![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 5, 1626-1640, May 2002



and
*Cell Cycle Laboratory, Medical Research Council, Radiation and
Genome Stability Unit, Harwell, Didcot, OX11 0RD, United Kingdom;
MRC Human Genetics Unit, Western General Hospital, Crewe
Road, Edinburgh, EH4 2XU, United Kingdom; and
Imperial
Cancer Research Fund, Institute of Molecular Medicine, John Radcliffe
Hospital, Oxford, OX3 9DS, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
Eukaryotic translation initiation factor 3 (eIF3) is a multisubunit complex that plays a central role in translation initiation. We show that fission yeast Sum1, which is structurally related to known eIF3 subunits in other species, is essential for translation initiation, whereas its overexpression results in reduced global translation. Sum1 is associated with the 40S ribosome and interacts stably with Int6, an eIF3 component, in vivo, suggesting that Sum1 is a component of the eIF3 complex. Sum1 is cytoplasmic under normal growth conditions. Surprisingly, Sum1 is rapidly relocalized to cytoplasmic foci after osmotic and thermal stress. Int6 and p116, another putative eIF3 subunit, behave similarly, suggesting that eIF3 is a dynamic complex. These cytoplasmic foci, which additionally comprise eIF4E and RNA components, may function as translation centers during environmental stress. After heat shock, Sum1 additionally colocalizes stably with the 26S proteasome at the nuclear periphery. The relationship between Sum1 and the 26S proteasome was further investigated, and we find cytoplasmic Sum1 localization to be dependent on the 26S proteasome. Furthermore, Sum1 interacts with the Mts2 and Mts4 components of the 26S proteasome. These data indicate a functional link between components of the structurally related eIF3 translation initiation and 26S proteasome complexes.
| |
INTRODUCTION |
|---|
|
|
|---|
The initiation of translation is a multistep
process involving the binding of Met-tRNA and mRNA to ribosomes and is
promoted by a large number of translation initiation factors (eIFs;
reviewed by Merrick and Hershey, 1996
). Translation initiation factor
eIF3 is the largest of the eukaryotic initiation factors and is
involved in a number of different aspects of the initiation step. eIF3 forms a stable complex with the 40S ribosomal subunit, which helps prevent premature association with the 60S subunit (Goumans et al., 1980
). eIF3 stabilizes the binding of the ternary complex eIF2-GTP-Met-tRNA to the ribosomal 40S subunit (Benne and Hershey, 1978
) and functions to bring the 40S subunit to the mRNA through interactions with the eIF4G subunit of the cap binding complex eIF4F
(Etchison and Smith, 1990
; Lamphear et al., 1995
).
Additionally, eIF3 has been shown to interact with eIF4B (Méthot
et al., 1996
), eIF5 (Asano et al., 1999
), and
eIF1 (Fletcher et al., 1999
), suggesting that eIF3 plays a
central role in initiation of translation by interacting with different
initiation factors (Asano et al., 2000
, Phan et
al., 2001
).
The mammalian eIF3 complex has been purified (Brown-Luedi et
al., 1982
) and consists of at least 10 subunits, with molecular masses ranging from 35 to 170 kDa (Asano et al., 1997a
,
1997b
; Méthot et al., 1997
). The eIF3 complex from the
yeast Saccharomyces cerevisiae has also been purified and
can replace mammalian eIF3 in an in vitro assay for initiation,
indicating a strong conservation of function in eukaryotes (Naranda
et al., 1994
). Biochemical interactions have been detected
between the conserved p170 (eIF3a), p116 (eIF3b), p110 (eIF3c), p44
(eIF3g), and p36 (eIF3i) subunits in both mammalian and yeast systems
(for eIF3 nomenclature, see Browning et al., 2001
),
indicating that these factors are likely to comprise a conserved core
eIF3 complex (Asano et al., 1997a
, 1998
; Verlhac et
al., 1997
; Block et al., 1998
; Phan et al.,
1998
). The eIF3 complex from S. cerevisiae contains
additional proteins, p135 (TIF31) and p62 (GCD10; Garcia-Barrio
et al., 1995
; Vornlocher et al., 1999
), for which
corresponding homologues are not found in mammalian or plant eIF3
(Hershey and Merrick, 2000
; Burks et al., 2001
). An
additional five subunits, p66 (eIF3d), p48 (eIF3e), p47 (eIF3f), p40
(eIF3h), and p28 (eIF3k) have been identified in the mammalian eIF3
complex, which are absent from S. cerevisiae. However, most
of these subunits do appear to be highly conserved in Drosophila
melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, and
the fission yeast Schizosaccharomyces pombe, suggesting that
the eIF3 complex may consist of a highly conserved core domain, together with associated factors that appear to be evolutionarily divergent (Asano et al., 1997c
; Phan et al.,
1998
).
We report here the characterization of the fission yeast
sum1+ gene.
sum1+ was originally isolated as a high
copy suppressor of a class of S-M cell cycle checkpoint mutants in
S. pombe and can also inhibit the normal cell cycle response
to osmotic stress (Humphrey and Enoch, 1998
). Sum1, a WD-repeat
protein, shares a predicted 53% amino acid sequence identity to
S. cerevisiae eIF3-p39 and a predicted 49% amino acid
sequence identity to the human TRIP-1 protein (Humphrey and Enoch,
1998
). The S. cerevisiae homologue, eIF3-p39, encoded by the
TIF34 gene, is essential for cell viability and for
maintaining and stabilizing the eIF3 complex (Naranda et
al., 1997
). It is also required for both cell cycle progression and mating (Verlhac et al., 1997
). Surprisingly, the
mammalian homologue, TRIP-1, has been independently identified both as
a modulator of TGF-
response (Chen et al., 1995
; Choy and
Derynck, 1998
) and as the p36 subunit of eIF3 (Asano et al.,
1997a
). We present evidence that Sum1 functions as an essential
component of the eIF3 complex in fission yeast. We have examined the
response of Sum1 to stress, and find, surprisingly, that it is rapidly relocalized to multifactor complexes in response to both osmotic and
thermal stress. Finally, we demonstrate that Sum1 interacts with
components of the 26S proteasome complex in vivo. These findings suggest that the eIF3 complex may integrate signals from multiple sources to modulate cell growth.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains and General Techniques
S. pombe strains used in this study are listed in
Table 1. Growth media and general methods
for studying fission yeast have been described previously (Moreno
et al., 1991
). Cells were transformed by electroporation
using a Bio-Rad gene pulser (Cambridge, MA). Cells were grown at 30°C
in yeast extract medium (YE5S) or in Edinburgh minimum medium (EMM)
containing appropriate amino acid supplements, unless otherwise stated.
To repress/induce the expression of the nmt1 promoter, cells
were grown in the presence/absence of thiamine at 20 µM, as indicated
in the text. For viability studies, cells were grown to logarithmic
phase in YE5S medium at 30°C, subjected to thermal stress (42°C)
for times indicated and plated on YE5S plates. Numbers of colonies were
determined after 3 d of incubation at 30°C.
|
Generation of HA/3xHA/GFP/6xHis-Myc-tagged sum1
Genomic DNA encoding sum1+ was
obtained by PCR amplification from S. pombe total DNA using
the 5' oligonucleotide GTAATGGAGGACAGTG and the 3' oligonucleotide
CTGGGGCTGTTCTCC to generate a 2.25-kb product. This fragment was then
subcloned into the pCR2.1 vector (Invitrogen, Carlsbad, CA). A
BamHI to EcoRV DNA fragment was cloned into the
BamHI and SmaI sites of the expression vector pIRT2, to form plasmid pIRT2-sum1. The 5' oligonucleotide
TATCTTTATGATGTTCCTGATTATGCT and the 3' oligonucleotide
AGCATAATCAGGAACATCATAAAGATA were hybridized to generate a blunt end
sequence encoding the HA epitope tag. A 97-base pair DNA fragment
encoding the epitope 3xHA was amplified by PCR from plasmid
pREP41X-3xHA, using the 5' oligonucleotide TACCCGTACGATGTTCCTG and the
3' oligonucleotide CATATGAGCGTAATCTGGAACG. GFP was amplified by PCR
from plasmid pGEM-GFP (F64L-S65T) using the 5' oligonucleotide
AGTAAAGGAGAAGAACTTTTC and the 3' oligonucleotide TTTGTATAGTTCATCCATGCC
to generate a 714-base pair product. 6xHis-Myc was amplified by PCR
from pREP42MH, using the 5' oligonucleotide GGTAGCAGCCACCATCATC and the
3' oligonucleotide CATATGTAAGTCCTCCTCGCTG to generate a 112-base pair
product. Resulting fragments were cloned into the StuI site
located in-frame at the 5' end of sum1+ to
form plasmids pIRT2-HA-sum1,
pIRT2-3xHA-sum1,
pIRT2-GFP-sum1, and
pIRT2-6xHis-Myc-sum1. To test the ability of these strains to functionally complement the
sum1::ura4+ disruption, strain
TH62 was transformed with these plasmids. Leu+ transformants were selected and
sporulated using standard conditions. Leu+
spores were germinated on EMM+A+U plates and replica-plated to EMM+A
plates. Only haploid cells transformed with plasmids that can
complement the sum1::ura4+
deletion and that can grow in the absence of uracil were selected. To
integrate the tagged Sum1 at the leu1 locus,
BamHI and SacI DNA fragments of plasmids
pIRT2-HA-sum1, pIRT2-3xHA-sum1,
pIRT2-GFP-sum1, and
pIRT2-6xHis-Myc-sum1 were subcloned into the
BamHI and SacI sites of the pJK148 vector (Keeney
and Boeke, 1994
) to form plasmids pJK148-HA-sum1,
pJK148-3xHA-sum1, pJK148-GFP-sum1, and
pJK148-6xHis-Myc-sum1. These integrating vectors
were linearized with NruI and transformed into TH62.
Leu+ stable integrants were selected on
EMM+A plates and sporulated using standard conditions.
Leu+ spores were germinated and haploids
were selected on EMM+A plates. Stable integration of the tagged
sum1 gene at the leu1 locus was confirmed by
Southern blot analysis. Normal growth and morphology was observed for
integrant strains. Multiple independent integrant strains containing
3xHA-Sum1 were all found to be temperature-sensitive at 35.5°C, and
this strain (TH604) is subsequently referred to in the text as
sum1-ts.
Preparation of Cell Extracts for Analysis of Total Protein
Cells were lysed with glass beads (425-600 µm; Sigma, St.
Louis, MO) in a Bio-Savant Fast Prep 120 machine and protein extracts prepared in 2× sample buffer (Laemmli, 1970
).
For [35S]methionine and
[35S]cysteine incorporation experiments, 100 µCi of Promix L-[35S] in vitro
cell labeling mix (Anachem, Luton, Bedfordshire, United Kingdom) was
added to 6 × 107 cells, and mixtures were
incubated for 20 min at the appropriate temperature. Labeled cells were
then harvested by centrifugation, and the pellet was drained well,
frozen in liquid nitrogen, and kept at
80°C. Lysates were prepared
in 2× sample buffer and analyzed by SDS-PAGE. Gels were stained with
Coomassie Blue, dried, and autoradiographed using a PhosphorImager
(Bio-Rad).
Nickel-Agarose Affinity Purification and Immunoprecipitation
For nickel-agarose affinity purification, strain TH504 was transformed with pIRT2-6xHis-Myc-sum1 to generate strain TH580, and cells were grown at 30°C in EMM medium to logarithmic phase. Pelleted cells were lysed with glass beads into lysis buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 3% Triton X-100, 10% glycerol, 1 mM PMSF) containing 1× complete protease inhibitors (Roche Laboratories, Nutley, NJ). Strain TH605 and TH9 were grown at 30°C in YE5S medium to logarithmic phase. Pelleted cells were lysed with glass beads into lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol) containing 1× complete protease inhibitors.
Lysates were clarified by centrifugation, and the protein concentration
was determined (Bradford, 1976
). Proteins were partially purified by
affinity chromatography on Ni+-NTA beads (QIAGEN,
West Sussex, UK) according to the manufacturer's instructions.
Affinity-purified proteins were resuspended in sample buffer and were
resolved by SDS-PAGE and immunoblotting.
For immunoprecipitation, cell extracts were prepared as described
previously (Moreno et al., 1991
) in the following buffer: 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 0.5%
sodium deoxycholate, 10% glycerol containing 1× complete protease
inhibitors. Anti-Mts4 polyclonal antiserum, 10 µl, was first
incubated with 50 µl of protein A-Sepharose (Sigma). Two milligrams
of protein extract was incubated with the serum for 1 h at 4°C.
After several washes in the above buffer, the proteins bound to the
Mts4 antibodies were released by boiling in sample buffer, and samples
were analyzed by SDS-PAGE and immunoblotting.
SDS-PAGE and Immunoblotting
Samples were fractionated by SDS-PAGE and transferred electrophoretically to a nitrocellulose membrane (Millipore, Bedford, MA). Membranes were subsequently immunoblotted with mouse monoclonal Myc, HA, and GFP antibodies at 1/1000 dilution (BabCo, Richmond, CA), or rabbit polyclonal Mts4 antibody at 1/1000 dilution. Detection was performed using peroxidase-conjugated anti-mouse or anti-rabbit IgGs (Amersham, Amersham, UK) and chemiluminescence visualization (ECL; Amersham) according to the manufacturer's instructions.
Polysome Profile Analysis
Polysomes were obtained using a protocol modified from Tzamarias
et al. (1989)
. Cycloheximide, 50 µg/ml, was added to 50 ml of cultures at OD595 of 0.5. Cells were rapidly
chilled, washed once in breaking buffer (10 mM Tris-HCl, 100 mM NaCl,
30 mM MgCl2, 50 µg/ml cycloheximide, and 200 µg/ml heparin) and harvested by centrifugation. Cells were lysed with
glass beads in 200 µl of breaking buffer. Cell lysates were clarified
by centrifugation at 13,000 × g for 2 min in a
microfuge. Supernatants were fractionated on 7-47% sucrose gradients
(made in 50 mM Tris-acetate, pH 7, 50 mM NH4Cl,
and 12 mM MgCl2) for 105 min at 40,000 rpm using a SW40-Ti rotor in a Beckman L70 centrifuge (Fullerton, CA). Polysome profiles were obtained by monitoring the absorbance at 254 nm along the
gradient using an LKB 2238 Uvicord SII, and the output was recorded
using a Picolog analog-to-digital converter and data logging software
(Pico Technology, Cambridge, United Kingdom). Proteins in the polysome
profile fractions were concentrated by trichloroacetic acid (TCA)
precipitation, and samples were analyzed by SDS-PAGE and immunoblotting.
Cell Staining, Confocal Microscopy, and Immunofluorescence
GFP-Sum1 and GFP-Int6 cells were subjected to stress, as
indicated in the text, and subsequently harvested, resuspended in a
small volume of YE5S, and observed using a Bio-Rad MRC 600 confocal laser scanning system attached to a Nikon Diaphot inverted microscope (Tokyo, Japan). For DAPI staining, strain TH496 was grown to
logarithmic phase, and after exposure to stress, cells were washed in
PBS, resuspended in a small volume medium, and stained with DAPI, as described in Moreno et al. (1991)
. Nuclear staining was
observed by confocal microscopy. For DNA/RNA staining, strain TH496 was grown to logarithmic phase, washed, and centrifuged. Cell pellets were
resuspended in 1 ml of medium containing 10 µg/ml dihydroethidium (Molecular Probes, Eugene, OR). Cells were then incubated at 30°C for
45-60 min in the dark and washed two or three times in 1 ml of medium.
After the final wash, cells were resuspended in a small volume of
medium and observed using confocal microscopy.
For immunofluorescence microscopy, cells were grown to logarithmic
phase in selective medium and were fixed in 100% methanol for 10 min.
The cells were then prepared as described in Hagan and Hyams (1988)
.
Monoclonal mouse anti-FLAG (clone M2; Sigma) and monoclonal mouse
anti-eIF4E (a generous gift from J. McCarthy) were used at 1:1000.
Polyclonal rabbit anti-Mts4 was used at 1/100 dilution. Detection was
performed using Texas Red-conjugated anti-mouse or Cy-3 conjugated
anti-rabbit secondary antibodies at a 1/50 dilution. Stained cells were
observed by confocal microscopy as described above.
| |
RESULTS |
|---|
|
|
|---|
Sum1 Is a Translation Initiation Factor
To characterize the role of Sum1 in translation, a
temperature-sensitive allele (sum1-ts) was generated (see
MATERIALS AND METHODS). The sum1-ts allele supports growth
at the permissive temperature of 25°C, but cells fail to form
colonies at the restrictive temperature of 35.5°C (Figure
1A). To determine whether Sum1 is required for general translation, sum1-ts cells were exposed
to a pulse of [35S]methionine at different
times after a shift to the restrictive temperature. The levels of de
novo protein synthesis were determined by detection of incorporated
[35S]methionine and cysteine, after SDS-PAGE
analysis of total protein samples. General protein synthesis was found
to be strongly reduced in a sum1-ts strain after 2 h at
35.5°C (Figure 1B, compare lanes 1 and 2). This decrease in protein
synthesis was not observed in a wild-type strain where levels of
labeled amino acid incorporation remain unchanged after shifting to the
restrictive temperature (our unpublished results). These data strongly
suggest that Sum1 is essential for general translation of proteins in
fission yeast.
|
To determine whether sum1 overexpression effects are
associated with a role in translation, the effect of sum1
overexpression on protein synthesis was examined. Wild-type cells were
transformed with a control plasmid or a plasmid in which the
sum1 cDNA is placed under the control of the nmt1
promoter. The nmt1 promoter is repressed in the presence of
thiamine, and high expression levels of sum1 cDNA were
obtained by derepressing the nmt1 promoter in the absence of
thiamine for 24 h. Strains TH32 (wild-type + OP sum1)
and TH33 (wild-type + vector; see Table 1) were grown in the presence
or absence of thiamine for 24 h. Levels of de novo protein
synthesis were determined by SDS-PAGE as described above. As shown in
Figure 1C (compare lanes 3 and 4), radiolabel incorporation into newly
synthesized proteins was reduced after overexpression of
sum1 in the absence of thiamine (
T). The same strains
transformed with vector alone showed efficient radiolabel incorporation
in the presence or absence of thiamine (Figure 1C, lanes 1 and 2).
These results indicate that sum1 overexpression leads to a
reduction in translation.
We next wanted to determine whether Sum1 plays a role in translation
initiation. To test this possibility, polysome profiles were compared
in wild-type and sum1-ts strains at the permissive and
restrictive temperatures. At 25°C, an increase in the monosome (80S)
to polysome ratio was observed in the sum1-ts strain
compared with wild-type cells (Figure 2,
top panels). This finding suggests that even at the permissive
temperature (25°C), the efficiency of translation initiation is
mildly reduced in sum1-ts compared with wild type. After a
shift of sum1-ts to 35.5°C for 2 h, a significant
increase in the monosome peak was observed, together with a reduction
in polysome levels (Figure 2, middle left panel). After incubation of
sum1-ts at 35.5°C for 4 h, the monosome peak had
accumulated further, and the polysome peaks were completely absent
(Figure 2, bottom left panel). In contrast, no significant difference
in the wild-type polysome profile was observed under these conditions
(Figure 2, right panels). These results indicate an essential role for
Sum1 in translation initiation in fission yeast.
|
Sum1 Is a Component of the eIF3 Complex
Because components of the eIF3 complex are associated with
ribosomal subunits (Benne and Hershey, 1978
), the possibility that Sum1
is associated with ribosomal subunits was examined. Extracts from a
strain encoding a 6xHis-Myc-tagged Sum1 (TH605) were subjected to
sucrose gradient centrifugation. Fractions were collected, precipitated
with 10% TCA, and analyzed by SDS-PAGE. From Western blot analysis,
the 6xHis-Myc-Sum1 protein (size, 43 kDa) was detected in low-density
fractions but was found to be enriched in fraction 5, corresponding to
the 40S ribosome fraction (Figure 3A).
These results are consistent with the sedimentation patterns observed for the mammalian p36 homolog (Asano et al., 1997a
) and
fission yeast Int6 eIF3 subunit (Bandyopadhyay et al., 2000
,;
Crane et al., 2000
; Akiyoshi et al., 2001
).
|
To further test the possibility that Sum1 is a component of eIF3, we
examined whether Sum1 and Int6 interact in vivo. To this end, a strain
(TH580) was constructed that expresses a 6xHis-Myc-tagged Sum1 and
HA-tagged Int6. In this strain, 6xHis-Myc-Sum1 is expressed from a
plasmid under its own promoter, which can complement a sum1
deletion strain. 6xHis-Myc-Sum1 thus appears to be fully functional.
The construct HA-Int6 has been previously described (Crane et
al., 2000
). 6xHis-Myc-tagged Sum1 was affinity-purified using
nickel beads, and copurified proteins were analyzed by Western blots.
As shown in Figure 3B, a protein of ~62 kDa, corresponding to HA-Int6
protein, copurified with 6xHis-Myc-Sum1 (43 kDa) under normal
conditions (lane 1). Interactions were confirmed by reciprocal immunoprecipitations using strain TH505, which encodes both GFP-Sum1 and HA-Int6 (Crane et al., 2000
). The association of Sum1
with the 40S ribosome, the physical interaction between Sum1 and Int6, together with its sequence similarity to TIF34 strongly suggests that
Sum1 is a component of the eIF3 complex in fission yeast.
GFP-Sum1 Protein Relocalizes under Stress Conditions
Because Sum1 overexpression leads to significant cell cycle delay
after osmotic stress (Humphrey and Enoch, 1998
), we examined the
regulation of Sum1 under conditions of stress. No changes in Sum1
protein levels were observed under conditions of osmotic, oxidative, or
thermal stress, and changes in Sum1 protein mobility were not observed
by SDS-PAGE (our unpublished results). The cellular localization of
Sum1 protein was additionally examined under stress conditions. Sum1
was tagged at the N-terminus with the green fluorescent protein
(GFP-Sum1) and integrated into a sum1::ura4 strain
(TH496). The GFP-Sum1 fusion protein expression is under the control of the sum1+ promoter and can functionally
complement the sum1 deletion strain. Additionally, GFP-Sum1
can suppress the HU sensitivity of cdc2-3w when
overexpressed (our unpublished results). GFP-Sum1 thus appears to be
fully functional. Under nonstressed conditions, GFP-Sum1 protein was
present in the cytoplasm of the cell and was excluded from the nucleus
(Figure 4A, time 0; see also GFP-Sum1
with nuclear [DAPI] staining, bottom panels). This observation is
consistent with a role for Sum1 in translation initiation. The smaller
unstained areas in the cytoplasm of the cell from which Sum1 is
excluded correspond to vacuoles (our unpublished results). Expressing
GFP protein alone in fission yeast shows a uniform localization pattern of the protein across the cell (Chen et al., 1999
). Because
overexpression of sum1 cDNA can inhibit the normal cell
cycle response to osmotic stress, GFP-Sum1 localization was examined
under conditions of osmotic stress. After exposure of cells to 1 M KCl,
GFP-Sum1 protein was observed to rapidly relocalize to cytoplasmic foci
(Figure 4A, top panels; see also magnified picture). Similar results
were observed after exposure to 1.2 M sorbitol (our unpublished
results). The diffuse cytoplasmic localization pattern was resumed
after extended periods of exposure to these agents, indicating that cells adapt to osmotic stress. The localization of GFP-Sum1 was further
examined under additional forms of stress. GFP-Sum1 was found to
rapidly relocalize to cytoplasmic foci after exposure to thermal stress
(42°C; Figure 4A, middle panels; see also magnified picture).
GFP-Sum1 was additionally present within a nuclear "ring"-shaped structure after 10 min at 42°C, and this localization pattern is
sustained at this temperature (Figure 4A, middle panels).
Colocalization of GFP-Sum1 with the nuclear stain DAPI revealed a
striking yellow ring structure, consistent with GFP-Sum1 localizing to
the inner side of the nuclear envelope after heat shock (Figure 4A,
bottom panels). Formation of such stress-dependent foci is reversible, because if cells were incubated at 30°C for 1 h after heat
shock, GFP-Sum1 became localized within the cytoplasm again (our
unpublished results). We further tested whether GFP-Sum1 was
relocalized after exposure to hydrogen peroxide, HU, or ionizing
radiation; however, GFP-Sum1 relocalization was not observed under
these conditions (our unpublished results).
|
To determine whether GFP-Sum1 foci were formed as a result of eIF3
relocalization under conditions of osmotic or thermal stress, we tested
whether Sum1 was associated with Int6 under these stress conditions.
Cells were exposed to osmotic or thermal stress for increasing periods
of time, and the ability of 6xHis-Myc-Sum1 to interact specifically
with HA-Int6 was determined by affinity purification and Western blot
analysis. From these experiments, HA-Int6 was found to be stably
associated with 6xHis-Myc-Sum1 under both osmotic stress (1 M KCl;
Figure 3B, lanes 1-4) and thermal stress (42°C; Figure 3C, lanes
1-4). These data are consistent with Sum1 relocalizing as part of the
eIF3 complex in response to environmental stress. To test this
hypothesis further, GFP-Int6 localization was examined under stress
conditions. GFP-Int6 was observed to rapidly relocalize to cytoplasmic
foci after exposure to osmotic or thermal stress (Figure 4B, GFP-Int6).
However, in contrast to Sum1, GFP-Int6 was not tightly associated with
a nuclear ring-like structure at 42°C (compare Figure 4A and 4B). The
localization of the fission yeast ortholog of p116 (eIF3b) was also
examined. p116 was expressed from a plasmid as a FLAG epitope-tagged
form (Crane et al., 2000
). Immunofluorescence studies using
anti-FLAG antibodies, revealed p116 to be cytoplasmic under normal
conditions (Figure 4B, FLAG-p116, unstressed) and to rapidly relocalize
to cytoplasmic foci after thermal stress (Figure 4B, FLAG-p116,
42°C). FLAG-p116 was not tightly associated with a nuclear ring-like structure at 42°C. These data are consistent with Sum1 relocalizing to cytoplasmic foci as part of a dynamic eIF3 complex during
environmental stress.
The finding that components of the eIF3 complex are relocalized to
cytoplasmic foci under conditions of stress raised the possibility that
additional components of the translational machinery may also be
localized to these foci after environmental stress in fission yeast. To
test this possibility, colocalization of GFP-Sum1 with rRNA was
examined. rRNA is strongly stained by dihydroethidium, an RNA/DNA
stain. This cytoplasmic staining pattern is distinct from that observed
from the weaker mitochondrial DNA/RNA staining (our unpublished
results). After exposure to thermal stress for 10 min, GFP-Sum1
colocalizes with areas of DNA/RNA staining in the cytoplasm in addition
to the nuclear periphery (Figure 4C). These data suggest that GFP-Sum1
is associated with rRNA at large cytoplasmic foci after thermal stress.
A striking yellow ring structure is also observed within the nucleus
(Figure 4C, right panel). The translation initiation subunit eIF4E has
been identified as a cap-binding protein in fission yeast (Ptushkina
et al., 1996
). To determine whether eIF4E was also observed
at specific foci after thermal stress, immunofluorescence was performed
using anti-eIF4E antibodies. After exposure of TH496 to thermal stress
for 20 min, eIF4E was observed to localize to both cytoplasmic
and nuclear foci (Figure 4D, middle panel). A merged picture of
GFP-Sum1 and eIF4E staining revealed a striking colocalization pattern
to both cytoplasmic foci and additionally within the nucleus after
thermal stress (Figure 4D, right panel). These data indicate that the GFP-Sum1, together with rRNA and eIF4E colocalize to specific foci
under conditions of thermal stress. These data together suggest that
the eIF3 complex is rapidly associated with multiple large multifactor
complexes after exposure to environmental stress.
Because Sum1 is essential for translation initiation, we next wanted to
determine whether translation was still observed under conditions in
which Sum1 is localized to both cytoplasmic and nuclear foci. Wild-type
cells were shifted to 42°C for increasing lengths of time, and levels
of de novo protein synthesis were determined as described above. After
exposure to thermal stress, radiolabel incorporation into newly
synthesized proteins was reduced to <50% of that observed in
unstressed conditions within 20 min (Figure
5A, compare lanes 1-4). Importantly, a
significant degree of radiolabel incorporation was still observed,
indicating that protein synthesis still occurs under these conditions.
Polysome profiles were also examined from wild-type cells under
conditions of thermal stress (Figure 5B). The reduced levels of RNA
associated with both monosomes and polysomes, together with an
increased 60S ribosomal peak, are consistent with the observation that
bulk polyA+ RNA is localized to the nucleus under these conditions (Tani et al., 1996
; our unpublished results). These data
indicate that protein synthesis still occurs, albeit at reduced levels under conditions in which GFP-Sum1 and additional subunits of translation factors are observed to localize to specific cytoplasmic and nuclear foci. Importantly, no loss of viability is observed under
these conditions in either wild-type or in strain TH496, in which
GFP-Sum1 performs an essential function (Figure
6C). These data strongly suggest that the
cytoplasmic foci described above are likely to function as translation
centers under conditions of thermal stress.
|
|
Sum1 Interacts with Components of the 26S Proteasome
The 26S proteasome complex is a large multisubunit complex
involved in degrading both cytoplasmic and nuclear proteins that have
been targeted for destruction by the ubiquitin pathway. The 26S
proteasome complex is localized predominantly at the nuclear periphery
as a ring shaped structure, both in interphase and throughout mitosis
in fission yeast (Wilkinson et al., 1998
, 1999
). Because GFP-Sum1 was observed to localize as a ring structure to the nuclear periphery under thermal stress (Figure 4, A and C), we further tested
the possibility that GFP-Sum1 may colocalize with the 26S proteasome at
the nuclear periphery after thermal stress. To this end, colocalization
of GFP-Sum1 with Mts4 was examined. Mts4, the fission yeast homolog of
RPN1, is a non-ATPase subunit of the 19S regulatory particle
of the 26S proteasome (Wilkinson et al., 1997
). As shown in
Figure 6A, Mts4 is localized at the nuclear periphery at both 25 and
42°C. At 25°C, GFP-Sum1 is cytoplasmic, although some overlap with
Mts4 is observed at the nuclear periphery under these conditions. After
exposure to thermal stress for 10 min, GFP-Sum1 colocalization with
Mts4 staining at the nuclear periphery is observed, as depicted by a
strong yellow ring structure (Figure 6A, bottom right panel). These
data indicate that GFP-Sum1 colocalizes with the 26S proteasome at
42°C. This finding raised the possibility that GFP-Sum1 was a
substrate for the 26S proteasome under these conditions. However,
GFP-Sum1 protein remained stable, and no loss of viability of this
strain was observed under these conditions (Figure 6, B and C).
Therefore, the possibility that Sum1 may interact with components of
the proteasome was examined further.
The localization of the 26S proteasome to the nuclear periphery is
dependent on Cut8 in fission yeast: Loss of Cut8 results in proteasome
subunits becoming enriched within the cytoplasm (Tatebe and Yanagida,
2000
). To determine whether the localization of GFP-Sum1 was dependent
on the localization of the 26S proteasome, GFP-Sum1 localization was
examined in a cut8-563 mutant at both the permissive
temperature (25°C) and at the restrictive temperature (36°C).
Surprisingly, at the permissive temperature, GFP-Sum1 in a
cut8-563 background (TH917) was found to be largely
localized within the nucleus compared with the exclusively cytoplasmic
localization pattern observed a wild-type background (TH496; Figure
7, left panel, GFP-sum1
cut8-563). This result clearly indicates that Cut8 is required to
maintain the cytoplasmic localization of GFP-Sum1. Analysis of GFP-Sum1
(TH496) incubated at the restrictive temperature followed by heat shock
at 42°C for 20 min resulted in GFP-Sum1 accumulation at the nuclear
periphery (Figure 7, right panel, GFP-sum1). In contrast, a
largely diffuse cytoplasmic staining pattern was observed for GFP-Sum1
in a cut8-563 background (TH917) under these conditions
(Figure 7, right panel, GFP-sum1 cut8-563). No increase in
GFP-Sum1 protein levels was observed in a cut8-563 background (our unpublished results). These findings clearly
indicate that the localization of GFP-Sum1 is Cut8 dependent, strongly suggesting a link between the localization of Sum1 and that of the 26S
proteasome. The relationship between the 26S proteasome and Sum1
localization was tested further by examining GFP-Sum1 localization in
temperature-sensitive mutants, which disrupts 26S proteasome
function at the restrictive temperature. Localization of GFP-Sum1 was
examined in mts4-1, which contains a temperature-sensitive lesion in the essential mts4+ gene.
Localization of GFP-Sum1 at 25°C (permissive temperature) in a
mts4-1 background (TH1117) was found to be mainly nuclear at
25°C and thus resembled the staining observed in a
cut8-563 background (Figure 7, left panel, GFP-sum1
mts4-1). Incubation of this strain at the restrictive temperature
followed by heat shock at 42°C for 10 min resulted in cytoplasmic
GFP-Sum1 staining, with no staining at the nuclear periphery observed
(Figure 7, right panel, GFP-sum1 mts4-1). Mts2 was first
isolated as a temperature-sensitive mutant, conferring resistance to
the microtubule destabilizing drug methyl 2-benzimidazolecarbamate, and
subsequently identified as the S. pombe homologue of the
human S4 subunit of the 26S proteasome (Gordon et al.,
1993
). Nuclear localization of GFP-Sum1 was similarly observed at
25°C in an mts2-1 background (TH1118), and incubation of
this strain at the restrictive temperature followed by heat shock at
42°C for 10 min again resulted in cytoplasmic GFP-Sum1 staining
pattern, with no accumulation at the nuclear periphery (Figure 7, left
and right panel, GFP-sum1 mts2-1). Pad1 is a component of
the 26S proteasome, which when overexpressed confers multidrug resistance in fission yeast (Spataro et al., 1997
; Penney
et al., 1998
). Localization of GFP-Sum1 in a
pad1-1 background (TH1119) was additionally found to be
largely nuclear at 25°C, and incubation of this strain at the
restrictive temperature, followed by heat shock at 42°C for 10 min
similarly resulted in a cytoplasmic GFP-Sum1 staining pattern only
(Figure 7, left and right panel, GFP-sum1 pad1-1). These
data indicate that mutation of components of the 26S proteasome result
in significant levels of nuclear Sum1 localization, even at their
permissive temperature. Therefore, the 26S proteasome is required for
the cytoplasmic localization of GFP-Sum1. Importantly, no changes in
GFP-Sum1 localization were observed in mutants defective in the nuclear
export protein Crm1 (our unpublished results), indicating that control
of Sum1 localization by Cut8 is specific and occurs through a
Crm1-independent mechanism. No such changes in GFP-Int6 or FLAG-p116
localization were observed in cut8 mutant cells either at
the permissive or nonpermissive temperature (our unpublished results).
|
To further examine the relationship between Sum1 and the 26S
proteasome, possible genetic interactions were sought between OP
Sum1 and temperature-sensitive alleles of components of the proteasome. To identify any genetic interactions between
mts4 and sum1, TH528, which contains a
temperature-sensitive lesion in the essential
mts4+ gene, was transformed with a control
plasmid (pREP3X) or a plasmid from which the sum1 cDNA was
highly expressed (pREP3X-sum1) to form TH548 and TH549,
respectively. Overexpression of sum1 (OP sum1 ON)
in mts4-1, at the permissive temperature, resulted in synthetic dosage lethality of mts4 cells (Figure
8A, right panel, lower right quadrant).
Normal growth for these strains was observed at the permissive
temperature when sum1 expression was repressed (OP
sum1 OFF) in the presence of thiamine (Figure 8A, left
panel, lower right quadrant). mts4-1 cells overexpressing
sum1 were found to be highly elongated compared with
wild-type cells and failed to grow even at the permissive temperature
of 25°C, indicating a cell cycle arrest (Figure 8B, right panel).
This phenotype is distinct from that of mts4-1 at the
restrictive temperature, in which cells die with a metaphase arrest
phenotype (Wilkinson et al., 1997
). These data indicate a
genetic interaction between overexpression of sum1 and the
mts4 component of the proteasome complex. Mts2, interacts
physically with Mts4, and genetic interactions have been identified
between mts2
and
mts4
(Wilkinson et al.,
1997
). Genetic interactions between Mts2 and Sum1 were therefore also
examined. To this end, strain TH529, which contains a
temperature-sensitive mutation in the essential mts2+ gene, was transformed with a control
plasmid (pREP3X) or a plasmid from which the sum1 gene was
highly expressed (pREP3X-sum1) to form TH553 and TH554,
respectively. Expression of sum1 in the presence (OP
sum1 OFF) or absence of thiamine (OP sum1 ON) had no effect on the growth of mts2-1 mutants at the permissive
temperature (Figures 8A, top quadrants, and 8C, left panel). However,
mts2-1 cells failed to form colonies at the restrictive
temperature of 35.5°C (Figure 8C, right panel, left quadrant). In
contrast, overexpression of sum1 was able to rescue the
temperature sensitivity of the mts2-1 mutant cells and
allowed them to form colonies at the restrictive temperature of
35.5°C (Figure 8C, right panel, right quadrant). These data clearly
indicate strong genetic interactions between Sum1 and the Mts2 and Mts4
components of the 26S proteasome in fission yeast. These interactions
are likely to be specific to Mts2 and Mts4 components of the 26S
proteasome, because no genetic interactions were observed after
overexpression of Sum1 in mts3-1 (our unpublished results).
|
To determine whether Sum1 was physically associated with components of
the proteasome in vivo, reciprocal coimmunoprecipitation experiments
were performed between Sum1 and Mts4. To this end, a strain (TH605) was
used in which an integrated construct encoding 6xHis-Myc-tagged Sum1
functionally replaced the endogenous sum1+
gene. 6xHis-Myc-Sum1 was affinity-purified using nickel beads, and
copurified proteins were analyzed by western blots. As shown in Figure
9A, a band corresponding to Mts4 (97 kDa)
was copurified with 6xHis-Myc-Sum1 under normal conditions (lane 1). To
further test this interaction, reciprocal immunoprecipitations were
also performed from strain TH605 using anti-Mts4 antibodies. As seen in
Figure 9B, after immunoprecipitation with anti-Mts4 antibodies, a band
corresponding to 6xHis-Myc-Sum1 was detected from the above strain,
using anti-Myc antibodies (lane 1), but not in strains encoding HA-Sum1
(TH498; lane 2) or mock experiments (lane 3). These data demonstrate a
specific physical interaction between Sum1 and Mts4 in vivo under
normal growth conditions.
|
| |
DISCUSSION |
|---|
|
|
|---|
Sum1 Is a Component of the eIF3 Translation Initiation Complex
We have identified Sum1 as an essential component of the eIF3
translation initiation complex. This conclusion is based on the
following observations: First, Sum1 shares striking sequence similarity
to eIF3-p39 (eIF3i), encoded by the TIF34 gene in S. cerevisiae, and TRIP-1 in humans (Chen et al., 1995
;
Naranda et al., 1997
). Second, overexpression of
sum1 resulted in reduced levels of global protein synthesis.
Third, incubation of a temperature-sensitive allele of sum1
at the restrictive temperature resulted in complete loss of
[35S]methionine incorporation, loss of
polysomes, and an increased monosome fraction. Fourth, sucrose gradient
analysis revealed Sum1 to be associated with 40S ribosomal fractions,
as has previously been reported for other eIF3 subunits, including the
mammalian p36 (Asano et al., 1997a
) and Int6 in fission
yeast (Bandyopadhyay et al., 2000
; Crane et al.,
2000
; Akiyoshi et al., 2001
). Finally, Myc-tagged Sum1 was
found to stably associate in vivo with HA-tagged Int6, a known
component of the fission yeast eIF3 complex. The identification of Sum1
as a component of the eIF3 complex indicates that this protein is
functionally as well as structurally conserved among eukaryotes.
Mammalian Int6/p48, has been demonstrated to interact with components
of the eIF3 core (Asano et al., 1997b
). The fission yeast
Int6 has been reported to interact with the S. pombe
ortholog of S. cerevisiae TIF35 (Akiyoshi et al.,
2001
). In addition, the fission yeast eIF3d/Moe1 and eIF3e/Int6
interact with the eIF3b-p116 subunit of the fission yeast eIF3 complex (Bandyopadhyay et al., 2001
). Our data demonstrate a stable
interaction in fission yeast between Sum1, a putative core subunit, and
fission yeast Int6. From this, it would appear that the association
between Int6 and components of the eIF3 core is maintained in fission yeast, suggesting that the general structure of the eIF3 complex is
likely to be highly conserved among eukaryotes. Sum1 was originally identified as a high copy suppressor of S-M checkpoint mutants and
inhibitor of the normal cell cycle response to osmotic stress (Humphrey
and Enoch, 1998
). The identification of Sum1 as a core component of the
eIF3 complex suggests that the cell cycle response to stress can be
translationally modulated in fission yeast.
Relocalization of Sum1 under Stress Conditions
We have examined the localization of Sum1 under conditions
of stress. Surprisingly, we observed GFP-Sum1 to be rapidly relocalized to specific foci: After exposure to osmotic stress, GFP-Sum1
relocalizes transiently to multiple cytoplasmic foci. After exposure to
thermal stress, GFP-Sum1 is rapidly relocalized and maintained at
cytoplasmic foci and is additionally present at the inner nuclear
periphery. Our data suggest that Sum1 is rapidly relocalized as part of
a dynamic eIF3 complex to cytoplasmic foci in response to environmental stress. Because Sum1 was additionally found to colocalize with an RNA
component and with eIF4E during thermal stress, these data strongly
suggest that the translational machinery is spatially reorganized to
specific foci under these conditions. Moreover, because translation was
still observed under these conditions, albeit at reduced levels, these
findings raise the possibility that the Sum1-associated foci perform a
translational role under conditions of environmental stress. These
stress-dependent foci observed in fission yeast resemble stress
granules observed in plant and mammalian cells under conditions of
environmental stress (Nover et al., 1983
; Kedersha et
al., 1999
). Stress granules are ribonuclear aggregates at which
untranslated mRNAs accumulate as a consequence of stress-induced
translational arrest and have been proposed to be sites at which
untranslated mRNAs are sorted and processed for either reinitiation,
degradation, or packaging into stable nonpolysomal mRNP complexes
(Nover et al., 1989
; Kedersha et al., 1999
,
2000
). Our findings raise the possibility that the spatial
reorganization of the translation machinery to cytoplasmic foci is a
common response to environmental stress in all eukaryotes.
Association of Sum1 with Components of the Proteasome
Recent studies indicate that components of the translation
initiation complex, eIF3, the COP9 signalosome, and the proteasome complex have similar properties and structures (Asano et
al., 1997c
; Aravind and Ponting, 1998
; Glickman et al.,
1998
; Hofmann and Bucher, 1998
; Wei et al., 1998
; Kim
et al., 2001
). Two structural motifs, the PCI (for
Proteasome, COP9, Initiation
factor) and MPN (for Mpr1 and Pad1
N terminal) appear to be present exclusively in these
multisubunit complexes (Table 2). These
findings suggest that these complexes are derived from a common
ancestral origin and that components of these complexes may perform
overlapping functions. Indeed, associations between subunits of the
eIF3 and COP9 signalosome have been reported (Karniol et
al., 1998
; Yahalom et al., 2001
). Although proteins
structurally related to Sum1 have not been identified within the 26S
proteasome or COP9 complexes, several lines of evidence presented here
indicate an interaction between Sum1 and components of the proteasome
complex: First, GFP-Sum1 stably colocalized with the Mts4 component of
the 26S proteasome at the nuclear periphery following thermal stress. Second, we found GFP-Sum1 localization to be dependent on an intact 26S
proteasome: Analysis of GFP-Sum1 in cut8-563, mts4-1,
mts2-1, and pad1-1, at the permissive temperature,
revealed a high degree of nuclear localization. Moreover, the rapid
relocalization of GFP-Sum1 to the nuclear periphery during heat shock
was also abolished in these mutants. Third, genetic interactions
between Sum1 and mutations in components of the 26S proteasome were
observed: OP sum1 exhibited synthetic-dosage lethality with
a temperature-sensitive allele of mts4-1, resulting in cell
cycle arrest at the permissive temperature. Further, OP sum1
could suppress a temperature-sensitive allele of mts2-1.
Finally, copurification and coimmunoprecipitation experiments revealed
physical interactions between Sum1 and Mts4 in vivo, under normal
growth conditions. This finding is consistent with the overlap observed
between GFP-Sum1 and Mts4 staining at the nuclear periphery under
normal growth conditions. The finding that Sum1 localization is
dependent on an intact 26S proteasome provides a functional insight
into the interaction of these two structurally related complexes.
However, the precise role of Sum1 within the nucleus under these
conditions is unclear. In contrast to Sum1, Int6 and p116 did not
localize to the nuclear periphery under stress, and Int6 and p116
localization was not dependent on the 26S proteasome (our unpublished
results). Moreover, Int6 does not cosediment with components of the
proteasome (Crane et al., 2000
). These data suggest that
Sum1 interacts with components of the proteasome independently of the
eIF3 complex and therefore may perform a distinct function in this
context. A role for p36-TIF34, the sum1+
homologue, has been proposed in both assembling and maintaining the
eIF3 translation initiation complex in S. cerevisiae
(Naranda et al., 1997
; Verlhac et al., 1997
).
Given the structural similarity between components of the eIF3 and the
26S proteasome complexes, Sum1 could potentially function to maintain
the stability of the 26S proteasome under stress conditions. Indeed the
hypothesis that Sum1 functions to stabilize the 26S proteasome during
heat shock is supported by the observation that GFP-Sum1 rapidly
localizes to the 26S proteasome after heat shock and additionally from
the finding that Sum1 overexpression suppressed the
temperature-sensitivity of mts2-1. Alternatively, Sum1 may
interact with components of the proteasome to increase turnover
efficiency of misfolded proteins produced under heat shock conditions.
Our observations also indicate, however, that Sum1 physically interacts
with Mts4 under normal conditions. The cell cycle arrest phenotype
resulting from sum1 overexpression in mts4-1
suggests the Sum1-Mts4 interaction may perform an essential function
in cell cycle control. Alternatively, because Sum1 and Mts4 are
required for protein synthesis and proteolytic functions, respectively,
it is reasonable to consider the possibility that the Sum1-Mts4
interaction may function in coordinating these processes. Experiments
are currently underway to further explore these exciting possibilities.
|
We have characterized the fission yeast Sum1 protein. We present
evidence that it functions as a component of the eIF3 complex, that it
rapidly relocalizes to specific foci under stress conditions as part of
a multifactor complex, and that it interacts both genetically and
biochemically with components of the 26S proteasome. Our findings indicate that Sum1, like its mammalian counterpart, TRIP-1, may perform
functions in addition to its translational role as an eIF3 subunit. A
diverse array of functions have been associated with other eIF3
subunits or orthologues: The mammalian eIF3-p40 and p48 subunits have
been implicated in tumorigenesis (Marchetti et al., 1995
;
Desbois et al., 1996
; Nupponen et al., 1999
) and may interact with p110 and a nuclear protein, Rfp (Morris-Desbois et al., 1999
). The eIF3/p48 has been recently shown to
interact with the human protein HSPC021, which contains motifs found in subunits of the eIF3, 26S proteasome and of the COP9 signalosome (Morris-Desbois et al., 2001
). Moreover, eIF3-p48 has
recently been demonstrated to interact with P56, a protein induced by
interferon and double-stranded RNA, indicating that eIF3 is a target
for translational stress response (Guo et al., 2000
).
Multiple functions have now been ascribed to the fission yeast Int6
homolog, including roles in multidrug resistance, microtubule assembly,
chromosome segregation, and spore formation (Bandyopadhyay et
al., 2000
; Crane et al., 2000
; Yen and Chang, 2000
;
Akiyoshi et al., 2001
). Cytoskeletal functions have also
been ascribed to the mammalian eIF3-p170, eIF3-p44, and the fission
yeast ortholog of p66 (Chen et al., 1999
; Hou et
al., 2000
; Lin et al., 2001
; Palecek et al., 2001
; Pincheira et al., 2001
). Further, the eIF3-p110
subunit is required for nuclear import in S. cerevisiae (Gu
et al., 1992
). Whether the additional functions associated
with these eIF3 subunits are distinct from their role in translation
remains to be determined. However, these findings raise the possibility
that the eIF3 complex may play a central role in coordinating a number
of diverse functions with cell growth. Genes encoding orthologues of
most of the subunits of the mammalian eIF3 complex are present in the
fission yeast genome (Table 2), suggesting that fission yeast will be a
useful model system for studying the mammalian eIF3 complex. The
identification of Sum1 as an essential component of the fission yeast
eIF3 complex will provide an important molecular tool with which to
further characterize the relationships between the functionally diverse subunits of the largest translation initiation factor.
| |
ACKNOWLEDGMENTS |
|---|
The authors thank S. Townsend at MRC Harwell and N. White, who is funded by the Wellcome Trust, at the Sir William Dunn School of Pathology, University of Oxford, for their expert help in confocal microscopy; J. McCarthy for the generous gift of the eIF4E antibody; and S. Kearsey and A. Pearce for helpful comments on the manuscript. This work was supported by the Medical Research Council.
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: T.Humphrey{at}har.mrc.ac.uk.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.01-06-0301. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.01-06-0301.
| |
REFERENCES |
|---|
|
|
|---|
, GTPase-activating and GDP-GTP exchange factors in translation initiation, mediate binding to their common substrate eIF2.
EMBO J.
18, 1673-1688[CrossRef][Medline].
type II receptor.
Nature
377, 548-552[CrossRef][Medline].
receptor-interacting protein TRIP-1 acts as a modulator of the TGF-
response.
J. Biol. Chem.
273, 31455-31462This article has been cited by other articles:
![]() |
T. Grousl, P. Ivanov, I. Frydlova, P. Vasicova, F. Janda, J. Vojtova, K. Malinska, I. Malcova, L. Novakova, D. Janoskova, et al. Robust heat shock induces eIF2{alpha}-phosphorylation-independent assembly of stress granules containing eIF3 and 40S ribosomal subunits in budding yeast, Saccharomyces cerevisiae J. Cell Sci., June 15, 2009; 122(12): 2078 - 2088. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Gaillard and A. Aguilera A Novel Class of mRNA-containing Cytoplasmic Granules Are Produced in Response to UV-Irradiation Mol. Biol. Cell, November 1, 2008; 19(11): 4980 - 4992. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Asp, D. Nilsson, and P. Sunnerhagen Fission Yeast Mitogen-Activated Protein Kinase Sty1 Interacts with Translation Factors Eukaryot. Cell, February 1, 2008; 7(2): 328 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Brengues and R. Parker Accumulation of Polyadenylated mRNA, Pab1p, eIF4E, and eIF4G with P-Bodies in Saccharomyces cerevisiae Mol. Biol. Cell, July 1, 2007; 18(7): 2592 - 2602. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Decca, M. A. Carpio, C. Bosc, M. R. Galiano, D. Job, A. Andrieux, and M. E. Hallak Post-translational Arginylation of Calreticulin: A NEW ISOSPECIES OF CALRETICULIN COMPONENT OF STRESS GRANULES J. Biol. Chem., March 16, 2007; 282(11): 8237 - 8245. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Stribinskis and K. S. Ramos Rpm2p, a protein subunit of mitochondrial RNase P, physically and genetically interacts with cytoplasmic processing bodies Nucleic Acids Res., February 28, 2007; 35(4): 1301 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. LeFebvre, N. L. Korneeva, M. Trutschl, U. Cvek, R. D. Duzan, C. A. Bradley, J. W. B. Hershey, and R. E. Rhoads Translation Initiation Factor eIF4G-1 Binds to eIF3 through the eIF3e Subunit J. Biol. Chem., August 11, 2006; 281(32): 22917 - 22932. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anderson and N. Kedersha RNA granules J. Cell Biol., March 13, 2006; 172(6): 803 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Swaminathan, T. Masek, C. Molin, M. Pospisek, and P. Sunnerhagen Rck2 Is Required for Reprogramming of Ribosomes during Oxidative Stress Mol. Biol. Cell, March 1, 2006; 17(3): 1472 - 1482. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Dunand-Sauthier, C. A. Walker, J. Narasimhan, A. K. Pearce, R. C. Wek, and T. C. Humphrey Stress-Activated Protein Kinase Pathway Functions To Support Protein Synthesis and Translational Adaptation in Response to Environmental Stress in Fission Yeast Eukaryot. Cell, November 1, 2005; 4(11): 1785 - 1793. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. L. Jenkins, J. Mata, R. F. Crane, B. Thomas, A. Akoulitchev, J. Bahler, and C. J. Norbury Activation of AP-1-Dependent Transcription by a Truncated Translation Initiation Factor Eukaryot. Cell, November 1, 2005; 4(11): 1840 - 1850. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ballut, M. Drucker, M. Pugniere, F. Cambon, S. Blanc, F. Roquet, T. Candresse, H.-P. Schmid, P. Nicolas, O. L. Gall, et al. HcPro, a multifunctional protein encoded by a plant RNA virus, targets the 20S proteasome and affects its enzymic activities J. Gen. Virol., September 1, 2005; 86(9): 2595 - 2603. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Miyamoto, P. Patel, and J. W. B. Hershey Changes in Ribosomal Binding Activity of eIF3 Correlate with Increased Translation Rates during Activation of T Lymphocytes J. Biol. Chem., August 5, 2005; 280(31): 28251 - 28264. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. TEIXEIRA, U. SHETH, M. A. VALENCIA-SANCHEZ, M. BRENGUES, and R. PARKER Processing bodies require RNA for assembly and contain nontranslating mRNAs RNA, April 1, 2005; 11(4): 371 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Liska, A. Shevchenko, U. Pick, and A. Katz Enhanced Photosynthesis and Redox Energy Production Contribute to Salinity Tolerance in Dunaliella as Revealed by Homology-Based Proteomics Plant Physiology, September 1, 2004; 136(1): 2806 - 2817. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Kimball, R. L. Horetsky, D. Ron, L. S. Jefferson, and H. P. Harding Mammalian stress granules represent sites of accumulation of stalled translation initiation complexes Am J Physiol Cell Physiol, February 1, 2003; 284(2): C273 - C284. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||