|
|
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 4, 1274-1281, April 2002


and
*Department of Pathology, Program in Stem Cell Biology, Shands
Cancer Center, University of Florida College of Medicine, Gainesville,
Florida 32610;
Department of Pharmacology, University of
Florida College of Medicine, Gainesville, Florida 32610; and
Department of Stem Cell Regulation, Institute of Medical
Science, University of Tokyo, Tokyo 108-8639, Japan
| |
ABSTRACT |
|---|
|
|
|---|
Mouse embryonic stem (ES) cells can proliferate indefinitely in an undifferentiated state in the presence of leukemia inhibitory factor (LIF), or differentiate into all three germ layers upon removal of this factor. To determine cellular factors associated with self-renewal of undifferentiated ES cells, we used polymerase chain reaction-assisted cDNA subtraction to screen genes that are expressed in undifferentiated ES cells and down-regulated after incubating these cells in a differentiation medium without LIF for 48 h. The mRNA expression of a tetraspanin transmembrane protein, CD9, was high in undifferentiated ES cells and decreased shortly after cell differentiation. An immunohistochemical analysis confirmed that plasma membrane-associated CD9 was expressed in undifferentiated ES cells but low in the differentiated cells. Addition of LIF to differentiating ES cells reinduced mRNA expression of CD9, and CD9 expression was accompanied with a reappearance of undifferentiated ES cells. Furthermore, activation of STAT3 induced the expression of CD9, indicating the LIF/STAT3 pathway is critical for maintaining CD9 expression. Finally, addition of anti-CD9 antibody blocked ES cell colony formation and reduced cell viability. These results indicate that CD9 may play a role in LIF-mediated maintenance of undifferentiated ES cells.
| |
INTRODUCTION |
|---|
|
|
|---|
Mouse embryonic stem (ES) cells, which originally derived from
inner cell mass of an early embryo named blastocyst, are able to
sustain their pluripotency in in vitro cell culture (Evans and Kaufman,
1981
; Martin, 1981
). Undifferentiated mouse ES cells can be maintained
for a long time in media containing the cytokine leukemia inhibitory
factor (LIF) (Smith et al., 1988
; Williams et
al., 1988
). Pluripotency of such cultured ES cells has been demonstrated in both in vivo and in vitro experiments. When injected into blastocysts, ES cells participate in embryonic development involving all three germ layers producing chimeric mice (Bradley et al., 1984
). ES cells also form teratomas containing
various mature tissues when injected into immunocompromised mice (Evans and Kaufman, 1981
; Martin, 1981
). In vitro, mouse ES cells start to
differentiate to every possible lineage upon removal of LIF from the
culture medium. The mechanism by which LIF maintains ES cells in
undifferentiated state is not completely understood. The transcription
factor STAT3 is a downstream target of LIF and its receptor
interaction (Niwa et al., 1998
; Matsuda et al.,
1999
). It has been shown that the activity of STAT3 is necessary and sufficient for LIF-induced self-renewal of mouse ES cells (Matsuda et al., 1999
). It remains unclear, however, which genes are
regulated by the STAT3 transcription factor in mouse ES cells and play
actual roles in the maintenance of stem cells. Indeed, there is no
generally accepted mechanism by which stem cells are maintained as
undifferentiated cells. Human ES cell cultures have been recently
established using mouse fibroblasts as feeder cells (Shamblott et
al., 1998
; Thomson et al., 1998
). In contrast to mouse
ES cells, LIF cannot replace such feeder cells to maintain self-renewal
of human ES cells (Thomson et al., 1998
). In addition, some
of the adult stem cells may be maintained in a multipotent status in
vitro for extended intervals (Pittenger et al., 1999
), but
the in vitro culture of others such as hematopoietic and neural stem
cells have not yet been successfully established as homogeneous stem
cell populations. Elucidating how different types of stem cells can be
maintained in culture may provide important clues into the regulation
of stem cell self-renewal, and may prove critical to facilitate in
studies of adult stem cells. It is important to understand the
molecular mechanisms of in vitro maintenance of stem cells,
particularly when clinical application of such stem cells into various
diseases now becomes promising (Petersen and Terada, 2001
).
To identify candidate genes that play a role in stem cell maintenance,
we attempted to isolate genes that were highly expressed in
undifferentiated ES cells but rapidly down-regulated after cell
differentiation. We used a polymerase chain reaction (PCR)-assisted cDNA subtraction method that has been successfully applied to enrich/identify genes that are selectively expressed in other cells
(Seale et al., 2000
; Geschwind et al., 2001
;
Terskikh et al., 2001
). Through this method, a plasma
membrane-associated molecule, CD9, was determined to be a gene
selectively expressed in undifferentiated ES cells. Additionally, the
potential regulation and role of CD9 in mouse ES cells were explored.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
ES Cell Culture
Mouse ES cell lines R1 (a gift from A. Nagy, Toronto, Ontario,
Canada) or EB3/5 (a gift from H. Niwa, Osaka, Japan) were maintained on
gelatin-coated dish in a medium containing 1000 U/ml recombinant mouse
LIF (ESGRO; Chemicon International, Temecula, CA) as described previously (Hamazaki et al., 2001
). In vitro ES cell
differentiation was induced using a standard method as we described
previously (Minamino et al., 1999
; Hamazaki et
al., 2001
). Briefly, ES cells were washed twice with
phosphate-buffered saline (PBS), and resuspended in a differentiation
medium (Iscove's modified Dulbecco's medium [Invitrogen,
Carlsbad, CA] containing 20% fetal calf serum, 2 mM
L-glutamine, 100 U/ml penicillin, 100 µg/ml
streptomycin (Invitrogen), 300 µM monothioglycerol). Cells were
cultured on Petri dish in which ES cells form aggregated embryoid body.
In experiments of readdition of LIF, ES cells were differentiated in
the ES differentiation medium described above for initial 3 d, and
LIF (or 4-hydroxy tamoxifen [ 4-HT]) was added back directly to the culture.
PCR-assisted cDNA Subtraction
PCR-assisted cDNA subtraction was performed based on the manufacturer's manual for the PCR-Select cDNA subtraction kit (CLONTECH, Palo Alto, CA). Total RNA was prepared from undifferentiated ES cells (tester) and 48-h differentiated ES cells (driver) by using an RNA aqueous kit (Ambion, Austin, TX). The mRNA was purified using Poly (A) Pure kit (Ambion).
Cloning and Sequencing of Subtracted cDNA
A subtracted cDNA library was cloned into TOPO TA-cloning vector (Invitrogen). After transformation, insert cDNAs were amplified by colony PCR with nested PCR primers 1 and 2R provided with the PCR-Select cDNA subtraction kit (CLONTECH). Amplified PCR fragments were purified with PCR purification kit (QIAGEN, Valenica, CA) and sequenced.
Semiquantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
Total RNA was prepared from ES cells by using an Aqueous kit
(Ambion). Total RNA (2 µg) was used for cDNA synthesis by using SuperScript II first-strand synthesis system with oligo(dT)
(Invitrogen). Final products of reverse transcriptase reaction
were filled up to 200 µl with H2O, and 5 µl
was used for each PCR reaction. PCR amplification was performed using
Taq DNA polymerase (Eppendorf, Westbury, NY). The PCR
reaction consisted of 25-30 cycles (specified below) of 1 min at
94°C, 1 min at 55°C, and 1 min at 72°C. Sequence of upstream and
downstream primers pair and cycle numbers used for each gene were as
follows: CD9 (CAGTGCTTGCTATTGGACTATG, GCCACAGCAGTCCAACGCCATA, 30),
osteopontin (GCAGACACTTTCACTCCAATCG, GCCCTTTCCGTTGTTGTCCTG, 30),
CD81 (CCATCCAGGAGTCCCAGTGTCT, GAGCATGGTGCTGTGCTGTGGC, 30), platelet
endothelial cell adhesion molecule-1 (PECAM-1) (AGGGGACCAGCTGCACATTAGG, AGGCCGCTTCTCTTGACCACTT, 30), E-cadherin (GTCAACACCTACAACGCTGCC, CTT-GGCCTCAAAATCCAAGCC, 25),
1 integrin
(AATGTTTCAGTG-CAGAGCC, ATTGGGATGATGTCGGGAC,
30),
3 integrin (AACA-GCGCTACCTCCTTCTG, GTCCTTCCGCTGAATCATGT, 30),
5 integrin (GCTGGACTGTGGTGAAGACA, CAGTCGCTGACTGGGA-AAAT, 30),
6 integrin
(AGGAGTCGCGGGATATCTTT, CAGGCCTTCTCCGTCAAATA, 30), heparin
binding-epidermal growth factor (HB-EGF) (GTTGGTGACCGGTGAGAGTC,
TGCAAGAGGGAGTACGGAAC, 30), brachyury (AAGGAACCACCGGTCATC,
GTGTGCGTCAGTGGTGTGTAATG, 30),
-actin (TTCCTTCTTGGGTATGGAAT, GAGCAATGATCTTGATCTTC, 25), Oct-4
(TGGAGAC-TTTGCAGCCTGAG, TGAATGCATGGGAGAGCCCA, 30),
UTF1 (GCCAACT-CATGGGGCTATTG, CGTGGAAGAACTGAATCTGAGC,
30), FGF4 (TACTGCAACGTGGGCATCGGA, GTGGGTTACCTTCATGGTAGG, 30), Rex-1 (CGTGTAACATACACCATCCG, GAAATCCTCTTCCAGAATGG, 30), and FGF5
(AAAGTCAATGGCTCCCACGAA, CTTCAGTCTGTACTTCACTGG, 30).
For each set of PCR primers, RT-PCR without reverse transcriptase was conducted to confirm that no genomic DNA was amplified.
Immunofluorescence Staining
ES cells were cultured on gelatin-coated plate, washed once with PBS, and fixed in 3.7% formamide/PBS for 15 min at room temperature. Cells were then treated with 0.5% Triton X/PBS for 5 min and with 5% bovine serum albumin/PBS for 1 h at room temperature. Cells were further incubated with either anti-SSEA1 (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA), anti-mouse osteopontin (R & D Systems, Minneapolis, MN), or anti-mouse CD9 (KMC8) (BD PharMingen, San Diego, CA) for 2 h at room temperature. After four times washing with PBS, cells were incubated with anti-mouse IgG, anti-goat IgG, or anti-rat IgG antibodies conjugated to fluorescein isothiocyanate (Jackson Immunoresearch Laboratories, West Grove, PA). After four times washing with PBS, cells were mounted by Vectashield containing 4,6 diamidino-2-phenylindole (Vector Laboratories, Burlingame, CA).
Propidium Iodide Staining
Propidium iodide was added (final 10 µg/ml) directly to the culture medium for staining cells with low viability. After a 30-min incubation at room temperature, staining was observed under a fluorescent microscope (IX70; Olympus, Tokyo, Japan).
| |
RESULTS |
|---|
|
|
|---|
To identify genes that may be involved in maintenance of
undifferentiated ES cells, we attempted to isolate genes that are highly expressed in ES cells and rapidly down-regulated after cell
differentiation. Herein, we used a PCR-assisted subtraction method. The
cDNA prepared from undifferentiated ES cells was subtracted by the cDNA
from differentiating ES cells in a differentiation medium without LIF
for 48 h. Of the subtracted cDNA clones, 304 cDNAs have been
sequenced. Of these, 98 genes were cloned more than two times, and the
rest were unique. Osteopontin was the most frequently cloned gene, and
a total of nine cDNA clones (corresponding to a total of three
different cDNA fragments) was found among the 304 sequenced genes.
Osteopontin, one of the extracellular matrix proteins, has been shown
to be highly expressed in ES cells and decreased after ES cell
differentiation (Botquin et al., 1998
). In the present
screening, we also cloned other genes previously identified as ones
highly expressed in ES cells and down-regulated after cell
differentiation, such as Rex-1 (Hosler et al., 1989
), KLF4
(Kelly and Rizzino, 2000
), and stathmin (Doye et al., 1992
) (one clone each). These results indicate that the method effectively identifies undifferentiated ES cell-associated genes.
CD9 was among the genes identified, and its expression in ES cells has
not been reported previously. CD9 is a type III membrane protein with
four transmembrane domains (tetraspanin) and proposed to be involved in
cell adhesion, migration, proliferation, and fusion (Ikeyama et
al., 1993
; Masellis-Smith and Shaw, 1994
; Hadjiargyrou and
Patterson, 1995
; Maecker et al., 1997
; Tachibana and Hemler, 1999
). Using RT-PCR, we confirmed that the mRNA expression of CD9 was
down-regulated within 24 h of ES cell differentiation (Figure
1A). The CD9 expression was further
decreased until day 3 in the differentiation medium. In the same
system, we also examined other cell adhesion-related molecules such as
osteopontin and PECAM-1, which have been reported to be expressed in
undifferentiated ES cells (Botquin et al., 1998
; Robson
et al., 2001
). The mRNAs of both osteopontin and PECAM-1
were expressed in undifferentiated ES cells and down-regulated after
differentiation as well. In contrast, the expression of other cell
adhesion-related molecules including E-cadherin, and
1,
3,
5,
and
6 integrins was not significantly changed throughout the
time course of differentiation (days 0-3). Expression of HB-EGF, which
is known to associate with CD9 (Iwamoto et al., 1994
), also
down-regulated during ES cell differentiation. The expression of CD81,
another tetraspanin molecule closely related to CD9 (Maecker et
al., 1997
), was also detected in undifferentiated ES cells and
modestly down-regulated after differentiation.
|
We also examined the mRNA expression of CD9 in a longer time course of
ES cell differentiation, up to day 15 (Figure 1B). CD9 mRNA was
expressed in undifferentiated ES cells (day 0) and down-regulated at
day 5 of differentiation. The expression was increased again at day 10 and 15 of differentiation. Osteopontin and PECAM-1 also highly
expressed in ES cells, temporally decreased by day 5, and increased
again at day 10. Accordingly, those cell adhesion-related molecules
(CD9, osteopontin, and PECAM-1) were highly expressed in
undifferentiated ES cells and rapidly decreased during initial cell
differentiation. However, their expression was not ES cell specific in
contrast to germ cell/early embryonic cell-specific genes such as
Oct-4, UTF1, FGF4, and Rex-1 (Rogers et al., 1991
; Niswander
and Martin, 1992
; Okuda et al., 1998
; Pesce et
al., 1998
). Oct-4, known to be required for inner cell mass
formation in blastocysts (Nichols et al., 1998
), was
expressed until day 5 of the ES cell differentiation and eliminated by
day 10. Expression of UTF1, FGF4 and Rex-1 was also eliminated by days
5-10. Markers for early mesodermal differentiation, such as brachyury
and FGF5 (Haub and Goldfarb, 1991
) expression, were high at day 5 and
decreased thereafter in the system. In addition, contractile cardiac
myocytes were observed under microscope by day 8-10, and expression of
albumin mRNA was detected by day 12 as we demonstrated previously
(Hamazaki et al., 2001
).
The protein expression of CD9 and osteopontin was then examined using
immunofluorescence staining. CD9 was localized at cell surface of ES
cells, as expected, when they were maintained in the ES maintenance
medium containing LIF. However, within 5 d of cell
differentiation, CD9 protein expression became almost undetectable
(Figure 2). Osteopontin, which is a
secreting protein, was detected at peri-nucleus, presumably endoplasmic
reticulum or Golgi, in undifferentiated ES cells. The protein
expression of osteopontin was similarly decreased within 5 d of ES
cell differentiation.
|
To further confirm the association of CD9 and osteopontin expression
with undifferentiated status of ES cells, we examined their protein
expression when LIF was added back to differentiating ES cells (Figure
3A). ES cells were incubated in the
differentiation medium for 4 d, treated with trypsin, and then
incubated in the ES maintenance medium containing LIF again. Most of
the cells remained differentiated in this condition, but, of interest,
several undifferentiated ES cell-like colonies (growing as a compact
colony with tight cell-to-cell conjunctions) appeared in the culture within 4 d after switching to the LIF-containing medium (Figure 3B). These undifferentiated ES cell-like colonies were morphologically distinguishable from the other differentiated cells. Moreover, SSEA1,
which is a surface marker for undifferentiated mouse ES cells (Solter
and Knowles, 1978
), was exclusively expressed in these compact
colonies. Anti-CD9 staining revealed that these undifferentiated
ES-like colonies also strongly expressed CD9. Importantly, the
expression of CD9 was low or not observed in surrounding differentiated
cells. Expression of osteopontin was also found exclusively in those
ES-like colonies. These results indicate that CD9 expression as well as
osteopontin expression is associated with the undifferentiated
phenotype during early differentiation of ES cells.
|
To examine whether LIF is a factor important for CD9 expression in the
ES maintenance medium, we incubated ES cells in LIF-free differentiation medium for 72 h. Then, LIF was added back to the culture for additional 24 h. CD9 mRNA was increased by this
readdition of LIF (Figure 4). STAT3 is
known as a downstream target transcription factor of the LIF
receptor-mediated signaling. By using STAT3ER (STAT3 fused to
estrogen-ligand binding domain), with which STAT3 activity could be
modulated by concentration of 4-HT in the medium, we examined whether
STAT3 activity was sufficient for the up-regulation of CD9 expression.
ES cells constitutively expressing STAT3ER were maintained with the ES
maintenance medium containing LIF. After LIF removal for 3 d, 4-HT
was added. As shown in Figure 4, CD9 mRNA expression was induced by
addition of 4-HT. These results indicate that the LIF/STAT3 pathway is
important for expression of CD9 in ES cells.
|
Finally, we investigated whether CD9 expression is important in
undifferentiated ES cells by using a neutralizing antibody against CD9,
KMC8 (Oritani et al., 1996
). This antibody has been shown to
block cell differentiation and cell fusion in other cell types,
including myoblasts (Oritani et al., 1996
; Aoyama et
al., 1999
; Tachibana and Hemler, 1999
; Tanio et
al., 1999
). ES cells were incubated in the medium containing LIF
in the presence of the antibody for 24 h. The control cells were
incubated with the identical concentration of an isotypic control
antibody containing the identical concentration of azide in stock
solution. Interestingly, the ES cells cultured in the presence of the
anti-CD9 antibody did not form compact ES-like colonies (Figure
5). Moreover, cells appeared to be dead
within 24 h of culture in the presence of the anti-CD9 antibody.
The decrease in cell viability after treatment with the anti-CD9
antibody was confirmed by propidium staining of cells (Figure 5).
Anti-CD9 antibody decreased the cell viability at the concentration as
low as 1 µg/ml. In contrast, neither nonspecific rat IgG2a,
nor
anti-osteopontin antibody (up to 10 µg/ml) affected the colony
formation or survival of ES cells. Specific interaction between SSEA1
molecules on cell surface (LewisX determinants)
is critical for cell aggregation of embryonic carcinoma cells (Eggens
et al., 1989
). An antibody against SSEA1, which blocks cell
adhesion (Cao et al., 2001
), also caused decrease in cell
viability of ES cells as seen with the anti-CD9 antibody.
|
| |
DISCUSSION |
|---|
|
|
|---|
A PCR-assisted subtraction method revealed that CD9 was among a
group of genes highly expressed in ES cells but down-regulated shortly
after cell differentiation. This group of genes includes several cell
adhesion-related molecules such as osteopontin and PECAM-1, whereas
others such as integrins
1,
3,
5, and
6 and E-cadherin were constitutively expressed during initial differentiation of ES cells. We also demonstrated that CD9 is likely under regulation of the LIF/STAT3 pathway in ES cells, which is critical for
self-renewal of undifferentiated ES cells. Indeed, CD9 expression was
exclusively associated with the undifferentiated phenotype of ES cells
when such cells reappeared among differentiating ES cells by readdition of LIF to the culture. The expression of CD9 along with other cell
adhesion-related molecules may be important for maintenance of
undifferentiated ES cells. Furthermore, a blocking antibody against CD9
(KMC8) inhibited colony formation and survival of ES cells, suggesting
that CD9 is playing a role in maintenance of ES cells in vitro.
A potential mechanism by which the anti-CD9 antibody reduced cell
survival may be its interference with cell adhesion of ES cells as seen
with anti-SSEA1 antibody (Cao et al., 2001
). Although CD9
itself is not considered as a cell adhesion molecule, CD9 has been
proposed to play a role in cell-extracellular matrix or cell-cell
interactions as a cofactor of integrin (Rubinstein et
al., 1994
; Nakamura et al., 1995
; Berditchevski
et al., 1996
). It still remains unclear, however, how the
association of CD9 with integrin regulates
cell-cell/cell-extracellular matrix interactions or modifies signal
transduction through the integrin/integrin-ligand interaction. Osteopontin, one of the components of the extracellular matrix, can serve as a ligand of integrin (Denhardt et
al., 2001
), and PECAM-1 binds to integrins and enhances
their function (Tanaka et al., 1992
; Leavesley et
al., 1994
; Piali et al., 1995
; Buckley et
al., 1996
; Newman, 1997
). Collectively,
integrin-associated signals may be important in self-renewal of
ES cells.
Cell adhesion, especially interactions among cells and components of
their environmental niche, is considered to be important for stem cell
maintenance of hematopoietic stem cells (HSCs) (Chan and Watt, 2001
).
It has been demonstrated that CD9 may be involved in hematopoiesis. The
KMC8 antibody against CD9 inhibited production of myeloid cells in
long-term bone marrow cell cultures (Oritani et al., 1996
)
and expansion of erythroid progenitor cells (Aoyama et al.,
1999
) or osteoclasts (Tanio et al., 1999
) when cocultured with stromal cells. Accordingly, CD9 might be important for colony formation or maintenance of HSCs. In this context, it is tempting to
examine the expression of CD9 in adult stem cells other than HSCs, such
as neuronal stem cells or liver stem cells.
CD9 is also known to associate with HB-EGF (Iwamoto et al.,
1994
), which is proposed to be important in cell survival under stressed conditions (Miyoshi et al., 1997
; Takemura et
al., 1997
; Horikawa et al., 1999
). Because induced
expression of CD9 can potentiate the function of HB-EGF (Iwamoto
et al., 1994
; Higashiyama et al., 1995
), CD9 may
support cell survival through HB-EGF. HB-EGF mRNA was also expressed in
ES cells and down-regulated during initial differentiation. It should
be noted that CD9 may be involved in cell-cell fusion as well. CD9
/
female is sterile because CD9 null oocyte cannot fuse to sperm (Miyado
et al., 2000
; Le Naour et al., 2000
), and
overexpression of CD9 in myoblast-derived RD sarcoma cell facilitates
the formation of multinucleated cells (Tachibana and Hemler, 1999
).
Despite the potential role of CD9 in ES cells we propose herein, CD9
null mice are viable without an apparent abnormality except female
infertility. One hypothesis would be that closely related tetraspanins
such as CD81, which was also expressed in ES cells, may compensate
function of CD9 during early embryonic development. Alternatively, CD9
may be required more stringently in in vitro maintenance of ES cells.
Such a gap between in vitro ES cell maintenance and in vivo development
has been observed previously with deficiencies of other molecules. The
LIF/STAT3 signaling mediated by the LIF receptor/gp130 complex is
critical for maintenance of ES cells in vitro; however, embryos lacking LIF, the LIF receptor, or gp130 develop normally, at least until midgestation (Stewart et al., 1992
; Ware et al.,
1995
; Yoshida et al., 1996
). Recently, Nichols et
al. (2001)
found that gp130
/
embryos were unable to resume
embryogenesis after delayed implantation. Moreover, pluripotent cells
were absent in delayed gp130
/
blastocysts, and they had reduced
number of ICM cells due to apoptotic cell death. These results
imply the importance of stem cell maintenance under suboptimal
conditions even although it is not necessary for normal development.
CD9 may be one of the factors downstream of the LIF/gp130/STAT3
pathway, critical for stem cell maintenance under such suboptimal
conditions or stem cell maintenance in vitro. Maintenance of stem cells
in vitro is important particularly when we consider clinical
application of stem cells. Expansion of adult normal adult stem cells
in vitro as a homogeneous population would facilitate application of
such stem cells. The study of factors necessary for ES cell maintenance
may contribute to a discovery of common mechanisms by which stem cells
can be sustained as stem cells in vitro.
| |
ACKNOWLEDGMENTS |
|---|
We are indebted to Dr. Andras Nagy and Hitoshi Niwa for providing ES cell lines, Drs. Stephen Sugrue and James M. Crawford for critical reading of the manuscript, and Amy Meacham and Neal Devine for technical assistance. This work was supported by a grant from the National Institutes of Health to N.T. (DK-59699).
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: terada{at}pathology.ufl.edu.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.02-01-0600. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.02-01-0600.
| |
REFERENCES |
|---|
|
|
|---|
v
3 as a heterotypic ligand for CD31/PECAM-1.
J. Cell Sci.
109, 437-445.
3
1 at cell-cell contact sites.
J. Cell Biol.
129, 1691-1705.
v
3 integrin involved in adhesion of leukocytes to endothelium.
J. Cell Biol.
130, 451-460.This article has been cited by other articles:
![]() |
I. Aksoy, C. Sakabedoyan, P.-Y. Bourillot, A. B. Malashicheva, J. Mancip, K. Knoblauch, M. Afanassieff, and P. Savatier Self-Renewal of Murine Embryonic Stem Cells Is Supported by the Serine/Threonine Kinases Pim-1 and Pim-3 Stem Cells, December 1, 2007; 25(12): 2996 - 3004. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nash, L. Neves, R. Faast, M. Pierce, and S. Dalton The Lectin Dolichos Biflorus Agglutinin Recognizes Glycan Epitopes on the Surface of Murine Embryonic Stem Cells: A New Tool for Characterizing Pluripotent Cells and Early Differentiation Stem Cells, April 1, 2007; 25(4): 974 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oka, N. Rodic, J. Graddy, L.-J. Chang, and N. Terada CpG Sites Preferentially Methylated by Dnmt3a in Vivo J. Biol. Chem., April 14, 2006; 281(15): 9901 - 9908. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Korkola, J. Houldsworth, R. S.V. Chadalavada, A. B. Olshen, D. Dobrzynski, V. E. Reuter, G. J. Bosl, and R.S.K. Chaganti Down-Regulation of Stem Cell Genes, Including Those in a 200-kb Gene Cluster at 12p13.31, Is Associated with In vivo Differentiation of Human Male Germ Cell Tumors Cancer Res., January 15, 2006; 66(2): 820 - 827. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nunomura, K. Nagano, C. Itagaki, M. Taoka, N. Okamura, Y. Yamauchi, S. Sugano, N. Takahashi, T. Izumi, and T. Isobe Cell Surface Labeling and Mass Spectrometry Reveal Diversity of Cell Surface Markers and Signaling Molecules Expressed in Undifferentiated Mouse Embryonic Stem Cells Mol. Cell. Proteomics, December 1, 2005; 4(12): 1968 - 1976. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Buageaw, M. Sukhwani, A. Ben-Yehudah, J. Ehmcke, V. Y. Rawe, C. Pholpramool, K. E. Orwig, and S. Schlatt GDNF Family Receptor alpha1 Phenotype of Spermatogonial Stem Cells in Immature Mouse Testes Biol Reprod, November 1, 2005; 73(5): 1011 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sekkai, G. Gruel, M. Herry, V. Moucadel, S. N. Constantinescu, O. Albagli, D. T.-L. Roux, W. Vainchenker, and A. Bennaceur-Griscelli Microarray Analysis of LIF/Stat3 Transcriptional Targets in Embryonic Stem Cells Stem Cells, October 1, 2005; 23(10): 1634 - 1642. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Skottman, M. Mikkola, K. Lundin, C. Olsson, A.-M. Stromberg, T. Tuuri, T. Otonkoski, O. Hovatta, and R. Lahesmaa Gene Expression Signatures of Seven Individual Human Embryonic Stem Cell Lines Stem Cells, September 1, 2005; 23(9): 1343 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Palmqvist, C. H. Glover, L. Hsu, M. Lu, B. Bossen, J. M. Piret, R. K. Humphries, and C. D. Helgason Correlation of Murine Embryonic Stem Cell Gene Expression Profiles with Functional Measures of Pluripotency Stem Cells, May 1, 2005; 23(5): 663 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Xu, E. Rosler, J. Jiang, J. S. Lebkowski, J. D. Gold, C. O'Sullivan, K. Delavan-Boorsma, M. Mok, A. Bronstein, and M. K. Carpenter Basic Fibroblast Growth Factor Supports Undifferentiated Human Embryonic Stem Cell Growth Without Conditioned Medium Stem Cells, March 1, 2005; 23(3): 315 - 323. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Cartwright, C. McLean, A. Sheppard, D. Rivett, K. Jones, and S. Dalton LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism Development, March 1, 2005; 132(5): 885 - 896. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Pera and A. O. Trounson Human embryonic stem cells: prospects for development Development, November 15, 2004; 131(22): 5515 - 5525. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cui, K. Johkura, F. Yue, N. Ogiwara, Y. Okouchi, K. Asanuma, and K. Sasaki Spatial Distribution and Initial Changes of SSEA-1 and Other Cell Adhesion-related Molecules on Mouse Embryonic Stem Cells Before and During Differentiation J. Histochem. Cytochem., November 1, 2004; 52(11): 1447 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hamazaki, M. Oka, S. Yamanaka, and N. Terada Aggregation of embryonic stem cells induces Nanog repression and primitive endoderm differentiation J. Cell Sci., November 1, 2004; 117(23): 5681 - 5686. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Carter, J. L. MacDonald, and A. J. Roskams Olfactory Horizontal Basal Cells Demonstrate a Conserved Multipotent Progenitor Phenotype J. Neurosci., June 23, 2004; 24(25): 5670 - 5683. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kanatsu-Shinohara, S. Toyokuni, and T. Shinohara CD9 Is a Surface Marker on Mouse and Rat Male Germline Stem Cells Biol Reprod, January 1, 2004; 70(1): 70 - 75. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||