![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 4, 1427-1438, April 2002
Department of Biology, Massachussetts Institute of Technology, Cambridge, Massachusetts 02139
Submitted October 5, 2001; Revised December 12, 2001; Accepted January 4, 2002| |
ABSTRACT |
|---|
|
|
|---|
The yeast SIR2 gene and many of its homologs have been identified as NAD+-dependent histone deacetylases. To get a broader view of the relationship between the histone deacetylase activity of Sir2p and its in vivo functions we have mutated eight highly conserved residues in the core domain of SIR2. These mutations have a range of effects on the ability of Sir2p to deacetylate histones in vitro and to silence genes at the telomeres and HM loci. Interestingly, there is not a direct correlation between the in vitro and in vivo effects in some of these mutations. We also show that the histone deacetylase activity of Sir2p is necessary for the proper localiztion of the SIR complex to the telomeres.
| |
INTRODUCTION |
|---|
|
|
|---|
SIR2 affects processes as widespread as silencing
(Rine and Herskowitz, 1987
), recombination (Gottlieb and Esposito,
1989
), DNA repair (Tsukamoto et al., 1997
), and aging
(Kaeberlein et al., 1999
). SIR2 was first
identified with the other SIR genes in a screen for mutations that
derepress the silent mating type loci (HM) (Rine and
Herskowitz, 1987
) and later shown to silence markers located in the
telomeres (Aparicio et al., 1991
). SIR2 is also
the only SIR gene that is necessary for silencing at the rDNA (Bryk
et al., 1997
; Smith and Boeke, 1997
).
Clues to the functions of SIR2 and the other SIR genes first
came from genetic studies that linked HM silencing to
chromatin. Mutations in the N-terminal tail of histone H3 and H4 can
derepress silencing at HM and the telomeres (Kayne et
al., 1988
; Park and Szostak, 1990
; Aparicio et al.,
1991
; Thompson et al., 1994
). In addition, the histones in
silenced regions of the genome are hypoacetylated in an SIR-dependent
manner (Braunstein et al., 1993
, 1996
). These observations
emphasize an important connection between the SIR genes, the
deacetylated state of silent chromatin, and the ability to repress.
SIR2 appears to play an especially important role in this
regard because its overexpression leads to decreases in global
acetylation levels of histones (Braunstein et al., 1993
).
The first insight for an enzymatic activity came when CobB, a bacterial
homolog to SIR2, was shown to be involved in transferring a
phospho-ribose moiety from nicotinate mononucleotide to
5,6-dimethylbenzimidazole (Tsang and Escalante-Semerena, 1998
). It was
then discovered that the human homolog to SIR2 could use
NAD+ to ADP-ribosylate protein (Frye, 1999
) and
that yeast SIR2 could ADP-ribosylate histones, albeit
inefficiently (Tanny et al., 1999
). Sir2p was then also
shown to deacetylate histone tails in an
NAD+-dependent manner in a robust manner (Imai
et al., 2000
). Related studies showed that the protein
product of HST2, a yeast gene that has sequence homology to
SIR2, and CobB were also capable of deacetylating histones
in an NAD+-dependent manner (Landry et
al., 2000b
; Smith et al., 2000
).
Recent investigations into the mechanism of the histone deacetylation
activity of Sir2p suggest that it is linked to the hydrolysis of
NAD+ (Landry et al., 2000a
; Tanner
et al., 2000
; Tanny and Moazed, 2001
). These two activities
are coupled in a reaction that transfers the acetyl group from histones
to the ADP-ribose from NAD+ and forms an
O-acetyl-ADP-ribose moiety. It is currently speculated that the
deacetylation reaction requires the energy yielded from the hydrolysis
of NAD+ (Tanny and Moazed, 2001
) or that the
O-acetyl-ADP-ribose moiety itself could have a signaling function in
the cell (Tanner et al., 2000
).
NAD+ and SIR2 are important regulators
of yeast aging. Deletions of SIR2 decrease yeast life span,
whereas overexpressing SIR2 leads to an extension
(Kaeberlein et al., 1999
). SIR2 is also necessary
for the increase in life span in caloric restricted yeast and
NAD+ levels are crucial for this increase (Lin
et al., 2000
). Interestingly, SIR2 is also an
important regulator of aging in nematodes. When the
Caenorhabditis elegans homolog of SIR2 is
overexpressed, the worm's life span is increased by as much as 50%
(Tissenbaum and Guarente, 2001
).
To understand this gene that affects so many processes, we have mutated
SIR2 and investigated its effects in vitro and in vivo.
Previous studies have shown that mutations in SIR2 can
affect both the enzymatic activity and its silencing phenotypes (Tanny et al., 1999
; Imai et al., 2000
). Other studies
have shown that mutations outside the most conserved part of
SIR2 create locus-specific alleles that silence either the
telomeres or the rDNA but not both (Cuperus et al., 2000
).
In this study, we mutated residues in the highly conserved core domain
of SIR2 to try to better understand the relationship between
the in vivo phenotypes of SIR2 and its in vitro enzymatic activity.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains, Plasmids, and Antibodies
Yeast strains are listed in Table
1. pRS305-SIR2, an integrating plasmid
that contains sir2 driven by its native promoter, was used.
Mutant SIR2 genes were also cloned into these vectors. SIR2 and mutant sir2 strains were generated by
cutting pRS305-SIR2 within the LEU2 gene at an
AflII site and integrated using standard yeast
transformation protocols. SIR2 or mutant sir2
cloned into the pET28a vector was used for the production of
recombinant protein. The hemagglutinin (HA) tagging of SIR4
was done with the pSF323-SIR4-3XHA vector (a gift from Steve
Bell), which integrates a tagged version of SIR4 into
the native SIR4 locus. Rabbit antibody to Sir2p and Sir3p
have been previously described (Mills et al., 1999
; Imai et al., 2000
). The 12CA5 antibody to the HA epitope was
obtained from Covance and the acetylated histone H3 and
acetylated histone H4 were obtained from Upstate Biotechnology (Lake
Placid, NY).
|
Site-directed Mutagenesis of SIR2
Site-directed mutants were generated in pRS305-SIR2 as per Imai
et al. (2000)
and subcloned into pET-28a (Imai et
al., 2000
). The mutations were sequenced to ensure that the
mutagenesis was successful. Expression of Sir2p in yeast was monitored
by Western blot analysis of whole cell extracts probed with anti-Sir2p antibody.
Purification of Recombinant Protein and Enzymatic Assays
Six-his-tagged recombinant Sir2p and mutant Sir2p were purified
from BL21 bacteria that overexpressed the gene on a pET28a plasmid as
described previously (Imai et al., 2000
). ADP-ribosylation of histones was detected as described previously (Imai et
al., 2000
). Histone deacetylation activity was measured using a
peptide corresponding to the N-terminal tail of histone H4
(SGRGKGGKGLGKGGAKRHRC) labeled with tritiated acetate by using the
histone deacetylase assay kit from Upstate Biotechnology. The assay was
performed by incubating 2 µg of recombinant protein with the labeled
peptide in 1 mM NAD+ overnight. Ethyl acetate was
then used to separate acetyl groups freed by the reaction from those
still bound to the peptide. Deaceytlation activity was then measured by
counting the free tritiated acetate in a scintillation counter. Histone
deacetylation assays were also measured by performing the reaction for
1 h and running the reaction products on a high-performance liquid
chromatography (HPLC) as previously described (Imai et al.,
2000
).
Silencing and rDNA Recombination Assays
To test silencing at the telomeres, 10-fold dilutions of the
derivatives of W303RT were spotted on media containing 5-fluoroorotic acid (5-FOA). To assay for HM silencing, W303R derivatives were patched
onto YPD with the tester strain CKy20 and after overnight growth were
replica plated to minimal media with no supplemented amino acids. rDNA
recombination rates were measured as in Kaeberlein et al.
(1999)
.
Immunoprecipitation of HA-Sir4 and Sir2
Whole cell extracts were prepared from cells grown in 100 ml of
YPD to an OD of 1.0 (Strahl-Bolsinger et al., 1997
). Extract (200 µl) was diluted to 500 µl with lysis buffer to which 3 µl of
anti-HA antibody was added and incubated at 4°C overnight. Protein A
beads were then added and further incubated at 4°C for 1 h. The
beads were washed three times with lysis buffer and then boiled in 60 µl of SDS running buffer. Ten microliters was run on a 7.5% PAGE gel
for Western blotting analysis.
Chromatin Immunoprecipitation
Yeast were grown in 100 ml of YPD to and OD of 1.0. Immunoprecipitation of cross-linked extract was performed essentially as described (Strahl-Bolsinger et al., 1997
), by using 2.5 µl of anti-SIR3 polyclonal antibody or 5.0 µl of anti-SIR2
polyclonal, anti-acetylated histone H3 antibody, or anti-aceytlated
histone H4 antibody. Polymerase chain reaction (PCR) analysis of
immunoprecipitated DNA was performed in 50-µl reaction volumes by
using 1:25, 1:75, and 1:225 of the total immunoprecipitated DNA. PCR
reaction conditions were as described using the following primers:
TEL-300.fwd, GGATATGTCAAAATTGGATACGCTTATG; TEL-300.rev,
CTATAGTTGATTATAGATCCTCAATGATC; TEL-3000.fwd,
TGATTCTGCTTTATCTACTTGCGTTTC; TEL-3000.rev, AGAGTAACCATAGCTATTTACAATAGG;
XV-internal2.fwd,
GTAGTTCGTTAGGTATGGACATTGATTTGGCC; and
XV-internal2.rev, AAATGAA-ATGTATTGGGGCCTAGGTTCGCA. Slot blot analysis was performed by blotting 10 µl of immunoprecipitated (IP)
DNA or 5 µl of input DNA to a Zeta-Probe membrane by using a
Bio-Rad slot blot apparatus. The blot was then probed with a 32P-labeled DNA fragment corresponding to the 5S
rDNA sequence.
| |
RESULTS |
|---|
|
|
|---|
Mutations in Core Domain of SIR2 Affect Enzymatic Activity
We chose eight amino acid residues that are absolutely conserved
between yeast SIR2, mouse SIR2alpha, and CobB for mutational analysis (Figure 1a). We mutated the
following residues in the yeast SIR2 gene to alanine:
Thr-261, Gly-270, Ile-271, Phe-274, Arg-275, Asn-345, Asp-347, and
His-364. Each mutant was expressed in bacteria and purified over a
Ni2+-NTA column (Figure 1b).
|
To test the effect of these mutations on the
NAD+-dependent histone deacetylase activity of
Sir2p, we performed a histone deacetylation assay in the presence of
NAD+ by incubating the recombinant proteins with
an H4 peptide with tritiated acetyl groups and counting the amount of
tritium that was freed in the reaction (Figure
2a). The mutations fall into three
different categories based on their ability to deacetylate. The first
category consisting of mutations in the following residues: Asn-345,
Asp-347, and His-364, shows complete loss of histone deacetylation
activity of Sir2p. The second category, Arg-275, shows almost no loss
of histone deacetylation activity, releasing ~1900 cpm of acetate
compared with wild type's 2400 cpm. The third category, including the
most N-terminal core domain mutants Thr-261, Gly-270, Ile-271, and
Phe-274, shows drastic decrease in the histone deacetylation activity,
yet not a total loss of it, with activities ranging from 7 to 20% the
level of wild type.
|
We also investigated the ADP-ribosyl transferase activity of a subset of the mutants (261, 270, 271, 275, 345, and 347) (Figure 2b). Again, the mutations appear to fall into three different categories. The most C-terminal mutations (345 and 347) have no noticeable level of activity. Mutation 275 is as robust as wild type. The N-terminal mutations (261, 270, and 271) appear to have levels of activity that are dramatically weakened, but higher than the nonactivity of mutants 345 and 347 or the empty vector control. The effect of mutations on ADP-ribosylation correlates well with their effects on deacetylation.
Mutations Affect In Vivo Functions of SIR2
We integrated wild-type SIR2, empty vector, and each of
the mutants into a
sir2 strain. We performed Western
blots on yeast whole cell extract and saw that each of the mutants
expresses at levels comparable to the wild-type allele, suggesting that none of the mutations alters the stability of the protein in vivo (Figure 3a).
|
To test silencing at the HM loci, we crossed each mutant with a mating tester strain to see whether they could successfully mate (Figure 3b). Wild type, and mutants 261, 270, and 271 formed diploids, whereas the other strains failed to mate, suggesting that mutants 261, 270, and 271 silence the HM loci, whereas mutant 274, 275, 345, 347, and 364 are unable to silence it.
To investigate silencing at the telomeres, we used a strain in which the URA3 marker has been integrated into the telomere at the left arm of chromosome VII. When SIR2 is functional, the URA3 gene is repressed and the strain can grow on media containing 5-FOA, a toxic substrate to cells that express the URA3 gene. We measured telomere silencing in the sir2 mutant strains by serial dilution of the mutants onto 5-FOA media (Figure 3c). The mutants fall into three categories based on their ability to silence telomeres. The first class, mutants 271, 274, 275, 345, 347, and 364, is incapable of silencing the URA3 marker. The second class, mutant 261, grows as well as wild type, suggesting no defect in telomere silencing. The third class, mutant 270, shows very limited but noticeable growth on 5-FOA, suggesting it can partially silence the marker.
SIR2 suppresses recombination at the rDNA and silences markers integrated there. To investigate how mutations affect the role of SIR2 at the rDNA, we measured the recombination rate in a strain with the ADE2 marker in the rDNA array by counting half-sectoring colonies (Figure 3d). Mutants 274, 275, and 345 have a rate of marker loss comparable to the sir2 disrupted strain, indicating they have lost the ability to suppress rDNA recombination. Mutants 261 and 270 have low rates of marker loss comparable to wild type. Finally, mutant 271 is intermediate, with twice the rate of marker loss as wild type, but 5 times lower than a sir2 deletion.
Overall, the mutants fall into three phenotypic categories. The first class, which only contains mutant 261, shows the same phenotypes as the wild-type allele. The second class, mutants 270 and 271, shows some ability to silence as well as wild type in some assays, yet they are either partially or completely defective in silencing at other loci. The final class, mutants 274, 275, 345, 347, and 364, is incapable of silencing at any locus tested.
Interestingly, there is not perfect correlation between the in vivo and in vitro effects for some of the mutants. There are, in particular, two puzzling mutants, mutant 261 and mutant 275. Mutant 261 has a weak enzymatic activity, yet appears to be as strong as wild type in all of its in vivo phenotypes. Alternatively, mutant 275 has near wild-type levels of activity in vitro, but is totally defective in vivo. To test whether the SIR2 homologous HST genes were able to help mutant 261 silence, we knocked out the genes HST1, HST2, HST3, and HST4 individually in a mutant 261 background but saw no effect on the ability of mutant 261 to silence (our unpublished data).
Acetylation State of Histones In Vivo
Because mutant 261 showed low activity in vitro despite behaving
like wild type in vivo and mutant 275 had the opposite effect, we
determined the acetylation state of silent chromatin by chromatin immunoprecipitation (ChIP). After cross-linking, we used both anti-acetylated H3 and anti-acetylated H4 to pull down the acetylated histones that had been cross-linked to DNA. After reversing the cross-linking we probed for telomere sequences by using primers that
specifically recognize the telomere on the right arm of chromosome VI
(Figure 4a). In strains with a wild-type
allele of SIR2, very little telomeric sequence is pulled
down compared with a sir2 disruption. This result was
expected, because regions that are silenced are hypoacetylated in a
SIR-dependent manner (Braunstein et al. 1993
, 1996
). The
telomeres in mutant 261 are hypoacetylated much like wild type, whereas
telomeres in mutant 275 is hyperacetylated much like the
sir2 disruption.
|
The effect of SIR2 on the acetylation state of histones at
the rDNA has not been examined in yeast. We used chromatin IP as described above to see what effect SIR2 and the mutants have
at the rDNA. Using slot blots, we saw that histones do indeed show an
increase in acetylation at the rDNA when SIR2 is deleted
(Figure 4b). When we looked at the mutants, we saw that mutant 261 was hypoacetylated like wild type, whereas mutant 275 is hyperacetylated like
sir2, much like what we saw at the telomeres. Thus,
for these unusual mutants, the histone acetylation state correlates with the observed degree of silencing.
Enzymatic Analysis of Mutant 261 and 275
To see whether mutant 275 affected the ability of Sir2p to bind
and use NAD, we repeated the histone deacetylation reaction under
varying concentrations of NAD+ (Figure
5a). As expected, when we used wild-type
Sir2p and increased the NAD+ concentration from 1 µM to 1 mM, an increase in the efficiency of deacetylation was
observed. Interestingly, the efficiency of the reaction does not change
much between 100 µM and 1 mM concentrations of NAD. The effect of
varying NAD+ concentration on mutant 275 very
closely paralleled the effect it had on wild-type Sir2p. This suggests
that mutant 275 does not strongly affect NAD+
binding.
|
Mutant 261 severely diminishes the histone deacetylation activity of Sir2p. It is possible that loss of activity is the result of poor substrate binding and that in vivo a higher histone concentration than what is used in vitro could explain why the mutant is capable of deacetylating histones in vivo. To test this possibility we used increasing amounts of peptide to see whether the efficiency of the histone deacetylation activity of mutant 261 increased (Figure 5b). Wild-type Sir2p shows a proportional increase in release the of acetyl groups as the peptide concentration is increased. The defect in the 261 mutant was not rescued by higher peptide concentrations, suggesting that mutant 261 affects the efficiency of the enzymatic activity and not the efficiency of histone binding.
The histone deacetylation assays were done overnight raising the
possibility that either mutant 275 had a slow initial rate, but over
time was able to catch up to wild-type Sir2p. To test this we measured
histone deacetylation rates after 1-h reactions by incubating an
acetylated histone H3 peptide with enzyme and NAD+ and then running the reaction products on an
HPLC apparatus comparable to what was done in Imai et al.
(2000)
. When wild-type Sir2p is compared with no protein, three novel
peaks appear in the wild-type reaction that correspond to deacetylated
products (Figure 5c, peaks 1, 2, and 4). When mutant 261 was used in
the reaction a very small peak appears that corresponds to a
deacetylated peptide. This indicates that like in the overnight
reaction, mutant 261 has very weak activity when the reaction is
carried out for shorter periods (4.4 vs. 26.0% for wild type). When
mutant 275 was used in the reaction, the deacetylated peaks were almost
as prominent as they were when wild-type Sir2p was used (17.5 vs.
26.0%). This indicates that 275 is not defective in deacetylating
under shorter reaction times and its in vivo defect is unlikely to be a
result of an initial rate defect.
Mutations Effects on Aging
In light of the importance that SIR2 plays in yeast
life span, we wanted to know what effect some of these mutations might have on aging. The life spans of mutants 261, 270, and 275 were measured in strains with HML
deleted. Mutants 261 and 270 had life spans comparable to wild type, whereas mutant 275 had a life span comparable to
sir2 (Figure
6a). HML
was deleted so
that a/
effects would not play a role; a/
strains show a
shortened life span (Kaeberlein et al., 1999
). Thus, mutants
261 and 270 do not affect life span, whereas mutant 275 does.
|
We also measured the life span of strains that were not deleted at
HML
. Mutants 261 and 275 had an intermediate life span, shorter than wild type, but not as short as
sir2 (Figure
5b). This suggests that these mutants have an intermediate effect on life span that is HML
dependent. This could be the result
of only partial silencing of MAT
expression from HML,
i.e., mutants 261 and 270 silence HML strongly enough to
allow mating, but allow enough expression of MAT
to shorten life
span. This is also the only phenotype seen for mutant 261 that differs
from wild-type SIR2, suggesting that mutant 261 is a slight
hypomorph, which can only be detected with the most sensitive assays.
Mutations Are Dominant Negative and Do Not Affect Formation of a Sir2/Sir4 Complex
Several labs have observed that mutations in SIR2 can
be dominant negative (Sherman et al., 1999
; Tanny et
al., 1999
; Cuperus et al., 2000
). This led us to test
whether our mutations were dominant negative. We integrated each mutant
into a wild-type strain with URA3 at TEL-VIIL so that each
strain would have both a wild-type and mutant copy of SIR2
present. We spotted the cells on 5-FOA media to test their ability to
silence the telomere (Figure 7a). Mutants
271, 274, 275, 345, 347, and 364 abolished silencing at telomeres by
the wild-type copy of SIR2. This is interesting and suggests
that even though these mutants fail to silence, they are probably
forming a complex with Sir2p-binding proteins, thereby poisoning the
wild-type activity.
|
It is known that Sir2p and Sir4p interact directly and
coimmunoprecipitate from whole cell extracts (Moazed et al.,
1997
; Strahl-Bolsinger et al., 1997
). To test whether these
mutants form the Sir complex, we tagged the native SIR4 gene
with HA in SIR2 wild-type,
sir2, mutant 261, mutant 275, and mutant 347 strains. We then isolated whole cell extract
from these strains and used anti-HA antibody to pull down Sir4p.
HA-Sir4p was precipitated from all of the strains as seen by Western
blot (Figure 7b). We then reprobed the Western to see whether Sir2p
coprecipitated (Figure 7c). Sir2p coprecipitated from wild-type extract
but not from extracts with untagged SIR4. Moreover, Sir2p
was coprecipitated with Sir4p in all three mutant extracts. This
suggests that all mutant Sir2p tested, including mutant 275 assemble
with Sir4p.
Mutations Affect Ability of Sir Complex to Localize to Telomeres
Although the mutants appear to form the Sir complex, it is
possible they fail to localize to the telomeres or other silenced loci.
To investigate this possibility we immunoprecipitated with anti-Sir3
antibody from extracts prepared after cross-linking and probed the
coprecipitated DNA by using PCR with primers that recognize sequences
300 base pairs from the end of the right arm of chromosome VI (Figure
8a). As expected, a wild-type strain supported immunoprecipitation of the telomeric sequence, whereas a
sir2 strain did not. Extracts from the sir2
mutants 261 and 270 gave a comparable signal to wild type. However, in
the remaining mutants: 271, 274, 275, 345, 347, and 364, the telomere
signal was absent, indicating Sir3p does not localize to the telomeres. We observed the same pattern by using anti-Sir2 antibody (our unpublished data). As a control for specificity and the amount of
DNA present in the IP sample, we reprobed the immunoprecipitated DNA
with primers corresponding to internal sequences and saw the same low
level of pull down from all of the extracts (Figure 8b). These
localization data show a strong correlation between the silencing
activities at telomeres and the ability of the Sir complex to localize
properly in the mutant strains. Because mutant 270 only partially
silences the telomeres, we checked more distal regions of the telomere
by probing sequences that are 3000 base pairs from the end (Figure 8c).
Mutant 270 localizes much more poorly than wild type at this distal
site, suggesting that this Sir mutant complex is weakened in its
ability to further polymerize along the telomeres.
|
At the rDNA, Sir2p interacts with a novel set of proteins termed the
RENT complex, whereas the other SIR genes do not have a direct effect
on the rDNA (Shou et al., 1999
; Straight et al., 1999
). We determined whether Sir2p was localizing to the rDNA in the
mutant strains. The DNA from anti-Sir2 ChIPs was blotted to a filter
and then probed for rDNA sequences (Figure 8d). As expected DNA from a
wild-type strain contained rDNA sequences, whereas DNA from a
sir2 disruption did not. All of the mutants localized to the
rDNA, even though their ability to elicit hypoacetylation of histones
and repress recombination varied at that site. This is not too
unexpected because it has previously been shown that a mutation in
residue 364 still localizes to the rDNA (Tanny et al.,
1999
); however, it is interesting that this phenomenon holds up for a
wide range of core domain mutants. This finding contrasts to telomeres
where there is a strong correlation between the silenced state and the
localization of the Sir proteins.
| |
DISCUSSION |
|---|
|
|
|---|
In this article, we investigated the effect of core domain
mutations on the in vitro enzymatic activity and in vivo phenotypes of
SIR2. A simple model would have predicted that mutations
that affect the histone deacetylase activity of Sir2p would also affect the ability of SIR2 to silence, and furthermore, that the
most severe mutations would show the strongest desilencing phenotypes. Although most mutations do indeed affect the in vivo and in vitro functions of SIR2 in similar ways, two of the mutations
showed unexpected differences between in vivo and in vitro activity. A
summary of the mutations and their effects in vivo and in vitro is
listed in Table 2.
|
Correlations between Mutations' Effects on Enzymatic Activity and Silencing Phenotypes
When we examined the effects of the mutations on the enzymatic
activity of Sir2p they fell into three categories: totally inactive,
partially active, and fully active. The first class of mutants had
three members: mutants 345, 347, and 364. None of these mutants were
capable of silencing in any of the in vivo assays tested, even though
they properly formed complexes and properly localized to some
chromosomal loci. The results with these mutants seem to correlate with
what was observed in Tanny et al. (1999)
who also mutated
residue 364 and made many of the same observations with it that we do herein.
Only mutant 275 showed full enzymatic activity. Surprisingly, this mutant was incapable of silencing in any of the in vivo assays. The mutant presumably has a subtler defect that only manifests itself in vivo.
The other class of mutants, 261, 270, 271, and 274, partially disrupts the enzymatic activity of Sir2p, showing anywhere from 5 to 20% of wild-type levels of histone deacetylase activity. Of these, only mutant 274 is completely inactive in all of the in vivo assays tested. Mutants 270 and 271 may not silence at wild-type levels because their enzymatic activity is reduced by 5- to 10-fold. Mutant 261, however, is exceptional because it has even lower enzymatic activity than mutants 270 and 271, yet it has no noticeable silencing defects, although it does have a shorter life span that appears to be the result of a failure to fully silence the HM loci
Paradoxes of Mutants 261 and 275
The lack of a direct correlation between the histone deacetylation
activity and the silencing phenotypes of mutants 261 and 275 suggests
that the role of SIR2 is more complex than that solely of a
histone deacetylase. One explanation would be the in vitro histone
deacetylation activity of SIR2 is not crucial for silencing. Instead, perhaps in vivo the relevant substrate for the deacetylation activity of Sir2p is something other than histones. By this scenario, mutant 261 would weaken activity for histones but not for the other
substrate, whereas mutant 275 would have the opposite effect. Lending
support to this possibility is the observation that Hst2p appears to
provide most of the NAD+-dependent histone
deacetylase activity in cell extracts (Smith et al., 2000
).
Also, new evidence has suggested that SIR2 homologs can
deacetylate proteins other than histones (Sutton et al.,
2001
; Imai, Park, and Guarente, unpublished data). However,
hypoacetylation of histones at silent loci is dependent upon
SIR2, which suggests that histones are the Sir2p substrate.
Also, Sir2p preferentially deacetylates residue 16 of histone H4, the
residue that plays the most important role in silencing (Imai et
al., 2000
; Tanny and Moazed, 2001
).
If SIR2 is deacetylating histones in vivo then how can we explain the effects of mutants 261 and 275? Mutant 275 may create a functional defect unrelated to its enzymatic activity such as an inability to interact with other proteins. However, Sir2p and Sir4p coimmunoprecipitated in mutant 275 strains, suggesting that the mutation did not disrupt that crucial interaction. It does not, however, rule out the possibility that another protein interaction is disrupted by mutant 275. In mutant 261, it is possible that the mutation causes a folding defect in Escherichia coli that does not exist in yeast. Purification of the mutant from yeast extract, however, showed that it was still a poor histone deacetylase, making that explanation unlikely (Armstrong, unpublished data). It is possible that the limited activity that mutant 261 possesses is adequate to silence in vivo but this would seem unlikely in light of the results with mutants 270, 271, and 275. Another reason that could explain both mutants might be a difference in how they interact with chromatin as opposed to histones. Mutant 275 is a very effective deacetylase with histone peptides as the substrate, but perhaps it is unable to deacetylate nucleosomes in the full chromatin context that is seen in the cell. Alternatively, perhaps mutant 261 is far more efficient at using full chromatin as the substrate.
SIR2 Mutations and Their Effects on Localization
We were also curious about what effect the mutations would have on where the Sir complex localized. Mutants that failed to silence at the telomeres also failed to localize there. This included mutant 275 along with the mutations that render the enzyme inactive. Is the mutants' failure to silence a result of their failure to localize? This could explain why mutant 275 does not silence. However, all of the mutants localize to the rDNA regardless of their ability to affect rDNA recombination. If mutant 275 did not silence merely because it failed to localize then one would expect it to suppress rDNA recombination, yet it does not.
Conversely, it seems plausible that the failure of these mutants to
deacetylate could lead to their inability to localize to the telomeres.
Mutants 345, 347, and 364 strongly support this idea because they do
not deacetylate histones in vitro and they fail to localize to the
telomeres. If telomere localization were independent of the acetylation
state then these mutants should localize properly. The failure of the
Sir complex in mutant 275 to localize to the telomeres could also be a
by-product of the mutant's failure to deacetylate in vivo. These
observations imply a model in which Sir2p first deacetylates the
histones and then the Sir complex tightly binds to the telomeres,
forming a fully functional silencing complex. This fits observations
showing that Sir3p and Sir4p are capable of binding to the tails of
histone H4 (Hecht et al., 1995
). Others have suggested that
a silenced state can be achieved in part by the binding of the Sir
proteins to the unacetylated histone tail to create heterochromatin (Wu and Grunstein, 2000
). These localization data in connection with previous observations suggest that a silencing complex is formed in the
following way. The telomere binding protein Rap1p binds to the telomere
and initially recruits the Sir complex. Sir2p then deacetylates
histones in the region, allowing the Sir complex to bind to the histone
tails and create silenced chromatin. The deacetylation of nearby
histones by Sir2p may also be responsible for the polymerization of the
Sir complex along the telomere. Even if histone deacetylation is a
crucial step for the proper localization of the Sir complex to the
telomeres, it is not necessary for Sir2p to localize to the rDNA.
Structure of Sir2
The crystal structure of the Archaeglobus fulfidus
homolog to SIR2 bound to NAD+ has
recently been solved, allowing us to compare our mutants to the crystal
structure (Min et al., 2001
). There are four major parts to
the structure: a Rossman fold made up of six parallel strands and six
helices, a loop that appears to be the most structurally flexible part
of the protein, a helical domain, and a Zn binding domain.
NAD+ binds in a pocket between the helical domain
and the Rossman fold and flanked by the loop.
Mutant 261 is on the border between the first part of the Rossman fold and the loop. Mutants 345 and 347 fall in the border region between the second part of the Rossman fold and the Zinc binding domain. Mutant 364 falls in the middle of the Zinc binding domain. Mutants 270, 271, 274, and 275 all fall within the loop. Mutant 275's location is interesting because it corresponds to residue Arg33 in A. fulfidus, which we see form a hydrogen bond with NAD+ in one of their crystals, suggesting an important role in NAD+ binding. If mutant 275 were crucial for NAD+ binding then one would expect this mutation to destroy the enzymatic activity, but it does not. On the other hand, in the monoclinic crystal we do not see the residue binding to NAD+, challenging the importance of that residue in NAD+ binding. It is interesting to note that mutants 261 and 275 both lie in or near the loop, suggesting that learning more about this loop region could reveal additional clues about the function of SIR2.
| |
ACKNOWLEDGMENTS |
|---|
We thank members of the Guarente lab for helpful comments throughout the work and E. Ford for helpful comments on the manuscript. This work was funded by a National Institutes of Health predoctoral grant to C.A. and M.K.; a grant from The Human Frontier Science Program Organization to S.I.; and grants from the National Institutes of Health, Seaver Foundation, Ellison Medical Foundation, and Howard and Linda Stern Fund to L.G.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: leng{at}mit.edu.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.01-10-0482. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.01-10-0482.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. J. Lynch and L. N. Rusche A Silencer Promotes the Assembly of Silenced Chromatin Independently of Recruitment Mol. Cell. Biol., January 1, 2009; 29(1): 43 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Haldar and R. T. Kamakaka Schizosaccharomyces pombe Hst4 Functions in DNA Damage Response by Regulating Histone H3 K56 Acetylation Eukaryot. Cell, May 1, 2008; 7(5): 800 - 813. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Calzari, I. Orlandi, L. Alberghina, and M. Vai The Histone Deubiquitinating Enzyme Ubp10 Is Involved in rDNA Locus Control in Saccharomyces cerevisiae by Affecting Sir2p Association Genetics, December 1, 2006; 174(4): 2249 - 2254. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Khan and P. N. Lewis Use of Substrate Analogs and Mutagenesis to Study Substrate Binding and Catalysis in the Sir2 Family of NAD-dependent Protein Deacetylases J. Biol. Chem., April 28, 2006; 281(17): 11702 - 11711. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liszt, E. Ford, M. Kurtev, and L. Guarente Mouse Sir2 Homolog SIRT6 Is a Nuclear ADP-ribosyltransferase J. Biol. Chem., June 3, 2005; 280(22): 21313 - 21320. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kaeberlein, T. McDonagh, B. Heltweg, J. Hixon, E. A. Westman, S. D. Caldwell, A. Napper, R. Curtis, P. S. DiStefano, S. Fields, et al. Substrate-specific Activation of Sirtuins by Resveratrol J. Biol. Chem., April 29, 2005; 280(17): 17038 - 17045. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Freeman-Cook, E. B. Gomez, E. J. Spedale, J. Marlett, S. L. Forsburg, L. Pillus, and P. Laurenson Conserved Locus-Specific Silencing Functions of Schizosaccharomyces pombe sir2+ Genetics, March 1, 2005; 169(3): 1243 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Tanny, D. S. Kirkpatrick, S. A. Gerber, S. P. Gygi, and D. Moazed Budding Yeast Silencing Complexes and Regulation of Sir2 Activity by Protein-Protein Interactions Mol. Cell. Biol., August 15, 2004; 24(16): 6931 - 6946. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zhao, R. Harshaw, X. Chai, and R. Marmorstein Structural basis for nicotinamide cleavage and ADP-ribose transfer by NAD+-dependent Sir2 histone/protein deacetylases PNAS, June 8, 2004; 101(23): 8563 - 8568. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Gallo, D. L. Smith Jr., and J. S. Smith Nicotinamide Clearance by Pnc1 Directly Regulates Sir2-Mediated Silencing and Longevity Mol. Cell. Biol., February 1, 2004; 24(3): 1301 - 1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Lin, E. Ford, M. Haigis, G. Liszt, and L. Guarente Calorie restriction extends yeast life span by lowering the level of NADH Genes & Dev., January 1, 2004; 18(1): 12 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hirao, J. Posakony, M. Nelson, H. Hruby, M. Jung, J. A. Simon, and A. Bedalov Identification of Selective Inhibitors of NAD+-dependent Deacetylases Using Phenotypic Screens in Yeast J. Biol. Chem., December 26, 2003; 278(52): 52773 - 52782. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Bitterman, O. Medvedik, and D. A. Sinclair Longevity Regulation in Saccharomyces cerevisiae: Linking Metabolism, Genome Stability, and Heterochromatin Microbiol. Mol. Biol. Rev., September 1, 2003; 67(3): 376 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huang and D. Moazed Association of the RENT complex with nontranscribed and coding regions of rDNA and a regional requirement for the replication fork block protein Fob1 in rDNA silencing Genes & Dev., September 1, 2003; 17(17): 2162 - 2176. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Ng, D. N. Ciccone, K. B. Morshead, M. A. Oettinger, and K. Struhl Lysine-79 of histone H3 is hypomethylated at silenced loci in yeast and mammalian cells: A potential mechanism for position-effect variegation PNAS, February 18, 2003; 100(4): 1820 - 1825. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kaeberlein, A. A. Andalis, G. R. Fink, and L. Guarente High Osmolarity Extends Life Span in Saccharomyces cerevisiae by a Mechanism Related to Calorie Restriction Mol. Cell. Biol., November 15, 2002; 22(22): 8056 - 8066. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Bitterman, R. M. Anderson, H. Y. Cohen, M. Latorre-Esteves, and D. A. Sinclair Inhibition of Silencing and Accelerated Aging by Nicotinamide, a Putative Negative Regulator of Yeast Sir2 and Human SIRT1 J. Biol. Chem., November 15, 2002; 277(47): 45099 - 45107. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Garcia and L. Pillus A Unique Class of Conditional sir2 Mutants Displays Distinct Silencing Defects in Saccharomyces cerevisiae Genetics, October 1, 2002; 162(2): 721 - 736. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||