![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 10, 3696-3705, October 2002
1 Cation Channel
mRNA


and
*Departments of Physiology,
Anatomy, and
Anatomical and Cellular Pathology, Faculty of Medicine,
The Chinese University of Hong Kong, Hong Kong, China
| |
ABSTRACT |
|---|
|
|
|---|
CNG channels are cyclic nucleotide-gated Ca2+-permeable
channels that are suggested to be involved in the activity-dependent alterations of synaptic strength that are thought to underlie information storage in the CNS. In this study, we isolated an endogenous RNA transcript antisense to CNG
1 mRNA. This transcript was capable of down-regulating the expression of sense CNG
1 in the
Xenopus oocyte expression system. RT-PCR, Northern blot,
and in situ hybridization analyses showed that the transcript was coexpressed with CNG
1 mRNA in many regions of human brain, notably in those regions that were involved in long-term potentiation and
long-term depression, such as hippocampal CA1 and CA3, dentate gyrus,
and cerebellar Purkinje layer. Comparison of expression patterns
between adult and fetal cerebral cortex revealed that there were
concurrent developmental changes in the expression levels of anti-CNG1
and CNG
1. Treatment of human glioma cell T98 with thyroid hormone
T3 caused a significant increase in anti-CNG1 expression
and a parallel decrease in sense CNG
1 expression. These data suggest
that the suppression of CNG
1 expression by anti-CNG1 may play an
important role in neuronal functions, especially in synaptic plasticity
and cortical development. Endogenous antisense RNA-mediated regulation
may represent a new mechanism through which the activity of ion
channels can be regulated in the human CNS.
| |
INTRODUCTION |
|---|
|
|
|---|
Cyclic nucleotide-gated (CNG) channels are
Ca2+-permeable nonselective cation channels that
exist as heteromeric complexes consisting of
and
subunits. Four
distinct
subunits and two
subunits have been identified.
1-3 may form functional channels on their own.
4 and two
subunits do not exhibit channel properties themselves but are able to
modify the channel properties (Kaupp, 1995
; Finn et al.,
1996
; Zagotta and Siegelbaum, 1996
). CNG channels have fairly
widespread tissue distribution, including sensory neurons, CNS, heart,
kidney, blood vessels, and spleen. In the CNS, electrophysiological and
molecular biological evidence has demonstrated that CNG channels are
present in many regions of rat brain, including hippocampus, cerebral
cortex, and cerebellum (Ahmad et al., 1994
; Kingston et al., 1996
; Bradley et al., 1997
; Samanta Roy
and Barnstable, 1999
; Strijbos et al., 1999
). Research has
linked the nitric oxide (NO)-cGMP pathway to the CNG channel activity
in neurons (Ahmad et al., 1994
). CNG channels may act as one
of the downstream effectors for the NO-cGMP pathway, modulating
neurotransmitter release and causing the activity-dependent alterations
of synaptic strength that are thought to underlie information storage,
such as long-term potentiation (LTP) and long-term depression (LTD). In
addition to their proposed role in synaptic plasticity, CNG channels
may also play an important role in brain development. Evidence suggests that CNG channels may control axon guidance (Coburn and Bargmann, 1996
)
and influence cortical dendritic outgrowth in the development of the
CNS (Samanta Roy and Barnstable, 1999
).
An important feature of CNG channels is their
Ca2+-permeability (Finn et al., 1996
;
Dzeja et al., 1999
). CNG channels open in response to cyclic
nucleotides and link cGMP/cAMP signaling to Ca2+
homeostasis. Activation of CNG channels would raise cytosolic Ca2+ levels, and this could trigger secondary
pathways that contribute to short-term and long-term alterations in
neural functions (Zufall et al., 1997
). Substantial amounts
of data are available regarding the modulation of CNG channel activity
by cellular factors, including phosphorylation enzymes,
Ca2+/calmodulin, and diacylglycerol (Hsu and
Molday, 1993
; Molokanova et al., 1997
; Crary et
al., 2000
). However, the regulation of CNG channels at the gene
transcription and/or protein translation levels is largely unknown. In
this study, we report the isolation of a cDNA clone representing an
endogenous antisense transcript against the mRNA of human CNG
1
channels. This endogenous antisense transcript is expressed in many
regions of human brain, and it may down-regulate the sense CNG
1
channels by suppressing the amount of channel proteins.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Library Screening
A cDNA fragment for CNG
1 (underlined by dots in Figure
1) was amplified by RT-PCR using total
RNA isolated from the human epithelial cell line ECV304. The primers
used for PCR were (+)TTGGTCCACAGGTAGTC and (
) TCATCATTATCCACTGGAA.
The fragment was labeled by random primer extension with
-32P-labeled dCTP (Amersham), and it
was then used to screen a commercial human cDNA library that was primed
with oligo-dT and unidirectionally cloned in pCMV-SPORT1 (Life
Technologies-BRL). The hybridizations were performed on Hybond nylon
membranes in Rapid-Hyb buffer (Amersham) at 55°C overnight. The
membranes were washed in 2× SSC/0.1% SDS at room temperature for
1 h, followed by 0.2× SSC/0.1% SDS at 42°C for 45 min as
described previously (Yao et al., 1995
). Positive clones
were verified with Southern blot using the same CNG
1-specific probe.
A 1.66-kilobase (kb) clone was isolated, and the nucleotide sequence
was analyzed by Sanger sequencing with Sequenase (US Biochemicals).
|
Reverse Transcription-Polymerase Chain Reaction
Total RNAs were isolated at autopsy from adult human brain
tissue and human glioma cell lines by the acid guanidinium thiocyanate method (Chomczynski and Sacchi, 1987
). One of the human brain total RNA
samples was a DNase-treated sample purchased from Invitrogen. RNAs were
transcribed into first-strand cDNAs using Superscript reverse
transcriptase (Life Technologies-BRL). Anti-CNG1-specific primers
[(+)GATGACGATATACATAACAAGG and (
)CTCAGCAGAATATTTTCTACAGCC] were
used to amplify a 450-base pair (bp) PCR fragment. The primer sites are
shown in Figure 1. PCR reactions of 100 µl contained 1 µl of the
first-strand cDNA, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM
MgCl2, 0.2 mM dNTP, 1.0 µM primers, and 2.5 U
Taq DNA polymerase (Life Technologies-BRL). Thirty cycles
(94°C for 1 min, 50°C for 1 min, 72°C for 1 min) were performed
with a Robocycler (Stratagene). Negative controls applied the same
samples and experimental procedures except that the step of reverse
transcription was omitted. The amplified PCR products were sequenced by
ABI 310 autosequencer (Perkin Elmer-Cetus). Human kidney and liver cDNA
libraries were purchased from Life Technologies-BRL.
Hormone Effect
T98 cells were treated with 1 µM T3
(Calbiochem) or 100 ng/ml human growth hormone (Calbiochem) for 4 d in a culture medium consisting of 90% Ham's F-12 and 10% fetal
calf serum (Life Technologies). Total RNAs were isolated thereafter for
semiquantitative RT-PCR assays. The primers used for anti-CNG1
detection were (+)GGTATCAGTGACAGAACATCAA and
(
)TACAGCCATAGGTTTATTAGTAT. The primers used for sense CNG
1 detection were (+)GAATTTGGCCGTTTGGCTAG and (
)CGTTGATGGCAATTTCTGCT. PCR reactions of 50 µl contained 1 µl of the first-strand cDNA, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2,
0.2 mM dNTP, 1.0 µM primers, and 2.5 U Taq DNA polymerase
(Life Technologies-BRL). Thirty-five cycles (94°C for 1 min, 55°C
for 1 min, 72°C for 1 min) were performed with a Robocycler
(Stratagene). For anti-CNG1, a single PCR product of 271 bp was
amplified. For sense CNG
1, a single amplified product of 386 bp was
detected. The authenticity of the amplified products was confirmed by
ABI 310 autosequencer. Equal volumes of the PCR products were loaded
onto a 1%-agarose gel and stained with ethidium bromide. The intensity
of the bands was analyzed by FluorChem 8000 imaging system (Alpha
Innotech). As a control for analysis, we used the expression levels of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a normalizing basis
for comparison. The primers for GAPDH were (+)ACCACAGTCCATGCCATCAC and
(
)TCCACCACCCTGTTGCTGTA.
Northern Blot
A 211-bp DNA fragment near the 3' end of anti-CNG1 (from
position 1308 to 1518 as in Figure 1, or P2 as in Figure
2) was subcloned into pCMVsport1 and then
in vitro transcribed into a 32P-labeled riboprobe
antisense to anti-CNG1 with the T7 MAXIscript transcription kit
(Ambion). The molecular size of synthesized riboprobe was confirmed by
gel electrophoresis. This strand-specific riboprobe was used to
hybridize with a Human Brain Multiple Tissue mRNA Blot (ClonTech) at
60°C overnight with ExpressHyb. The blot was then washed twice in 2×
SSC/0.5% SDS for 45 min, followed by 2× 20-min washes in 0.1×
SSC/0.1% SDS at room temperature, and then exposed to x-ray film
overnight. The Multiple Tissue mRNA Blot was reprobed with human
-actin gene (Clontech) to demonstrate that equal amounts of poly(A)
RNA was loaded onto each lane.
|
Cloning of Sense CNG
1 Gene
Sense CNG
1 was amplified by RT-PCR using total RNA isolated
from the human epithelial cell line ECV304. The PCR primers
[(+)TCCATGAACAATATTATCAAT and (
)TCAAAAGGATCATGAGGCAT] were designed
on the basis of the published nucleotide sequence of human CNG
1 mRNA
(GenBank Accession Number NM 000087) (Dhallan et al.,
1992
). The amplified PCR product of 2112 bp was cloned into
pPCR-ScriptAmp cloning vector (Stratagene). The amplified PCR products
were sequenced by ABI 310 autosequencer (Perkin Elmer-Cetus). The DNA
sequencing confirmed that the clone represented authentic human
CNG
1.
Oocyte Expression
Anti-CNG1, CNG
1, and Kv1.5 were
subcloned into pgh21 vector and then expressed in Xenopus
oocytes by microinjecting in vitro transcribed cRNAs as previously
described (Yao et al., 1995
). For CNG
1, oocyte membrane
was clamped at
100 mV. For anti-CNG1 suppression studies, 25 ng of
anti-CNG1 cRNA was injected into oocytes 2 h before the injection
of sense CNG
1 cRNA. For Kv1.5, the outward
currents were elicited by two-microelectrode voltage clamp using 800-ms
pulses of +80 mV from a holding potential of
80 mV. The experimental
bath contained 88 mM NaCl, 2 mM KCl, 1 mM CaCl2,
1 mM MgCl2, 2.5 mM
NaH2CO3, and 5 mM HEPES, pH
7.4. Expressed currents were measured with OC-725 oocyte clamp 2 days after cRNA injection as described previously (Yao et al.,
1995
). Measured currents were analyzed using Pulse and Pulse-fit
software (Heka Lambretch, Germany).
In Situ Hybridization
The same 211-bp DNA fragment as used in Northern blot
(illustrated as P2 in Figure 2) was in vitro transcribed into
DIG-labeled RNA probes with a DIG-labeling kit (Roche Biochemicals).
The strand complementary to anti-CNG1 was used to detect anti-CNG1, and
the sense strand was used as control. For the detection of sense
CNG
1 transcript, a 259-bp DNA fragment illustrated in Figure 2 as P1 was subcloned into pPCR-ScriptAmp cloning vector (Stratagene) and then
in vitro transcribed into DIG-labeled riboprobes. The strand
complementary to CNG
1 was used to detect CNG
1 mRNA, and the sense
strand was used as control. These probes were used to hybridize with
the sections cut from the brain tissues embedded in paraffin. The brain
tissues of human adult and 15-wk-old fetus were from autopsy cases with
the consent of family members and the approval of the university
clinical research ethics committee. Tissues were fixed overnight with
4% paraformaldehyde in phosphate-buffered saline (PBS). The postmortem
delay was ~7 h. The tissues were dehydrated through graded ethanol,
cleared with xylene, and embedded in Parafilm, and 6-µm-thick
sections were prepared. After dewaxing and hydration, the sections were
washed briefly with diethylpyrocarbonate-treated water followed by PBS
for 10 min. They were then digested with Proteinase K (10 µg/ml) at
37°C for 15 min. Hybridization was performed at 48°C in a
hybridization buffer containing 4× SSC, 10% dextran sulfate, 1×
Denhardt's solution, 5 mM EDTA, 0.1% CHAPS, 50% deionized formamide,
200 µl/ml herring sperm DNA, and 200 ng/ml DIG-labeled probe (Yew
et al., 1999
). The slides were then washed four times for 15 min each in 2× SSC/0.1% SDS and then twice for 15 min each in 0.2×
SSC/0.1% SDS at 42°C. Colorimetric detections were performed using
an anti-DIG antibody conjugated to alkaline phosphatase followed by
incubation with NBT/BCIP color substrates using a digoxygenin-nucleic
acid detection kit (Roche, Germany) as described previously (Yew
et al., 1999
). For anti-CNG1, positive signals appeared ~5
min after incubation in NBT/BCIP color substrate solution. For the
detection of sense CNG
1, ~30 min was needed for the color
development in NBT/BCIP color substrate solution.
| |
RESULTS |
|---|
|
|
|---|
A CNG
1-related cDNA clone was isolated by screening an adult
human brain cDNA library with a DNA probe specific for CNG
1. Nucleotide sequence of the isolated cDNA clone was analyzed by Sanger's sequencing. Because the library was a commercial cDNA library
that was primed with oligo-dT and unidirectionally cloned in
pCMVsport1, we were able to determine the 5'-3' orientation of the
clone on the basis of the location of the 18-base oligo(A) (Figure 1).
Comparison of nucleotide sequence of this clone with that of human
CNG
1 mRNA (GenBank Accession Number NM 000087) revealed that a
1311-bp region at the 5' portion of this clone was complementary to
CNG
1 mRNA, whereas the rest of the clone (345 bp at the 3' end) had
no similarity to CNG
1 mRNA (Figure 2). Therefore, this transcript
represented a natural antisense transcript complementary to CNG
1
mRNA. We named this transcript anti-CNG1. Comparison of the nucleotide
sequence of anti-CNG1 with that of human chromosome 4 showed that the
345 bp at the 3' end of the clone was actually transcribed from an
immediate downstream region following the CNG
1-coding 1311-bp
upstream region in chromosome 4 between 4p12 and the centromere (Figure 2). It should be noted that anti-CNG1 and CNG
1 were transcribed in
the same locus but in reverse orientation. On the basis of the
published intron-exon structure of human CNG
1 gene (Dhallan et
al., 1992
), the transcription of anti-CNG1 started from exon 10 of
CNG
1 and extended into intron 9. The isolated clone might contain a
genuine 3' end, because oligo(A) was located at the end and multiple
AAUAAA motifs, the signal for processing of mRNA at the 3' end (Nevins,
1983
), could be found near the A-rich region. It was not clear whether
this transcript might encode any protein, but the longest possible open
reading frame was only 243 bp long, which is equivalent to 81 amino
acids. The putative amino acid sequence from this open reading frame is
illustrated in Figure 1. Blast GenBank search with this putative
protein showed no significant similarity to any known protein.
A suspicion could be raised that the isolated clone might represent a cloning artifact caused by a piece of cDNA inserted in the wrong direction. But this was unlikely, because a detailed sequence analysis of the clone showed that the 3' end of the clones contained an intact oligo(dT) that was flanked by a NotI restriction site specially designed for unidirectional cloning, and this NotI restriction site was followed immediately by a pCMV-SPORT1 vector sequence. In addition, the 5' end of the clone contained a complete EcoRI adaptor specially designed for unidirectional cloning, and this EcoRI site was followed immediately by a pCMV-SPORT1 vector sequence. The correct insertion pattern argued against false insertion. The clone was certainly not a result of the false fusion of cDNA for CNG1 with another cDNA encoding different protein, because the analyses of genomic DNA showed that the cDNA was continuously transcribed from a single locus (Figure 2).
RT-PCR was used to examine the expression pattern of this endogenous
anti-CNG1 transcript. PCR primers were carefully designed so that the
targeted 450-bp amplification products extended across the boundary of
intron 9 and exon 10 of CNG
1 (Figure 1). In this way, only anti-CNG1
but not CNG
1 could be amplified. RT-PCR experiments revealed the
expression of anti-CNG1 in adult human brain and two human glioma cell
lines, T98 and D247 (Figure 3A). No
expression could be detected in the total RNA samples isolated from
human adult stomach tissue and rat pheochromocytoma cell line PC12
(data not shown). DNA sequencing confirmed that the amplified PCR
products represented the authentic anti-CNG1. The amplified anti-CNG1
did not originate from the residual genomic DNA contaminations in total
RNA samples, because PCR reactions alone without reverse transcription
did not produce any detectable product (Figure 3A). Furthermore, the
same anti-CNG1 product of ~450 bp could be amplified by RT-PCR from a
commercially available DNase-treated total RNA sample (Figure 3A). In
addition to brain, anti-CNG1 transcript was also expressed in kidney
and liver, because the same 450-bp product could be amplified by PCR
from commercially available human cDNA libraries generated from kidney
and liver (data not shown).
|
Northern blot analysis was used to further examine the expression of anti-CNG1 in brain. A human Multiple Tissue mRNA Blot was hybridized with a 32P-labeled riboprobe specific for anti-CNG1. Three different transcripts with molecular sizes of 5.5, 3.5, and 1.7 kb were detected in poly(A) RNAs from different brain regions (Figure 3B). The 1.7-kb transcript agreed well with the size of anti-CNG1 we isolated, and this transcript was expressed in amygdala, caudate nucleus, hippocampus, and thalamus. Weak hybridization signals could also be observed in substantia nigra and whole brain tissue. Large transcripts of 5.5 and 3.5 kb were expressed more abundantly in amygdala, caudate nucleus, and hippocampus. These large transcripts might represent alternatively spliced forms of anti-CNG1. It should be noted that the 211-bp riboprobe used for hybridization was derived from a region close to the 3' end of anti-CNG1 transcript (Figure 2). This probe was highly specific for anti-CNG1, because BLAST GenBank search with anti-CNG1 did not reveal significant similarity to any known gene. A point worth mentioning was that the riboprobe was strand-specific. It could recognize only the transcripts containing anti-CNG1 but not those containing the complementary strand.
To examine whether the isolated anti-CNG1 was capable of
down-regulating sense CNG
1, in vitro transcribed anti-CNG1 cRNA was
microinjected into Xenopus oocytes to determine whether it could suppress the expression of sense CNG
1 currents. We used membrane-permeable 8-Br-cGMP to activate sense CNG
1 channels in the
oocytes injected with CNG
1 cRNA. In Xenopus oocytes
injected with 5 ng of CNG
1 cRNA, activation of CNG
1 channels by
8-Br-cGMP initiated inward currents (Figure
4, A and B). Conversely, 8-Br-cGMP had no
effect in the control oocytes, which did not receive the injection of
CNG
1 cRNA. Importantly, cGMP-activated inward currents in
CNG
1-injected oocytes were abolished if the oocytes were preinjected with 25 ng anti-CNG1 cRNA 2 h before the injection of CNG
1
(Figure 4, A and B). This suppression was not caused by any nonspecific effect associated with the injection of anti-CNG1 transcript, because
in control experiments, the expression of a voltage-gated potassium
channel, Kv1.5, was not affected by anti-CNG1
transcript (Figure 4, C and D).
|
In situ hybridizations were performed to examine the expression of
anti-CNG1 and sense CNG
1 mRNA in different human brain regions.
DIG-labeled anti-CNG1 riboprobe for in situ hybridization contained the
same anti-CNG1-specific 211-base nucleotides as that used in Northern
blot. The 259-base riboprobe for CNG
1 was derived from a region of
CNG
1 with no complementarity to anti-CNG1 (Figure 2). Our data
showed that the expression of anti-CNG1 was widespread in adult human
CNS. This expression could be observed in pyramidal neurons of
hippocampal CA1 and CA3 of Ammon's horn (Figure
5, A and C), granule neurons in
dentate gyrus (Figure 5, A and G), and Purkinje cells and granular
cells in cerebellum (Figure 5, H and I). Similar expression patterns
were observed for sense CNG
1 (Figure 5, D and F-M). Very little
hybridization signal could be seen in the experiments with control
riboprobes (Figure 5, B, E, J, and N). It was notable that virtually
every visible hippocampal pyramidal, dentate granule, and cerebellar Purkinje neuron was labeled with both anti-CNG1 and sense CNG
1 probes. Two additional sets of DIG-labeled riboprobes, one covering the
region from position 1-667 and the other covering the region from
position 567 to 952 of anti-CNG1 (the positions were as labeled in
Figure 1), were used for in situ hybridization. Because these two
probes covered the regions in which both anti-CNG1 and sense CNG
1
were transcribed, as expected, we were able to detect the hybridization
signals with the probes generated from both sense and antisense strands
(data not shown).
|
Because CNG channels were suggested to play a crucial role in cortical
development (Samanta Roy and Barnstable, 1999
), attempts were made to
study the developmental changes of anti-CNG1 and sense CNG
1 in
cerebral cortex. We found that in fetal cortex, the expression of
anti-CNG1 was observed predominantly in a cortical layer adjacent to
the outermost layer (Figure 6, A and I).
Fetal cortex at 15 wk old was still not well differentiated and could not be divided into classic six-layered cortical structures. But on the
basis of the anatomical location, these anti-CNG1-expressing neurons
should correspond to the layer II and layer III cells of the adult
cortex. Unlike fetal cortex, the expression of sense anti-CNG1 in adult
cortex was more widespread and could be found in almost all cortical
layers except layer I (Figure 6, B and J). High-magnification pictures
showed that anti-CNG1 transcript was expressed in the soma as well as
in the primary dendrite of pyramidal and granule neurons (Figure 6, D
and L). Very little stain was observed in cortical layer I, which
contained primarily dendrites and axons of cortical neurons. Similar
expression patterns were observed for sense CNG
1. The expression was
located predominantly in a narrow layer in fetal cortex (Figure 6, E
and M), but it was widespread and existed in almost all cortical layers
except layer I in adult cortex (Figure 6, F and N). High-magnification pictures showed that both soma and primary dendrite of cortical neurons
were stained (Figure 6, H and P). No hybridization signal could be seen
for the experiments with control riboprobes (Figure 6, C, G, K, and O).
|
We also explored the possible endogenous factor(s) that could regulate
the expression level of anti-CNG1. As shown in Figure 7, treatment of human glioma cell line
T98 with thyroid hormone T3 (1 µM) caused a
significant increase in the expression level of anti-CNG1. The same
treatment reduced the expression of sense CNG
1. Thyroid hormone is a
well-recognized agent involved in brain development and maturation. The
deficiency of thyroid hormone during critical periods of development is
associated with irreversible mental retardation and profound
neurological defects, including deafness and movement disorders
(Dussault and Ruel, 1987
; Oppenheimer and Schwartz, 1997
). The effect
of T3 on the expression of anti-CNG1 and sense
CNG
1 was consistent with the hypothesis that anti-CNG1 might play a
critical role in down-regulating the expression of sense CNG
1 during
brain development. We also tested the effect of human growth hormone.
Human growth hormone at 100 ng/ml had no effect on the expression of
either anti-CNG1 or sense CNG
1 in T98 cells (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
Endogenous natural antisense RNAs are widely distributed in the
prokaryotic and eukaryotic world. Numerous natural antisense RNAs have
also been reported in mammals, including rats, mice, cows, and human
(for review, see Dolnick, 1997
; Simons, 1988
; Vanhee-Brossollet and
Vaquero, 1998
). These antisense RNAs are complementary to sense
transcripts encoding proteins involved in extremely diverse biological
functions: hormonal response, proliferation control, development, etc.
In fact, it is believed that endogenous antisense regulation may be
part of a general mechanism in the control of gene expression (Wutz
et al., 1997
; Simons, 1988
; Vanhee-Brossollet and Vaquero,
1998
; Kimelman and Kirschner, 1989
; Thrash-Bingham and Tartof, 1999
).
Several best-characterized examples in eukaryotes include a native
antisense RNA to basic fibroblast growth factor in Xenopus
(Kimelman and Kirschner, 1989
), an antisense RNA to Igf2r (the receptor
for insulin-like growth factor type-2) in mice (Wutz et al.,
1997
), an antisense RNA to HIF1
(hypoxia inducible factor
) in
humans (Thrash-Bingham and Tartof, 1999
), and an antisense RNA to
eb4-psv gene in Dictyostelium (Hildebrandt and Nellen,
1992
). In this study, we isolated a cDNA clone representing an
endogenous antisense transcript against the mRNA of human CNG
1
channels. The presence of anti-CNG1 transcript(s) was verified by
RT-PCR, Northern blot hybridization, and in situ hybridization. The
expression of the transcript(s) could be found in many regions of human
brain (Figures 3 and 5) as well as in human glioma cell lines T98 and
D247 (Figure 3A). Interestingly, the molecular size of the isolated
anti-CNG1 cDNA clone matched that of one of the transcripts detected on
the Northern blot (1.7 kb), suggesting that the isolated anti-CNG1
clone might represent a complete transcript. This study represents the
first demonstration of an endogenous antisense RNA transcript against
any ion channel.
A unique function of antisense transcripts is to regulate the
expression of their sense counterparts. It has been recognized that
antisense transcripts may hybridize with their complementary sense
mRNAs to form RNA-RNA duplexes. These duplexes can be digested by the
RNases that are specific for double-stranded RNA. Alternatively, because of the structural similarity between the sense and antisense transcripts, antisense transcripts may down-regulate the sense gene by
depriving sense mRNAs from the proteins necessary for their functions
(Vanhee-Brossollet and Vaquero, 1998
). To test whether the isolated
1.66-kb anti-CNG1 transcript was capable of down-regulating the
expression of sense CNG
1, we used the Xenopus oocyte
expression system. Xenopus oocytes have endogenous Ca2+-dependent Cl
channels that are sensitive to the Ca2+
concentration beneath the plasma membrane. Therefore, this expression system can be used as an amplification system to detect
Ca2+ influx (Petersen and Berridge, 1994
). We
chose to use this Ca2+-activated
Cl
channel reporter system instead of
conventional inside-out patch clamp for the detection of CNG channel
expression, because the effect of antisense RNA should presumably
decrease the overall density (or number) of CNG
1 channel protein. A
decrease in the overall density of the channel protein could be better
resolved in the whole-cell recording mode, which represented the
overall expression of CNG
1, rather than in the patch recording mode, which would not reflect the overall channel density. We microinjected the in vitro transcribed cRNA for sense CNG
1 into Xenopus
oocytes. The injected oocytes exhibited cGMP-activated inward currents (Figure 4, A and B). The inward currents were caused by the activation of Ca2+-permeable CNG
1 channels by 8-Br-cGMP.
The opening of CNG
1 channels promoted Ca2+
influx, which in turn stimulated Ca2+-dependent
Cl
channels. A critical piece of evidence that
supported the functional role of anti-CNG1 was provided by anti-CNG1
preinjection study. The prior injection of oocytes with anti-CNG1 cRNA
before the injection of sense CNG
1 effectively "knocked out" the
cGMP-activated inward currents, indicating that the isolated anti-CNG1
transcript possessed the function of down-regulating CNG
1 channels.
CNG channels may play a general role in a number of activity-dependent
modulatory and adaptive changes in synaptic strength, such as LTP and
LTD (Kingston et al., 1996
; Savchenko et al., 1997
; Zufall et al., 1997
). A growing body of evidence
suggests that CNG channels are important downstream mediators for the
effects of the diffusible messengers NO and carbon monoxide (CO)
(Shiells and Falk, 1990
; Ahmad et al., 1994
; Leinders-Zufall
et al., 1995
), agents known to stimulate the activity of
soluble guanylyl cyclase and then cGMP level. The resultant activation
of CNG channels may subsequently increase the release of
neurotransmitter(s) in presynaptic terminals through
Ca2+ influx-mediated exocytosis (Zufall et
al., 1997
). This mechanism may be widely used in brain as a
retrograde signaling pathway to modulate synaptic transmission (Reike
and Schwartz, 1994
; Savchenko et al., 1997
), and it may
represent an important feature of a number of forms of
activity-dependent synaptic plasticity (Arancio et al.,
1995
; Zufall et al., 1997
). In agreement with the above notion, our data showed that CNG
1 transcript was expressed in many
brain regions that were known to be important for LTP and LTD, such as
hippocampal CA1 and CA3, dentate gyrus, and the cerebellum Purkinje
layer. If the function of anti-CNG1 is to regulate the expression of
sense CNG
1, it is likely that they will be coexpressed in the same
type of tissues or cells (Laabi et al., 1994
; Knee et
al., 1994
; Thrash-Bingham and Tartof, 1999
). Our experiments demonstrated that anti-CNG1 and CNG
1 transcripts were indeed coexpressed in many different brain regions. It was also noticed in our
experiments that a long color development time for in situ hybridization was needed for the detection of sense CNG
1. This was
in agreement with several previous in situ hybridization studies of
CNG
1 in rat hippocampus and cerebral cortex (Kingston et
al., 1996
; Samanta Roy and Barnstable, 1999
), and it suggested
that the level of CNG
1 mRNA in neurons was low. It was possible that the suppressive effect of anti-CNG1 might have contributed to the low
levels of sense CNG
1 mRNA.
CNG channels play a role in the development of CNS. In rat brain, the
CNG channels are highly expressed in developing visual cortex during
dendritic outgrowth, and the expression level changes in an
age-dependent manner (Samanta Roy and Barnstable, 1999
). In
Caenorhabditis elegans, mutation of CNG channels has been
shown to cause defects in axon outgrowth (Coburn and Bargmann, 1996
). Because CNG channels are calcium-permeable channels and because calcium
levels in growth cones of neurons are known to be important in
regulating growth cone motility, it is conceivable that CNG channels,
by influencing [Ca2+]i
levels, may exert a great effect on neuronal growth in cortical development. In agreement with what was reported by Samanta Roy and
Barnstable (1999)
for rat visual cortex, we found that the expression
of CNG
1 in human cerebral cortex was developmentally regulated. In
fetal visual and frontal cortex, the expression was concentrated
primarily on a narrow neuronal layer that corresponded to the layer II
and layer III of adult cortex. In adult cortex, CNG
1 was universally
expressed in almost all areas of cortical structure except layer I,
which contained primarily dendrites and axons of cortical neurons.
Interestingly, the expression pattern of anti-CNG1 was remarkably
similar to that of CNG
1 (Figure 6). It was expressed predominantly
in a narrow layer in fetal cortex, but it was universally expressed in
all cortical layers except layer I in adult cortex. The expression of
anti-CNG1 in the developing fetal cortex suggests that anti-CNG1 may
down-regulate CNG channel level, thereby influencing neuronal growth
during cortical development. Concurrent expression of sense CNG
1 and
anti-CNG1 together with the parallel developmental changes in the
expression levels of these two transcripts supports the notion that
anti-CNG1-mediated regulation might be a general mechanism for the
control of CNG
1 expression in the CNS. The regulatory role of
T3 on the expression of anti-CNG1 and sense
CNG
1 in human glioma cell line T98 further substantiates the
argument that anti-CNG1 may play a critical role in down-regulating the
expression of sense CNG
1 during brain development.
In conclusion, we have isolated a 1.66-kb endogenous transcript
(anti-CNG1) that is antisense to CNG
1 mRNA. This transcript is
coexpressed with sense CNG
1 mRNA in many different brain regions, noticeably in those regions involved in LTP and LTD, and there are
parallel changes of anti-CNG1 and CNG
1 transcripts during brain
development. It is likely that the suppression of CNG
1 expression by
anti-CNG1 may play an important role in neuronal functions, especially
in LTP/LTD and cortical development. Endogenous antisense RNA-mediated
regulation may represent a new mechanism through which the activity of
ion channels can be regulated in human CNS.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. K.H. Lee for advice, F. Tang and M.W. Leung for technical support, and P.C. Leung for manuscript correction. This study was supported by Hong Kong Research Grant Council CUHK4259/99 M and the Chinese University Research Committee.
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: yao2068{at}cuhk.edu.hk.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-03-0127. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-03-0127.
| |
REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||