![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 10, 3662-3671, October 2002
Division of Signal Transduction, Department of Medicine, Beth Israel Deaconess Medical Center, Boston, Massachusetts 02215; and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts 02115
Submitted April 12, 2002; Revised June 19, 2002; Accepted July 16, 2002| |
ABSTRACT |
|---|
|
|
|---|
Geminin is an unstable inhibitor of DNA replication that gets destroyed at the metaphase/anaphase transition. The biological function of geminin has been difficult to determine because it is not homologous to a characterized protein and has pleiotropic effects when overexpressed. Geminin is thought to prevent a second round of initiation during S or G2 phase. In some assays, geminin induces uncommitted embryonic cells to differentiate as neurons. In this study, geminin was eliminated from developing Xenopus embryos by using antisense techniques. Geminin-deficient embryos show a novel and unusual phenotype: they complete the early cleavage divisions normally but arrest in G2 phase immediately after the midblastula transition. The arrest requires Chk1, the effector kinase of the DNA replication/DNA damage checkpoint pathway. The results indicate that geminin has an essential function and that loss of this function prevents entry into mitosis by a Chk1-dependent mechanism. Geminin may be required to maintain the structural integrity of the genome or it may directly down-regulate Chk1 activity. The data also show that during the embryonic cell cycles, rereplication is almost entirely prevented by geminin-independent mechanisms.
| |
INTRODUCTION |
|---|
|
|
|---|
The events of mitosis are controlled by a small group of unstable
regulatory proteins that are destroyed at the metaphase/anaphase transition (King et al., 1996
). The timely synthesis and
destruction of these proteins ensures that mitosis proceeds in an
orderly and irreversible manner. This family of proteins includes the anaphase inhibitor securin and the B-type cyclins, which activate the
mitotic protein kinase Cdc2.
Geminin is a 25-kDa protein that was discovered by screening cDNA
libraries for novel proteins that were destroyed during mitosis
(McGarry and Kirschner, 1998
). Except for B-type cyclins, geminin was
the most abundant cDNA detected in the screen. Geminin's function was
not immediately apparent because it is not homologous to any previously
characterized protein. Overexpression experiments demonstrated that
geminin strongly inhibits DNA replication by preventing formation of
prereplication complex (preRC), a collection of essential replication
factors that assembles on DNA at origins of replication (Stillman,
1996
). At the molecular level, geminin prevents the incorporation of
the mini-chromosome maintenance (MCM) complex into preRC. MCM complex
is thought to be the helicase that separates the two strands of the
double helix. Geminin seems to affect replication by inhibiting Cdt1,
an essential replication factor that must be incorporated into preRC
before the MCM complex can be added (Maiorano et al., 2000
).
Geminin binds tightly to Cdt1, and overexpression of Cdt1 overcomes the
inhibition of replication caused by geminin (Wohlschlegel et
al., 2000
; Tada et al., 2001
).
Based on these results, it has been proposed that the function of
geminin is to inhibit a second round of DNA replication during S or G2
phase, and that geminin destruction during mitosis allows replication
in the following cell cycle (McGarry and Kirschner, 1998
). Although
this model is appealing, it has been difficult to directly demonstrate
that geminin is necessary to prevent rereplication in vertebrate cells.
Immunodepletion of geminin from Xenopus egg extracts does
not result in an extra round of replication. Furthermore, Xenopus egg extracts contain a pool of Cdt1 that is not
bound to geminin, and this free pool seems to be sufficient to initiate replication (Tada et al., 2001
).
Geminin was independently discovered as a molecule that induces
uncommitted embryonic cells to differentiate as neurons (Kroll et
al., 1998
). It is not known how this activity is related to geminin's effect on the cell cycle. One possibility is that the two
activities are linked and that geminin couples cell division and cell
differentiation. For example, geminin might cause cells to accumulate
in a cell cycle stage that is conducive to differentiation. Another
possibility is that geminin has two separate and independent activities
mediated by separate domains of the protein. In support of this
hypothesis, the neuralizing activity of geminin can be reproduced by a
small fragment of the protein that has no effect on DNA replication.
In this study, geminin was eliminated from developing Xenopus embryos by using antisense oligonucleotides to clarify its biological function. Geminin-depleted embryos were found to have a unique early embryonic lethal phenotype. They complete the embryonic cleavage divisions normally but suddenly arrest in G2 phase after the 13th cell division. The arrest occurred just after the midblastula transition (MBT), the point in development when the cell cycle slows and zygotic gene expression begins. There was no detectable overreplication of the genome in geminin-deficient embryos, and embryonic death occurs before the time of neural induction. The G2 arrest is enforced by the checkpoint kinase Chk1. There is increased Chk1 phosphorylation at the arrest point, and the arrest can be bypassed by overexpressing a dominant negative Chk1 mutant. Surprisingly, Chk1 is also phosphorylated around the time of the MBT in wild-type embryos, suggesting that the Chk1 pathway constitutively controls entry into mitosis. The results indicate that geminin has an essential function in allowing entry into mitosis, possibly by maintaining the integrity of the genome or by down-regulating Chk1 activity.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Host Transfer Technique
To generate geminin-depleted embryos by the host transfer
technique (Heasman et al., 1991
), oocytes were injected near
the vegetal pole with 5 ng of geminin antisense oligonucleotide
(Bio-Synthesis, Lewisville, TX) in a total volume of 20 nl of
H2O. The oligonucleotide had the sequence
G*C*T*GGATTACTTTAA*G*T*G, where the asterisk indicates a
phosphorothioate bond between the nucleotides. This oligonucleotide is
complementary to a sequence encoding amino acids 35-41 that is
completely conserved between geminin H and geminin L, the two isoforms
of Xenopus geminin. It gave the most complete depletion of
geminin of the three that were tested. Control embryos were injected
with the sense version of the antisense oligonucleotide
(C*A*C*TTAAAGTAATCC*A*G*C).
Embryo Injection Technique
To generate geminin-depleted embryos by the embryo injection
technique (Heasman et al., 2000
), each blastomere of a
two-cell embryo was injected with 8 ng of an equal mixture of two
morpholino oligonucleotides (Gene Tools, Corvallis, OR) in a
volume of 10 nl. The antigeminin H oligonucleotide had the sequence
ATCTCTGCTTCTTGTTGGTATTCAT and the antigeminin L oligonucleotide had the
sequence TAAGCCTCTGCTCTTTTCACGCACA. After injection, embryos were
cultured in 1× MMR/5% Ficoll for 2-3 h and then in 0.1× MMR.
Control embryos were injected with a standard morpholino
oligonucleotide that bore no sequence relationship to geminin (CCTCTTACCTCAGTTACAATTTATA).
Plasmid Construction and RNA Synthesis
Cdc2 WT and Cdc2AF genes were amplified using the primers GGGCCCGAATTCATGGACGAGTACAC and GGGCCCTCTAGATTAGTTTCTAATCTGATTG. After amplification, the fragments were digested with EcoRI and XbaI and subcloned into the vector pCS2(+), which had been digested with the same enzymes. The sequence of the Cdc2 coding region in each construct was confirmed by dideoxy sequencing. The isoform used in these experiments did not contain an internal EcoRI site.
pCS2-Cdc25 WT and pCS2-Cdc25 S287A were constructed by amplifying the
Cdc25 gene from pSKCdc25-1 and pEGFP Cdc25 S287A, respectively (Kumagai
and Dunphy, 1992
; Kumagai and Dunphy, 1999
). The primers were
GGGCCCAGATCTATGGCAGAG-AGTCACATAATG and
GGGCCCCTCGAGTTAAAGCTTCATTATGCGGGC. The amplified fragments were
digested with BglII and XhoI and ligated to the
vector pCS2(+), which had been digested with BamHI and
XhoI.
pCS2-Gemininwobble was constructed by amplifying
the Xenopus geminin H gene from the original cDNA clone of
geminin H, p6.42.152 (McGarry and Kirschner, 1998
). The two primers
were GGGCCCGAATTCATGAACACAAATAAAAAACAACGC-TTGGATATGGAGAAGCC and GGGCCCCTCGAGCTAGACAGTATGTGCATC. The amplified fragment was digested
with EcoRI and XhoI and inserted into the vector
pCS2(+) that had been cut with the same enzymes. The sequence of the
amplified geminin gene was confirmed by dideoxy sequencing.
pCS2-his6-Chk1
KD was constructed by digesting
a pET28 clone of Chk1
KD (Michael et al., 2000
) with
NcoI, blunting the ends with the Klenow fragment, and
digesting with XhoI. The fragment was ligated to the vector
pCS2(+) that had been digested with BamHI, treated with
Klenow fragment, and digested with XhoI.
To make mRNA, template plasmids were linearized with NotI
and transcribed in vitro by using SP6 or T7 polymerase in the presence of ribonucleotide triphosphates and pGpppG cap analog
(Pharmacia, Peapack, NJ). RNA was resuspended and diluted in
H2O before injection. Chk1 D148A RNA was
synthesized using pT7-G DA-Chk1 (Nakajo et al., 1999
) as a
template, and Myc RNA was synthesized using pMT-CS2.
Rescue with Cdc2, Cdc25C, and Chk1 D148A
Two-cell embryos were injected sequentially with morpholino antisense oligonucleotides and RNA. The time between the two injections was 20-30 min. It was found that the RNAs would not be expressed well when coinjected with the morpholino oligonucleotide. The embryos were scored for rescue at the late blastula stage when geminin-depleted embryos from the same clutch of eggs had arrested. Arrest was determined by judging the size and the appearance of the cells (Figure 2, B and D). In many instances one side of the embryo would be rescued and the other side would not. Rescue frequencies are calculated as the percentage of half-embryos rescued. Embryos were injected and scored blindly to avoid bias in the results. Geminin-depleted embryos injected with Cdc2 WT, Cdc2 AF, Cdc25C WT, Cdc25C S287A, or Chk1 D148A RNA did not develop past the late blastula stage, presumably because of the toxic effects of improperly regulated Cdc2 activity.
Antibodies
Affinity-purified anti-geminin H antibody was described
previously (McGarry and Kirschner, 1998
). Anti-Cdc2 (sc-54) and
His-Probe (sc-804) antibodies were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). Phosphospecific anti-Cdc2 pY15 antibody
was purchased from New England Biolabs (Beverly, MA). Anti-Cdc25C and
anti-Cds1 antibodies were provided by Akiko Kumagai and William Dunphy
(Kumagai and Dunphy, 1992
; Guo and Dunphy, 2000
). Anti-cyclin B1
antibody was provided by James Maller (Hartley et al.,
1996
). Anti-xChk1 antibody was provided by Jill Sible (Kappas et
al., 2000
). Monoclonal anti-actin antibody AC-40 was purchased
from Sigma-Aldrich (St. Louis, MO).
| |
RESULTS |
|---|
|
|
|---|
Depletion of Geminin by Antisense Oligonucleotides
Two different techniques were used to deplete geminin from
Xenopus embryos. In the host transfer technique (Heasman
et al., 1991
), stage VI oocytes were injected with either
control or antisense-geminin phosphorothioate oligonucleotides. The
injected oocytes were transplanted into the abdomen of a host female,
fertilized, and cultured in vitro. In control embryos, geminin
synthesis is induced during oocyte maturation and the level of the
protein stays roughly constant throughout early development (Figure
1A, left). The antisense oligonucleotide
eliminates 90-95% of the geminin protein induced during oocyte
maturation and the geminin concentration remains low until at least the
late blastula stage (Figure 1A, right). In the embryo injection
technique (Heasman et al., 2000
), fertilized Xenopus eggs were injected with either control or
antisense-geminin morpholino oligonucleotides at the two-cell stage.
The antisense oligonucleotide causes a rapid reduction in the geminin
concentration and the protein is barely detectable at the 128-cell
stage (Figure 1B, bottom). The concentration remains low until at least
the beginning of gastrulation (stage 10; Nieuwkoop and Faber, 1967
). Injection of control oligonucleotides has no effect (Figure 1B, top).
The embryo injection technique was used in most of the experiments because it is much easier to perform and produces greater numbers of
geminin-depleted embryos than the host transfer technique.
|
Geminin Depletion Causes an Early Embryonic Cell Cycle Arrest
Geminin-depleted embryos generated by either technique display a
characteristic early embryonic lethal phenotype. The early cell
divisions seem to be normal, with normal timing and normal positioning
of the cleavage furrows (Figure 2A). The
first deviation from normal development becomes manifest at the late
blastula stage, when the cells of geminin-depleted embryos seem to be
noticeably larger than the cells of control embryos (Figure 2B). As
development proceeds, the surface pigment of each cell condenses and
develops a central white spot, giving the embryo a characteristic
"leopard skin" appearance (Figure 2D). The larger cells of
geminin-depleted embryos fail to execute normal gastrulation movements.
The blastopore is misshapen and its diameter does not shrink normally.
A wave of large detached white cells emerges from the region of the
blastopore groove and quickly sweeps over the animal pole (Figure 2C).
The underlying embryo becomes a large mass of yolky vegetal cells covered by a cap of pigmented animal cells (Figure 2F) that
disintegrates over the course of a few hours. Virtually all
geminin-depleted embryos displayed this phenotype (Table
1). In contrast, embryos injected with
control oligonucleotides typically develop normally to at least the
late tadpole stages (Table 1 and Figure 2E).
|
|
The observation that geminin-depleted blastulae had abnormally large
cells suggested that their primary defect was a cell cycle arrest. This
was confirmed by making time-lapse videorecordings of 13 geminin-depleted embryos from 13 different clutches of eggs. In all
cases, the embryonic cell divisions were normal but the cells suddenly
stopped dividing just after the MBT, which occurs after the 12th cell
cycle. There was some variability in the exact time at which cell
division stopped, both between different embryos and between different
cells of the same embryo. Most often (>90% of the time), cell
division stopped after the 13th or 14th division, but some cells would
divide a 15th time before arresting. After the arrest, the embryos
seemed healthy for about an hour and remained intact for several hours
before disintegrating. To confirm that cell division had ceased, the
embryos were sectioned and the mitotic index was determined by staining
the nuclear DNA with 4,6-diamidino-2-phenylindole and counting the
number of cells with condensed chromatin. In both late blastulae and
early gastrulae (stages 9 and 11), virtually none of the cells of
geminin-depleted embryos were in mitosis, whereas control embryos
showed a mitotic index of 6-10% (Table 2).
|
Injection of Geminin RNA Reverses Defects caused by Geminin Depletion
Normal development can be restored by injecting geminin-depleted embryos with geminin RNA (Figure 2G and Table 1). This control demonstrates that the phenotype is due to the loss of geminin itself and excludes the possibility that the antigeminin oligonucleotide fortuitously destroys a different protein or that the oligonucleotide preparation contains a toxic substance.
To rescue embryos generated by the host transfer method, oocytes were injected with ~240 pg of geminin RNA 3 h after injection of the antisense oligonucleotide. This amount was sufficient to restore the geminin concentration to normal (our unpublished data). Presumably, the antisense oligonucleotide is degraded during the 3-h cultivation period so that it does not destroy the injected RNA. Virtually none the embryos that developed from these oocytes showed a large-cell phenotype characteristic of a cell cycle arrest, and most of them (15/19, ~80%) developed to the swimming tadpole stage (Table 1 and Figure 2G). Some of the tadpoles seemed to have completely normal anatomy and others had a slightly malformed body.
To rescue embryos generated by the embryo injection technique, two-cell embryos were injected with gemininwobble RNA 20-30 min after the injection of the antigeminin oligonucleotide. To allow translation of the gemininwobble RNA, eight of the 25 bases in the region that would hybridize to the oligonucleotide were mutated in a way that preserved the amino acid sequence. Embryos injected with 100-200 pg of this RNA contain a normal amount of geminin at the late blastula stage (our unpublished data). Most of these embryos (~75%) did not show a cell cycle arrest and many of them (~30%) developed as far as the tadpole stage (Table 1). The extent of the rescue was not as complete as with the host transfer method, perhaps because of incomplete diffusion of the rescuing geminin RNA throughout the embryo or degradation of zygotic geminin RNA because of persistence of the morpholino oligonucleotide.
Geminin-depleted Cells Arrest in G2 Phase
To determine the cell cycle stage of the arrest, DNA content was
measured in tissue sections by quantitative fluorescence microscopy. In
two separate experiments, geminin-depleted cells contained an average
of 1.4 and 2.1 times as much nuclear DNA as control cells (Table 2).
Figure 3A shows a histogram of DNA content for one of the experiments. The nuclei of geminin-depleted cells were noticeably larger than control nuclei and their chromatin was often partially condensed (Figure 3B). The appearance of the nuclei
and the higher DNA content of the geminin-depleted cells suggested that
they were arrested in G2 phase.
|
The G2 arrest was verified by demonstrating two biochemical markers
that are characteristic of G2 phase cells: a high concentration of
B-type cyclins and complete phosphorylation of Cdc2 on tyrosine-15 (Y15) (Draetta et al., 1988
; Pines and Hunter, 1989
). The
B-type cyclins accumulate during S and G2 phase and bind to the mitotic protein kinase Cdc2 (King et al., 1994
). Once the activating
cyclin subunit is bound, Cdc2 activity is inhibited by phosphorylation of Y15 and threonine-14 (T14) by kinases in the Wee1/Myt1 family. The
critical event that triggers the start of mitosis is the removal of the
two inhibitory phosphates by a member of the Cdc25 family of phosphatases.
During the early embryonic cell cycles, Cdc2 is virtually
unphosphorylated and S phase and mitosis directly follow each other without intervening gap phases (Graham and Morgan, 1966
; Ferrell et al., 1991
; Hartley et al., 1996
). After the
MBT, gap phases appear and cell division becomes asynchronous
throughout the embryo. In normal embryos, the appearance of a
population of cells in G2 phase at the MBT is reflected by the
accumulation of B-type cyclins (Figure
4A, top) and the appearance of a small
amount of Cdc2 that is phosphorylated on Y15 (Figure 4B, top). Both of these changes are exaggerated in geminin-depleted embryos. As the
arrest point is reached, they accumulate 2-4 times as much cyclin B1
as control embryos (Figure 4A, bottom) and virtually all the Cdc2
becomes phosphorylated on Y15 (Figure 4B, bottom). These findings
confirm that the arrest is in G2 phase.
|
Cdc2 AF Bypasses the Cell Cycle Arrest of Geminin-depleted Embryos
The near quantitative phosphorylation of Cdc2 on Y15 at the time
of the arrest suggests that geminin-depleted embryos fail to enter
mitosis because of an inability to remove the inhibitory phosphates on
T14 and Y15. To test this possibility, geminin-depleted embryos were
injected with RNA encoding Cdc2 AF, a mutant form of Cdc2 in which
threonine-14 is replaced by alanine and tyrosine-15 is replaced by
phenylalanine. Cdc2 AF cannot be phosphorylated at either of the
inhibitory sites and does not require dephosphorylation for activity
(Pickham et al., 1992
). Injection of as little as 30 pg of
Cdc2 AF RNA significantly suppressed the cell cycle arrest caused by
geminin depletion, as judged by the size and appearance of the cells
after the MBT (Figure 5A, top, black
rectangles). The degree of suppression increased as more Cdc2 AF RNA
was injected. Time-lapse videorecordings of two geminin-depleted
embryos injected with 1000 pg of Cdc2 AF RNA confirmed that cell
division continued throughout the embryo for several cycles after the
13th division until the cells became too small to be distinguished. In
contrast, injection of as much as 1000 pg of wild-type Cdc2 RNA had no
effect (Figure 5A, gray rectangles). Immunoblots showed
that comparable amounts of the WT and AF proteins were expressed at
each RNA concentration (our unpublished data). To confirm that
the G2 arrest had been overcome, the extent of Cdc2 phosphorylation and
the cyclin B1 level were measured after the MBT. Cdc2 AF expression
caused the complete disappearance of tyrosine-15-phosphorylated Cdc2
and restored the cyclin B1 level to normal, indicating that the G2 arrest had been bypassed (Figure 5A, compare lanes 2 and 4). Wild-type Cdc2 had no effect (lane 3). The suppression of the arrest by Cdc2 AF
indicates that geminin-depleted embryos fail to enter mitosis because
of sustained inhibitory phosphorylation of Cdc2.
|
Geminin Depletion Causes Increased Chk1 Phosphorylation
Checkpoint pathways prevent entry into mitosis in the presence of
incompletely replicated or damaged DNA (Zhou and Elledge, 2000
).
Checkpoint responses are implemented by two effector protein kinases
that are activated by phosphorylation, Chk1 and Cds1. Activated Chk1
and Cds1 prevent entry into mitosis in part by inhibiting Cdc25C, the
phosphatase that removes the phosphates from T14 and Y15 of Cdc2 at the
onset of mitosis (see below).
To see whether geminin depletion activates a checkpoint, the extent of
Chk1 and Cds1, phosphorylation in geminin-depleted and control embryos
was measured by immunoblotting (Figure
6). Phosphorylated Cds1 migrates through
a polyacrylamide gel more slowly than the unphosphorylated form
(bottom) (Guo and Dunphy, 2000
). To monitor the phosphorylation of
Chk1, embryos were injected with RNA encoding
his6-tagged Chk1
KD, a fragment of Chk1 that undergoes an easily observable gel shift when phosphorylated. The
phosphorylation of this fragment reflects endogenous Chk1 phosphorylation and is correlated with activation of the DNA
replication checkpoint in Xenopus egg extracts (Michael
et al., 2000
). Control embryos injected with
his6-Chk1
KD RNA develop into normal tadpoles, indicating that the protein itself is not toxic (our unpublished data). Both his6-Chk1
KD and Cds1 become
extensively phosphorylated when the DNA replication checkpoint is
induced by adding 20 mM hydroxyurea (HU) to the culture medium (Figure
6, top and bottom, lanes 6-10). Time-lapse videorecording of four
HU-treated embryos showed that 80-90% of the cells stop dividing
immediately after the 12th cell division, or about one division earlier
than geminin-depleted embryos. The phosphorylation of
his6-Chk1
KD and Cds1 occurs around the time of
the arrest and is associated with increased phosphorylation of Cdc2 on
Y15 (middle, lanes 6-10).
|
In control embryos, Cds1 remains unphosphorylated throughout
development (bottom, lanes 1-5) but
his6-Chk1
KD becomes partially phosphorylated
at the time of the midblastula transition (top, lanes 1-5). This
phosphorylation is temporally correlated with the appearance of
Y15-phosphorylated Cdc2 (middle, lanes 1-5), suggesting that Chk1
might constitutively control Cdc2 phosphorylation in normal post-MBT
cell cycles (see DISCUSSION). His6-Chk1
KD becomes more extensively phosphorylated in geminin-depleted embryos than in controls (top, lanes 11-15). Quantification of the band intensities in four independent experiments showed that in control embryos Chk1
KD is 22 ± 5% phosphorylated after the MBT,
whereas in geminin-depleted embryos Chk1
KD is 43 ± 2%
phosphorylated (mean ± SE, P < 0.02). This is comparable
with the amount of Chk1 DKD phosphorylated that is phosphorylated in
HU-treated embryos (43 ± 5%). The increased Chk1 phosphorylation
is associated with complete phosphorylation of Cdc2 on Y15 (middle,
lanes 15). In contrast, Cds1 remains unphosphorylated in both control
and geminin-depleted embryos throughout development. These results
suggest that the Chk1 pathway is responsible for the G2 arrest that
occurs when geminin is depleted.
Bypassing Chk1 Pathway Suppresses G2 Arrest Caused by Geminin Depletion
To confirm that the Chk1 pathway imposes the G2 arrest,
geminin-depleted embryos were injected with RNA encoding two different proteins that bypass or inhibit the Chk1 pathway (Figure 5, B and C).
Chk1 prevents Cdc2 dephosphorylation by negatively regulating Cdc25C,
the phosphatase that removes the inhibitory phosphates from Cdc2. Chk1
phosphorylates Cdc25C on serine-287 (S287), generating a binding site
for a member of the 14-3-3 family of proteins (Peng et al.,
1997
; Kumagai et al., 1998a
; Kumagai and Dunphy, 1999
). 14-3-3 binding masks a nuclear localization signal on Cdc25C and causes
the phosphatase to be retained in the cytoplasm, where it presumably
cannot dephosphorylate nuclear Cdc2.
Cdc25 S287A is a mutant in which S287 is mutated to alanine. Cdc25C
S287A cannot be phosphorylated by Chk1 and induces checkpoint-arrested egg extracts to enter mitosis (Kumagai et al., 1998b
). The
S287A mutant efficiently suppresses the cell cycle arrest caused by geminin depletion in a dose-dependent manner, as determined by the size
and appearance of the embryonic cells after the MBT (Figure 5B, top,
black rectangles). Cdc25 S287A expression also causes the disappearance
of Y15-phosphorylated Cdc2 and restores the cyclin level to normal
(bottom, compare lanes 6 and 8), confirming that the G2 arrest has been
overcome. Injection of the highest concentration of wild-type Cdc25C
RNA partially suppresses the cell cycle arrest (Figure 5B, top, gray
rectangles) and partially reverses the phosphorylation of Cdc2 on
tyrosine-15 (bottom, lane 7). Because phosphorylation of S287 does not
inhibit phosphatase activity (Kumagai et al., 1998b
),
wild-type Cdc25C would be able to overcome the arrest once sufficient
quantities were available to saturate the amount of 14-3-3 in the
cytoplasm. Immunoblots showed that comparable amounts of
the Cdc25C WT and S287A proteins were expressed at each RNA
concentration (our unpublished data).
Chk1 D148A is a kinase-inactive mutant that shows dominant negative
effects when overexpressed with wild-type Chk1 (Nakajo et
al., 1999
). Injection of 1-10 ng of RNA encoding Chk1 D148A overcomes the cell cycle arrest caused by geminin depletion (Figure 5C). The D148A mutant suppresses the appearance large arrested cells
after the MBT (top, black bars), eliminates the accumulation of
Y15-phosphorylated Cdc2, and restores the cyclin B1 level to normal
(bottom, lanes 9 and 12). Time-lapse videorecording of two embryos from
two different clutches of eggs injected with 10 ng of Chk1 D148A
confirmed that cell division continued past the 13th division.
Injection of an inert RNA encoding a myc-epitope tag has no effect
(Figure 5C, gray bars and lane 11). Immunoblots showed that
the Chk1 D148A protein was vastly overexpressed relative to endogenous
WT Chk1 at all RNA concentrations (our unpublished data). These
experiments indicate that the G2 arrest caused by geminin depletion is
Chk1 dependent.
| |
DISCUSSION |
|---|
|
|
|---|
Geminin is a recently discovered protein that inhibits DNA
replication and gets destroyed during mitosis (McGarry and Kirschner, 1998
). These properties strongly suggest that geminin has a key role in
regulating the cell cycle, but the protein's function has been
difficult to determine from overexpression experiments. It has been
proposed that geminin prevents a second round of replication during S
or G2 phase, yet geminin is clearly not required to prevent reinitiation in all types of cells (McGarry and Kirschner, 1998
; Noton
and Diffley, 2000
). Furthermore, geminin seems to induce neural
differentiation in some assays (Kroll et al., 1998
). It is
difficult to understand how a single small protein could have such
diverse biological effects.
To better define the biological function of geminin, the protein was depleted from developing Xenopus embryos by using antisense oligonucleotides. Geminin-deficient embryos display a novel and unusual phenotype. The 12 early embryonic cell cycles are normal but the cells suddenly stop dividing after the 13th or 14th division, just after the midblastula transition. Several independent criteria establish that the cells are arrested in G2 phase: their mitotic index is close to zero, they have approximately twice the DNA content of normal cells, they contain a high concentration of B-type cyclins, and the mitotic kinase Cdc2 is virtually completely phosphorylated at the Y15 inhibitory site. The arrest is brought about by the Chk1-dependent checkpoint pathway, which inhibits mitosis by causing sustained inhibitory phosphorylation of Cdc2. The arrest can be overcome by expression of either a dominant negative mutant form of Chk1 or unphosphorylatable mutants of Cdc25C and Cdc2 that are not susceptible to inhibition by the Chk1 pathway.
The requirement for Chk1 in implementing the G2 arrest readily explains
why geminin-depleted embryos do not stop dividing until after the
midblastula transition. The MBT occurs after the 12th cell division and
marks a time when the cell cycle undergoes an extensive reorganization
(Newport and Kirschner, 1982a
,b
). The MBT is triggered when the
nuclear/cytoplasmic ratio exceeds a critical threshold, but the
molecular events responsible for the transition are unknown. Before the
MBT, cells divide rapidly and synchronously about every 30 min. DNA
synthesis and mitosis alternate in quick succession without intervening
gap phases and zygotic transcription is suppressed. After the MBT,
cells divide much more slowly and asynchronously. Gap phases appear and
zygotic transcription begins. Most significantly, the MBT marks the
time in development when the Chk1 pathway first becomes operational (Kappas et al., 2000
). When the Chk1 pathway is induced by
treating embryos with aphidicolin or ionizing radiation, phosphorylated Chk1 does not appear until the MBT is reached. The pathway is blocked
upstream of Chk1, possibly because the concentration of DNA is too low
to generate a signal sufficient to activate the kinase. Because Chk1 is
required for the G2 arrest of geminin-deficient embryos, the embryos
would be able to divide normally until Chk1 becomes activated at the
MBT. This probably occurs at slightly different times in different
cells, explaining why there is some variability in the exact number of
cell cycles that can be completed in the absence of geminin.
The mechanism by which geminin deficiency leads to Chk1 activation is
not clear. Studies with Xenopus egg extracts have
demonstrated that the Chk1 pathway inhibits entry into mitosis in the
presence of unreplicated or UV-irradiated DNA (Kumagai et
al., 1998a
). The simplest explanation of the phenotype is that
geminin deficiency causes a subtle defect in DNA structure that
activates the pathway. For example, geminin loss may cause a small
amount of overreplication that cannot be detected by the techniques
used in this study. This would be consistent with the hypothesis that
geminin suppresses a second round of DNA synthesis during S phase.
The results confirm that during the Xenopus early embryonic
cell cycles reinitiation can be almost entirely prevented by mechanisms that do not involve geminin. After 14 rounds of replication (13 cell
cycles and one additional round before the arrest), geminin-deficient cells contain roughly twice as much nuclear DNA as control cells. The
difference can be accounted for if the geminin-deficient cells are in
G2 phase and the control cells are in G1 or S phase. Even if the
difference were due to overreplication, there could be no more than
(2)1/14 = 1.05 times the normal amount of
replication in each cell cycle, i.e., 5% rereplication per cell cycle.
In comparison, permeabilization of the nuclear envelope causes 25-50%
rereplication per cell cycle (Blow and Laskey, 1988
). The results
reported here corroborate previous density label studies that showed a
single round of replication occurs when geminin is removed from egg
extracts by using specific antibodies (McGarry and Kirschner, 1998
).
Because of the serious consequences of overreplicating the genome,
cells may use more than one mechanism to inhibit rereplication. One
likely geminin-independent mechanism for preventing rereplication is
the inhibition of preRC assembly by high levels of CDK activity (Kelly
and Brown, 2000
; Nguyen et al., 2001
).
The phenotype of geminin-depleted Xenopus embryos is very
different from that of Drosophila geminin mutants (Quinn
et al., 2001
). Geminin (
/
) Drosophila do not
survive past the larval stages and the cause of the lethality has not
been established. They exhibit a variety of defects, including anaphase
chromosome bridges, a greater number of S-phase cells in some tissues,
and a malformed peripheral nervous system. Significantly, a G2 cell cycle arrest was not apparent, neither at the MBT nor at later stages.
The reasons for the difference in phenotype between Xenopus and Drosophila embryos that lack geminin are not immediately
obvious. Geminin (
/
) Drosophila may survive past the MBT
because of a maternal supply of geminin protein or RNA, but it is not
clear why the cells do not arrest in G2 phase later in development when the maternal supply becomes exhausted. There may be differences between
the two organisms in the way checkpoint controls are exercised. It has
recently been reported that cultured Drosophila cells
accumulate excessive amounts of DNA (up to 8n) when geminin synthesis
is inhibited by interfering RNA (Mihaylov et al., 2002
).
This may indicate that Drosophila cells are more dependent
on a geminin-requiring mechanism to inhibit rereplication than
vertebrate cells. However, it has not been established that the excess
DNA results from reinitiation within a single S phase.
The results do not demonstrate a primary role for geminin in inducing
neural tissue. Geminin-deficient embryos die before neural induction
begins during the gastrula stage (Kroll et al., 1998
).
Geminin might have a separate role in inducing the nervous system that
is not manifest in geminin-deficient embryos because of the early
mortality. Alternatively, the neural effects of geminin may be a
secondary consequence of an effect on the cell cycle. For example,
geminin might cause undifferentiated cells to accumulate in a cell
cycle stage that is conducive to neural differentiation.
The results reported here suggest that the Chk1 pathway constitutively
controls Cdc2 dephosphorylation in normal cell cycles. Phosphorylated
Chk1
KD appears at the late blastula stage in normal embryos that
are not exposed to DNA-damaging agents or replication inhibitors. The
onset of Chk1 phosphorylation coincides with the appearance of
Y15-phosphorylated Cdc2 (Figure 6), and expression of dominant negative
Chk1 D148A suppresses the appearance of phosphorylated Cdc2 (our
unpublished data). The removal of the inhibitory phosphates from
Cdc2 is the rate-limiting step for mitotic entry in most organisms
(King et al., 1994
). The hypothesis that Chk1 constitutively
controls Cdc2 dephosphorylation is consistent with previously published
reports that Chk1 is an essential protein in Drosophila and
in mice (Sibon et al., 1997
; Liu et al., 2000
; Takai et al., 2000
). The phenotype of Drosophila
Chk1 (grapes) mutants suggests that the function of the
protein is to prevent mitotic entry until DNA replication is complete.
In maternal grapes mutants, the cells of the syncytial
blastoderm continue to divide rapidly after the midblastula transition
is reached, causing a catastrophic premature entry into mitosis that
kills the embryo. Chk1 is also required for mouse ES cell viability,
suggesting that the protein has a constitutive role in somatic cell
cycles. Because Chk1 is activated in normal cell cycles, another
interpretation of the data presented here is that geminin is more
directly required to down-regulate Chk1. If this were the case, then
one would expect active Chk1 to accumulate and cause a G2 arrest when
geminin was absent. Further experiments will be required to evaluate
this possibility.
| |
ACKNOWLEDGMENTS |
|---|
I especially thank Lew Cantley for outstanding support and commitment to this project. The manuscript was critically reviewed by Lew Cantley, Marc Kirschner, K. Ping Lu, Seth Field, Reuben Shaw, and Ben Turk. This work was supported by grants to T.J.M. from the Howard Hughes Medical Institute, the Warren-Whitman-Richardson Foundation, and the National Heart Lung and Blood Institute (K 08 HL03461), and by a grant to Lew Cantley from the National Institutes of Health (GM-56203).
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: t_mcgarry{at}northwestern.edu.
Present address: Division of Cardiology, Northwestern
University Medical School, Chicago, IL 60611.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-04-0199. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-04-0199.
| |
ABBREVIATIONS |
|---|
Abbreviations used: MBT, midblastula transition; S287, serine-287 of Cdc25; T14, threonine-14 of Cdc2; Y15, tyrosine-15 of Cdc2.
| |
REFERENCES |
|---|
|
|
|---|
-Catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach.
Dev. Biol.
222, 124-134[CrossRef][Medline].
/
) mice.
Genes Dev.
14, 1439-1447This article has been cited by other articles:
![]() |
T. Tsuyama, S. Watanabe, A. Aoki, Y. Cho, M. Seki, T. Enomoto, and S. Tada Repression of Nascent Strand Elongation by Deregulated Cdt1 during DNA Replication in Xenopus Egg Extracts Mol. Biol. Cell, February 1, 2009; 20(3): 937 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Hall, H. O. Lee, B. D. Bunker, E. S. Dorn, G. C. Rogers, R. J. Duronio, and J. G. Cook Cdt1 and Cdc6 Are Destabilized by Rereplication-induced DNA Damage J. Biol. Chem., September 12, 2008; 283(37): 25356 - 25363. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Lin and A. Dutta ATR Pathway Is the Primary Pathway for Activating G2/M Checkpoint Induction After Re-replication J. Biol. Chem., October 19, 2007; 282(42): 30357 - 30362. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Arias and J. C. Walter Strength in numbers: preventing rereplication via multiple mechanisms in eukaryotic cells Genes & Dev., March 1, 2007; 21(5): 497 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Kerns, S. J. Torke, J. M. Benjamin, and T. J. McGarry Geminin Prevents Rereplication during Xenopus Development J. Biol. Chem., February 23, 2007; 282(8): 5514 - 5521. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hara, K. I. Nakayama, and K. Nakayama Geminin is essential for the development of preimplantation mouse embryos Genes Cells, November 1, 2006; 11(11): 1281 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Winkler, C. Eggert, D. Gradl, G. Meister, M. Giegerich, D. Wedlich, B. Laggerbauer, and U. Fischer Reduced U snRNP assembly causes motor axon degeneration in an animal model for spinal muscular atrophy Genes & Dev., October 1, 2005; 19(19): 2320 - 2330. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Seo, A. Herr, J.-W. Lim, G. A. Richardson, H. Richardson, and K. L. Kroll Geminin regulates neuronal differentiation by antagonizing Brg1 activity Genes & Dev., July 15, 2005; 19(14): 1723 - 1734. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Yanagi, T. Mizuno, T. Tsuyama, S. Tada, Y. Iida, A. Sugimoto, T. Eki, T. Enomoto, and F. Hanaoka Caenorhabditis elegans Geminin Homologue Participates in Cell Cycle Regulation and Germ Line Development J. Biol. Chem., May 20, 2005; 280(20): 19689 - 19694. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. J. Machida and A. Dutta Cellular Checkpoint Mechanisms Monitoring Proper Initiation of DNA Replication J. Biol. Chem., February 25, 2005; 280(8): 6253 - 6256. [Full Text] [PDF] |
||||
![]() |
T. Tsuyama, S. Tada, S. Watanabe, M. Seki, and T. Enomoto Licensing for DNA replication requires a strict sequential assembly of Cdc6 and Cdt1 onto chromatin in Xenopus egg extracts Nucleic Acids Res., February 1, 2005; 33(2): 765 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Chiao, J. Leonard, K. Dickinson, and J. C. Baker High-throughput functional screen of mouse gastrula cDNA libraries reveals new components of endoderm and mesoderm specification Genome Res., January 1, 2005; 15(1): 44 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Arias and J. C. Walter Replication-dependent destruction of Cdt1 limits DNA replication to a single round per cell cycle in Xenopus egg extracts Genes & Dev., January 1, 2005; 19(1): 114 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Eward, E. C. Obermann, S. Shreeram, M. Loddo, T. Fanshawe, C. Williams, H.-I. Jung, A. T. Prevost, J. J. Blow, K. Stoeber, et al. DNA replication licensing in somatic and germ cells J. Cell Sci., November 15, 2004; 117(24): 5875 - 5886. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Benjamin, S. J. Torke, B. Demeler, and T. J. McGarry Geminin Has Dimerization, Cdt1-binding, and Destruction Domains That Are Required for Biological Activity J. Biol. Chem., October 29, 2004; 279(44): 45957 - 45968. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kulartz and R. Knippers The Replicative Regulator Protein Geminin on Chromatin in the HeLa Cell Cycle J. Biol. Chem., October 1, 2004; 279(40): 41686 - 41694. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhu, Y. Chen, and A. Dutta Rereplication by Depletion of Geminin Is Seen Regardless of p53 Status and Activates a G2/M Checkpoint Mol. Cell. Biol., August 15, 2004; 24(16): 7140 - 7150. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nishitani, Z. Lygerou, and T. Nishimoto Proteolysis of DNA Replication Licensing Factor Cdt1 in S-phase Is Performed Independently of Geminin through Its N-terminal Region J. Biol. Chem., July 16, 2004; 279(29): 30807 - 30816. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Markey, H. Siddiqui, and E. S. Knudsen Geminin Is Targeted for Repression by the Retinoblastoma Tumor Suppressor Pathway through Intragenic E2F Sites J. Biol. Chem., July 9, 2004; 279(28): 29255 - 29262. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Melixetian, A. Ballabeni, L. Masiero, P. Gasparini, R. Zamponi, J. Bartek, J. Lukas, and K. Helin Loss of Geminin induces rereplication in the presence of functional p53 J. Cell Biol., May 24, 2004; 165(4): 473 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. May, M. A. Madine, and M. J. Waring Echinomycin inhibits chromosomal DNA replication and embryonic development in vertebrates Nucleic Acids Res., January 2, 2004; 32(1): 65 - 72. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||