H), as detected with anti-HA antibodies.
The limited colocalization of the phosphomimetic HA-eIF2
S51D at SGs
suggests that these are compositionally similar to "late" SGs
rather than "early" ones.
|
Energy Depletion Induces SGs without Inducing Phosphorylation of
eIF2
Phosphorylation of eIF2
arrests translation by limiting the
amount of eIF2-GTP-tRNAiMet ternary
complex; this occurs because eIF2(
P)GDP acts as competitive inhibitor of eIF2B, the guanine nucleotide exchange factor that allows
eIF2 to exchange GDP for GTP. Only eIF2-GTP can bind
met-tRNAi and yield the
eIF2-GTP-tRNAiMet ternary complex
that is required for initiation (reviewed by Trachsel, 1996
). The
exchange of eIF2-GDP for eIF2-GTP is also impaired by a low cellular
GTP/GDP ratio in vitro, leading to ternary complex deficiency and
impaired translation (Walton and Gill, 1976
; Hucul et al.,
1985
). We therefore treated cells with a variety of drugs that deplete
intracellular energy stores to determine whether energy starvation
could induce SGs independently of eIF2
phosphorylation. Brief
treatment with inhibitors of glycolysis (2-deoxyglucose; Figure
9B), mitochondrial membrane potential (ionophore FCCP; Figure 9C), and the mitochondrial ATPase (oligomycin; Figure 9D) induce the assembly of SGs. Double staining for
phospho-eIF2
(Figure 9; red) reveals that these SGs are assembled in
cells in which there is no detectable increase in eIF2
phosphorylation (Figure 9, B-D; red) relative to the control (Figure
9A; red). In contrast, both arsenite (Figure 9E) and DPI, a specific
inhibitor of flavin-dependent oxidoreductase (Figure 9F), induce SGs
concurrently with elevated phospho-eIF2
. Immunofluorescence was used
to verify that SGs induced by energy starvation contain other SG
markers including poly(A)+ RNA and eIF3 (our
unpublished data). These treatments were insufficient to induce
apoptosis, e.g., washing out the drugs allowed the cells to recover.
Western blot analysis with phosphospecific anti-eIF2
antibodies
confirms that 2-deoxyglucose, FCCP, and oligomycin do not induce the
phosphorylation of eIF2
(Figure 9, bottom; antibodies reactive with
TIAR were used to confirm equal loading between samples). We conclude
that energy depletion can induce SGs without increasing eIF2
phosphorylation. Energy starvation and concurrent reduced ATP/GTP
levels would affect on many facets of translation in addition to
ternary complex formation, such as amino acyl-tRNA charging, eIF4A,
eIF1A, and the termination events. However, the strong link between SG
assembly and phosphorylation of phospho-eIF2
leads us to favor the
possibility that reduced levels of GTP result in reduced levels of the
eIF2-GTP-tRNAiMet ternary complex,
and that the lack of ternary complex may drive SG formation, rather
than increased phospho-eIF2
per se.
|
| |
DISCUSSION |
|---|
|
|
|---|
Previous work from our lab and others (Nover et al.,
1989
; Kedersha et al., 1999
, 2000
) has established that SGs
are highly dynamic cytoplasmic foci at which
poly(A)+ RNA, TIA-1, TIAR, and PABP-I transiently
accumulate in response to stress-induced phosphorylation of eIF2
.
Both the RNA and protein components of SGs are in equilibrium with
polysomes, as evinced by the dispersal of SGs upon treatment of cells
with drugs that stabilize polysomes (e.g., emetine and cycloheximide),
and by the enhanced assembly of SGs in cells treated with drugs that destabilize polysomes (e.g., puromycin). Herein, we demonstrate that
SGs are not only in equilibrium with polysomes but also that they
contain many components of the classical cap-dependent 48S preinitiation complex, including eIF3, eIF4E, eIF4G, and small (but not
large) ribosomal subunits. Excluded from SGs are eIF2B, eIF5, HSP27,
the eIF4E-binding protein PHAS-I, and surprisingly, eIF2. The SGs
assembled in response to enforced expression of the S51D
phospho-mimetic mutant of eIF2
have a similar composition as those
induced by stress, suggesting that phosphorylation of eIF2
is
sufficient to recruit these eIFs to SGs. The ability of metabolic
poisons to induce the assembly of SGs without inducing the
phosphorylation of eIF2
suggests that the SG-initiating effects of
phospho-eIF2
are indirect. Both metabolic poisons and
phospho-eIF2
reduce the levels of
eIF2-GTP-tRNAiMet, however,
suggesting that it is the lack of ternary complex that initiates SG
formation rather than phosphorylation of eIF2
alone, although other
explanations are possible. The major components of SGs [i.e., TIA-1/R,
poly(A)+ mRNA, PABP-I (Kedersha et
al., 1999
), HuR, eIF3, eIF4E, and eIF4G (this study)], assemble
into/disassemble from SGs with similar kinetics, suggesting that they
are coordinately recruited to the SG as a complex. SG components that
survive sucrose gradient sedimentation appear to migrate at 40-50S,
consistent with our contention that SGs are composed of eIF2-deficient
preinitiation complexes.
Eukaryotic translational initiation in vitro (reviewed by Dever, 1999
;
Pestova and Hellen, 1999
; Hershey and Merrick, 2000
) begins with the
binding of eIF3 to the 40S ribosomal subunit. The subsequent
recruitment of eIF1A and
eIF2-GTP-tRNAiMet forms a 43S complex
that binds to the mRNA/eIF4E/eIF4G/PABP mRNP to produce the canonical
48S preinitiation complex. In stressed cells, components of the 48S
preinitiation complex (with the glaring exception of eIF2) are
coordinately recruited to SGs. These results suggest that ternary
complex-deficient "noncanonical" 48S complexes (hereafter referred
to as 48S* complexes) are core constituents of SGs. The existence of
some type of eIF2-deficient 48S preinitiation complex has been proposed
to explain the preferential translation of stress-induced transcription
factors such as ATF4 in mammals (Harding et al., 2000
) and
GCN4 in yeast (Hinnebusch, 1996
, 1997
; Harding et al.,
2000
), both of which are preferentially translated during conditions of
eIF2
phosphorylation. Their transcripts possess long 5' untranslated
regions, which contain multiple small upstream ORFs, which prevent
translation by causing scanning ribosomes to terminate before they
reach the initiator codon of the stress-induced transcription factor.
In stressed cells, the reduced availability of
eIF2-GTP-tRNAiMet has been proposed
to allow the assembly of eIF2-deficient 48S preinitiation complexes
that scan past the upstream ORFs. When these eIF2-deficient 48S
complexes acquire eIF2-GTP-tRNAiMet before they
reach the initiation codon of the transcription factor, translation can
begin. Both the induction of SG assembly by phospho-eIF2
and the
composition of SGs suggest that they are comprised of 48S* complexes;
whether these are identical to those proposed to regulate the
translation of ATF4 and GCN4 remains to be determined.
We previously demonstrated that mRNA is in a dynamic equilibrium
between polysomes and SGs (Kedersha et al., 2000
), because treatment of SG-containing cells with emetine, a drug that
"freezes" ribosomes on their mRNA, shifts the distribution of TIA-1
toward the polysome fractions in sucrose gradients prepared from
arsenite-stressed cells (Kedersha et al., 2000
). If
eIF2-deficient 48S* preinitiation complexes comprise the basic unit of
SGs, the mechanism whereby this occurs becomes apparent. The assembly
of a TIA-1 containing scanning-incompetent/eIF2-deficient preinitiation
complex at the 5' end of a polysomal mRNA will allow elongating
ribosomes to "run off" the transcript, effectively converting the
mRNA from a polysome into a 48S* mRNP. Emetine treatment prevents this, allowing small amounts of TIA-1 to be shifted into the polysome region
of the gradient (Kedersha et al., 2000
). In the absence of
emetine, the 48S* complexes are routed into SGs by the self-aggregating prion-like domain of TIA-1. Within the SG "triage" environment, the
structure and composition of individual mRNPs could determine whether
mRNAs are repacked into mRNPs, reinitiated, silenced, or degraded
(Kedersha et al., 2000
). The recruitment of the
mRNA-stabilizing ELAV protein HuR to SGs supports this model, because
both mRNA-stabilizing and -destabilizing proteins would be required at
mRNA triage sites to determine the fates of individual transcripts.
Our data suggest that TIA-1/R and
eIF2-GTP-tRNAiMet may act as
functional antagonists to regulate the equilibrium between polysomes and SGs. This concept is supported by the following experimental observations: 1) the phosphomimetic eIF2
mutant (S51D) that reduces the concentration of active ternary complex promotes the assembly of
SGs (Kedersha et al., 1999
); 2) a nonphosphorylatable
eIF2
mutant (S51A) that prevents the stress-induced depletion of
active ternary complex inhibits arsenite-induced assembly of SGs
(Kedersha et al., 1999
); 3) overexpression of TIA-1
RRM, a
truncation mutant that sequesters endogenous TIA-1 and TIAR, prevents
SG assembly and promotes the expression of cotransfected reporter genes
(Kedersha et al., 2000
); and 4) overexpression of TIA-1
represses the expression of cotransfected reporter genes (Kedersha
et al., 2000
). The effects of recombinant TIA-1 and
TIA-1
RRM are observed in the absence of stress, suggesting that
these proteins might regulate the equilibrium between polysomal and
nonpolysomal mRNPs in both stressed and unstressed cells.
The finding that phospho-eIF2
is selectively recruited only to
disassembling SGs is remarkable, because it suggests that phospho-eIF2
may be required for SG disassembly. Because ternary complexes composed of phospho-eIF2
can initiate a single round of
translation in vitro (reviewed by Trachsel, 1996
), it is possible that
such phospho-eIF2
ternary complexes are actually required to
displace TIA-1/R from 48S* complexes and allow the restoration of
normal initiation. Such a mechanism could explain the observed weak
recruitment of ribosomal Po and eIF5 to eIF2
(S51D)-induced SGs. In
this case, the SG-localized fraction of phosphomimetic eIF2
would be
present as ternary complex and initiate translation. Although the
extent to which the S51D mutant can be incorporated into ternary
complex is not known, most of the SGs it induces are slowly dispersed
upon cycloheximide treatment (our unpublished data), suggesting that
their component mRNAs are in equilibrium with polysomes.
In addition to their role as organizers of SGs during environmental
stress, TIA-1 and TIAR have been shown to selectively repress the
translation of TNF-
transcripts. In macrophages lacking TIA-1, the
polysome profile of tumor necrosis factor-
(TNF-
) transcripts is
shifted such that the percentage of TNF-
transcripts associated with
polysomes is increased compared with that of wild-type macrophages
(Piecyk et al., 2000
). This result suggests that TIA-1 represses the translation of TNF-
by promoting the assembly of a
nonpolysomal mRNP complex. We suggest that this complex is structurally equivalent to the 48S* mRNP. Because TIA-1 binds to an AU-rich element
in the 3'-untranslated region of TNF-
transcripts, the probability
that it will interact with an assembling preinitiation complex will be
markedly increased compared with other transcripts. The tethering of
TIA-1 to TNF-
transcripts would increase the percentage of these
transcripts found in nonpolysomal mRNP complexes, dampen the expression
of TNF-
, and increase the sensitivity of these transcripts to
regulatory control. In a similar manner, hnRNP K/E1, proteins that are
tethered to the 3'-untranslated region of 15-lipoxygenase transcripts,
induce the assembly of a translationally incompetent 48S preinitiation
complex (Ostareck et al., 2001
). The hnRNP K/E1 proteins act
by preventing the joining of the 60S ribosomal subunit (Ostareck
et al., 2001
), while allowing the small ribosomal subunit to
scan to the initiation codon, at which point the scanning is halted and
the transcript is silenced. Because
eIF2-GTP-tRNAiMet is required for the
initiator codon recognition, it is likely that TIA-1-induced 48S*
complexes promote translational silencing via a different mechanism.
Future experiments are needed to resolve this issue.
Assessing translational control mechanisms in the context of the intact
cell is complicated relative to the in vitro systems by the
multifunctional nature of shuttling proteins such as TIA-1, TIAR, and
HuR, which may perform different but related functions in the nucleus
and the cytoplasm. Recent reports indicate that TIA-1 regulates
specific mRNA splicing events (Del Gatto-Konczak et al.,
2000
; Forch et al., 2000
; Le Guiner et al.,
2001
), suggesting that an indirect function of SG assembly in the
cytoplasm may be the altered splicing of specific nuclear transcripts,
owing to the relocalization of TIA-1 from the nucleus to SGs. Indeed, the stress-induced relocalization of the shuttling protein hnRNP A1
from the nucleus to the cytoplasm appears to regulate pre-mRNA splicing
in vivo by such a mechanism (van der Houven van Oordt et
al., 2000
). The ability of TIA-1/R to recruit eIF-2-deficient 48S*
complexes to SGs demonstrates the modular and versatile nature of mRNA
binding proteins, and emphasizes that many aspects of mRNA metabolism
occur concurrent with the movement of mRNA between organelles or
subcellular domains.
| |
ACKNOWLEDGMENTS |
|---|
We thank members of the Anderson laboratory for helpful discussions. We thank Drs. Supratik Das, Gideon Dreyfuss, Imed Gallouzi, John Hershey, Randal Kaufman, Scot Kimball, Umadas Maitra, and Richard Panniers for generously providing many of the reagents used in this study. P.A. was supported by National Institutes of Health grant AI-33600 and a Biomedical Science Grant from the Arthritis Foundation.
| |
FOOTNOTES |
|---|
* Corresponding authors. E-mail addresses: panderson{at}rics.bwh.harvard.edu or nkedersha{at}rics.bwh.harvard.edu.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.01-05-0221. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.01-05-0221.
| |
ABBREVIATIONS |
|---|
Abbreviations used: eIF, eukaryotic initiation factor; PABP-I, poly(A)+ binding protein I; SG, stress granule.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Grousl, P. Ivanov, I. Frydlova, P. Vasicova, F. Janda, J. Vojtova, K. Malinska, I. Malcova, L. Novakova, D. Janoskova, et al. Robust heat shock induces eIF2{alpha}-phosphorylation-independent assembly of stress granules containing eIF3 and 40S ribosomal subunits in budding yeast, Saccharomyces cerevisiae J. Cell Sci., June 15, 2009; 122(12): 2078 - 2088. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mokas, J. R. Mills, C. Garreau, M.-J. Fournier, F. Robert, P. Arya, R. J. Kaufman, J. Pelletier, and R. Mazroui Uncoupling Stress Granule Assembly and Translation Initiation Inhibition Mol. Biol. Cell, June 1, 2009; 20(11): 2673 - 2683. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sukarieh, N. Sonenberg, and J. Pelletier The eIF4E-binding proteins are modifiers of cytoplasmic eIF4E relocalization during the heat shock response Am J Physiol Cell Physiol, May 1, 2009; 296(5): C1207 - C1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Thomas, L. J. M. Tosar, M. A. Desbats, C. C. Leishman, and G. L. Boccaccio Mammalian Staufen 1 is recruited to stress granules and impairs their assembly J. Cell Sci., February 15, 2009; 122(4): 563 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chalupnikova, S. Lattmann, N. Selak, F. Iwamoto, Y. Fujiki, and Y. Nagamine Recruitment of the RNA Helicase RHAU to Stress Granules via a Unique RNA-binding Domain J. Biol. Chem., December 12, 2008; 283(50): 35186 - 35198. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Buchan, D. Muhlrad, and R. Parker P bodies promote stress granule assembly in Saccharomyces cerevisiae J. Cell Biol., November 3, 2008; 183(3): 441 - 455. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zheng, N. Ezzeddine, C.-Y. A. Chen, W. Zhu, X. He, and A.-B. Shyu Deadenylation is prerequisite for P-body formation and mRNA decay in mammalian cells J. Cell Biol., October 23, 2008; 182(1): 89 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawahara, T. Imai, H. Imataka, M. Tsujimoto, K. Matsumoto, and H. Okano Neural RNA-binding protein Musashi1 inhibits translation initiation by competing with eIF4G for PABP J. Cell Biol., October 17, 2008; 181(4): 639 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kramer, R. Queiroz, L. Ellis, H. Webb, J. D. Hoheisel, C. Clayton, and M. Carrington Heat shock causes a decrease in polysomes and the appearance of stress granules in trypanosomes independently of eIF2{alpha} phosphorylation at Thr169 J. Cell Sci., September 15, 2008; 121(18): 3002 - 3014. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-E. Kim, I. Ryu, W. J. Kim, O.-K. Song, J. Ryu, M. Y. Kwon, J. H. Kim, and S. K. Jang Proline-Rich Transcript in Brain Protein Induces Stress Granule Formation Mol. Cell. Biol., January 15, 2008; 28(2): 803 - 813. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Farny, J. A. Hurt, and P. A. Silver Definition of global and transcript-specific mRNA export pathways in metazoans Genes & Dev., January 1, 2008; 22(1): 66 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kwon, Y. Zhang, and P. Matthias The deacetylase HDAC6 is a novel critical component of stress granules involved in the stress response Genes & Dev., December 15, 2007; 21(24): 3381 - 3394. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamasaki, G. Stoecklin, N. Kedersha, M. Simarro, and P. Anderson T-cell Intracellular Antigen-1 (TIA-1)-induced Translational Silencing Promotes the Decay of Selected mRNAs J. Biol. Chem., October 12, 2007; 282(41): 30070 - 30077. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Baguet, S. Degot, N. Cougot, E. Bertrand, M.-P. Chenard, C. Wendling, P. Kessler, H. Le Hir, M.-C. Rio, and C. Tomasetto The exon-junction-complex-component metastatic lymph node 51 functions in stress-granule assembly J. Cell Sci., August 15, 2007; 120(16): 2774 - 2784. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mazroui, S. Di Marco, R. J. Kaufman, and I.-E. Gallouzi Inhibition of the Ubiquitin-Proteasome System Induces Stress Granule Formation Mol. Biol. Cell, July 1, 2007; 18(7): 2603 - 2618. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Jeyaraj, D. Dakhlallah, S. R. Hill, and B. S. Lee Expression and distribution of HuR during ATP depletion and recovery in proximal tubule cells Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1255 - F1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stohr, M. Lederer, C. Reinke, S. Meyer, M. Hatzfeld, R. H. Singer, and S. Huttelmaier ZBP1 regulates mRNA stability during cellular stress J. Cell Biol., November 20, 2006; 175(4): 527 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dang, N. Kedersha, W.-K. Low, D. Romo, M. Gorospe, R. Kaufman, P. Anderson, and J. O. Liu Eukaryotic Initiation Factor 2{alpha}-independent Pathway of Stress Granule Induction by the Natural Product Pateamine A J. Biol. Chem., October 27, 2006; 281(43): 32870 - 32878. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Deigendesch, F. Koch-Nolte, and S. Rothenburg ZBP1 subcellular localization and association with stress granules is controlled by its Z-DNA binding domains Nucleic Acids Res., October 6, 2006; 34(18): 5007 - 5020. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mazroui, R. Sukarieh, M.-E. Bordeleau, R. J. Kaufman, P. Northcote, J. Tanaka, I. Gallouzi, and J. Pelletier Inhibition of Ribosome Recruitment Induces Stress Granule Formation Independently of Eukaryotic Initiation Factor 2{alpha} Phosphorylation Mol. Biol. Cell, October 1, 2006; 17(10): 4212 - 4219. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Guil, J. C. Long, and J. F. Caceres hnRNP A1 Relocalization to the Stress Granules Reflects a Role in the Stress Response Mol. Cell. Biol., August 1, 2006; 26(15): 5744 - 5758. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Vessey, A. Vaccani, Y. Xie, R. Dahm, D. Karra, M. A. Kiebler, and P. Macchi Dendritic localization of the translational repressor Pumilio 2 and its contribution to dendritic stress granules. J. Neurosci., June 14, 2006; 26(24): 6496 - 6508. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anderson and N. Kedersha RNA granules J. Cell Biol., March 13, 2006; 172(6): 803 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Kim, W. K. Dong, I. J. Weiler, and W. T. Greenough Fragile X Mental Retardation Protein Shifts between Polyribosomes and Stress Granules after Neuronal Injury by Arsenite Stress or In Vivo Hippocampal Electrode Insertion J. Neurosci., March 1, 2006; 26(9): 2413 - 2418. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Smith, S. C. Schmechel, A. Raghavan, M. Abelson, C. Reilly, M. G. Katze, R. J. Kaufman, P. R. Bohjanen, and L. A. Schiff Reovirus Induces and Benefits from an Integrated Cellular Stress Response J. Virol., February 15, 2006; 80(4): 2019 - 2033. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Suswam, Y. Y. Li, H. Mahtani, and P. H. King Novel DNA-binding properties of the RNA-binding protein TIAR Nucleic Acids Res., August 9, 2005; 33(14): 4507 - 4518. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Miyamoto, P. Patel, and J. W. B. Hershey Changes in Ribosomal Binding Activity of eIF3 Correlate with Increased Translation Rates during Activation of T Lymphocytes J. Biol. Chem., August 5, 2005; 280(31): 28251 - 28264. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. McInerney, N. L. Kedersha, R. J. Kaufman, P. Anderson, and P. Liljestrom Importance of eIF2{alpha} Phosphorylation and Stress Granule Assembly in Alphavirus Translation Regulation Mol. Biol. Cell, August 1, 2005; 16(8): 3753 - 3763. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. McDunn and J. P. Cobb That Which Does Not Kill You Makes You Stronger: A Molecular Mechanism for Preconditioning Sci. Signal., July 5, 2005; 2005(291): pe34 - pe34. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kedersha, G. Stoecklin, M. Ayodele, P. Yacono, J. Lykke-Andersen, M. J. Fritzler, D. Scheuner, R. J. Kaufman, D. E. Golan, and P. Anderson Stress granules and processing bodies are dynamically linked sites of mRNP remodeling J. Cell Biol., June 20, 2005; 169(6): 871 - 884. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. McEwen, N. Kedersha, B. Song, D. Scheuner, N. Gilks, A. Han, J.-J. Chen, P. Anderson, and R. J. Kaufman Heme-regulated Inhibitor Kinase-mediated Phosphorylation of Eukaryotic Translation Initiation Factor 2 Inhibits Translation, Induces Stress Granule Formation, and Mediates Survival upon Arsenite Exposure J. Biol. Chem., April 29, 2005; 280(17): 16925 - 16933. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. TEIXEIRA, U. SHETH, M. A. VALENCIA-SANCHEZ, M. BRENGUES, and R. PARKER Processing bodies require RNA for assembly and contain nontranslating mRNAs RNA, April 1, 2005; 11(4): 371 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Kim, S. H. Back, V. Kim, I. Ryu, and S. K. Jang Sequestration of TRAF2 into Stress Granules Interrupts Tumor Necrosis Factor Signaling under Stress Conditions Mol. Cell. Biol., March 15, 2005; 25(6): 2450 - 2462. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wilczynska, C. Aigueperse, M. Kress, F. Dautry, and D. Weil The translational regulator CPEB1 provides a link between dcp1 bodies and stress granules J. Cell Sci., March 1, 2005; 118(5): 981 - 992. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Shenberger, J. L. Myers, S. G. Zimmer, R. J. Powell, and A. Barchowsky Hyperoxia alters the expression and phosphorylation of multiple factors regulating translation initiation Am J Physiol Lung Cell Mol Physiol, March 1, 2005; 288(3): L442 - L449. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Thomas, L. J. M. Tosar, M. Loschi, J. M. Pasquini, J. Correale, S. Kindler, and G. L. Boccaccio Staufen Recruitment into Stress Granules Does Not Affect Early mRNA Transport in Oligodendrocytes Mol. Biol. Cell, January 1, 2005; 16(1): 405 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, M. Simarro, N. Kedersha, and P. Anderson FAST Is a Survival Protein That Senses Mitochondrial Stress and Modulates TIA-1-Regulated Changes in Protein Expression Mol. Cell. Biol., December 15, 2004; 24(24): 10718 - 10732. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gilks, N. Kedersha, M. Ayodele, L. Shen, G. Stoecklin, L. M. Dember, and P. Anderson Stress Granule Assembly Is Mediated by Prion-like Aggregation of TIA-1 Mol. Biol. Cell, December 1, 2004; 15(12): 5383 - 5398. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cande, N. Vahsen, D. Metivier, H. Tourriere, K. Chebli, C. Garrido, J. Tazi, and G. Kroemer Regulation of cytoplasmic stress granules by apoptosis-inducing factor J. Cell Sci., September 1, 2004; 117(19): 4461 - 4468. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anderson, K. Phillips, G. Stoecklin, and N. Kedersha Post-transcriptional regulation of proinflammatory proteins J. Leukoc. Biol., July 1, 2004; 76(1): 42 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cougot, S. Babajko, and B. Seraphin Cytoplasmic foci are sites of mRNA decay in human cells J. Cell Biol., April 12, 2004; 165(1): 31 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ma and L. M. Hendershot Herp Is Dually Regulated by Both the Endoplasmic Reticulum Stress-specific Branch of the Unfolded Protein Response and a Branch That Is Shared with Other Cellular Stress Pathways J. Biol. Chem., April 2, 2004; 279(14): 13792 - 13799. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Sheth and R. Parker Decapping and Decay of Messenger RNA Occur in Cytoplasmic Processing Bodies Science, May 2, 2003; 300(5620): 805 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tourriere, K. Chebli, L. Zekri, B. Courselaud, J. M. Blanchard, E. Bertrand, and J. Tazi The RasGAP-associated endoribonuclease G3BP assembles stress granules J. Cell Biol., March 17, 2003; 160(6): 823 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Le Guiner, M.-C. Gesnel, and R. Breathnach TIA-1 or TIAR Is Required for DT40 Cell Viability J. Biol. Chem., March 14, 2003; 278(12): 10465 - 10476. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Kimball, R. L. Horetsky, D. Ron, L. S. Jefferson, and H. P. Harding Mammalian stress granules represent sites of accumulation of stalled translation initiation complexes Am J Physiol Cell Physiol, February 1, 2003; 284(2): C273 - C284. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mazroui, M.-E. Huot, S. Tremblay, C. Filion, Y. Labelle, and E. W. Khandjian Trapping of messenger RNA by Fragile X Mental Retardation protein into cytoplasmic granules induces translation repression Hum. Mol. Genet., November 15, 2002; 11(24): 3007 - 3017. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, Y. Li, N. Kedersha, P. Anderson, M. Emara, K. M. Swiderek, G. T. Moreno, and M. A. Brinton Cell Proteins TIA-1 and TIAR Interact with the 3' Stem-Loop of the West Nile Virus Complementary Minus-Strand RNA and Facilitate Virus Replication J. Virol., October 25, 2002; 76(23): 11989 - 12000. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anderson and N. Kedersha Stressful initiations J. Cell Sci., August 15, 2002; 115(16): 3227 - 3234. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||