|
|
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 5, 1641-1651, May 2002
Howard Hughes Medical Institute and Division of Biology, California Institute of Technology, Pasadena, California 91125
Submitted October 3, 2001; Revised January 18, 2002; Accepted February 1, 2002| |
ABSTRACT |
|---|
|
|
|---|
Ovulation in Caenorhabditis elegans requires inositol 1,4,5-triphosphate (IP3) signaling activated by the epidermal growth factor (EGF)-receptor homolog LET-23. We generated a deletion mutant of a type I 5-phosphatase, ipp-5, and found a novel ovulation phenotype whereby the spermatheca hyperextends to engulf two oocytes per ovulation cycle. The temporal and spatial expression of IPP-5 is consistent with its proposed inhibition of IP3 signaling in the adult spermatheca. ipp-5 acts downstream of let-23, and interacts with let-23-mediated IP3 signaling pathway genes. We infer that IPP-5 negatively regulates IP3 signaling to ensure proper spermathecal contraction.
| |
INTRODUCTION |
|---|
|
|
|---|
A crucial aspect of signal transduction is understanding how
regulatory mechanisms ensure a precise biological response to pathway
activation. Activation of receptor tyrosine kinases (RTK) stimulates
phospholipase C to hydrolyze phosphatidyl 4,5-bisphosphate to
inositol 1,4,5 triphosphate (IP3), which
binds the tetrameric IP3 receptor to mobilize
intracellular calcium (Majerus, 1992
; Berridge, 1993
).
IP3 signaling mediates many cellular processes (Berridge and Irvine, 1989
; Berridge,
1993
). Mechanisms for attenuating and
terminating signaling, such as provided by proteins that metabolize IP3, are critical in maintaining fine control of
the physiological responses dependent on
IP3-mediated calcium release. Thus, it is
important to understand negative regulation of
IP3 signaling.
|
Previous biochemical studies have shown how IP3
is produced (Berridge and Irvine, 1984
), how it is metabolized
(Majerus, 1992
), and how it releases intracellular calcium (Berridge,
1995
; Bootman and Berridge, 1995
; Clapham, 1995
); however, they have
not directly addressed IP3 function in an intact
metazoan. Two enzymes have been biochemically identified that
participate in IP3 metabolism and potentially
regulate signaling output: IP3 kinase
(IP3K) and inositol polyphosphatase
5-phosphatase (Majerus, 1992
; Drayer et al., 1996
).
5-Phosphatases lower IP3 levels by
dephosphorylating the 5'-phosphate, and they vary in substrate
specificity (Mitchell et al., 1996
; Erneux et
al., 1998
). Type I 5-phosphatases are the most active in
hydrolyzing IP3 and IP4
(Verjans et al., 1992
; Laxminaryayan et al.,
1993
). Thus, they likely play a larger role in regulating cellular
levels of IP3 than do the type II phosphatases, which additionally hydrolyze the 5'-phosphoinositols,
phosphatidyl inositol 4,5-bisphosphate and phosphatidyl inositol
3,4,5-trisphosphate (Mitchell et al., 1996
). The
distinct functional roles of various type II 5-phosphatase family
members have been demonstrated by examining targeted deletions of
mammalian type II 5-phosphatases in mice (Helgason et al.,
1998
; Janne et al., 1998
; Cremona et al., 1999
)
and targeted disruption of type II 5-phosphatases in yeast (Stolz
et al., 1996
). The functional consequence of removing type I 5-phosphatase activity in vivo is unknown.
Ovulation in Caenorhabditis elegans hermaphrodites provides a genetic system to study the regulation of IP3 signaling in vivo. C. elegans mutants defective in IP3K, known as lfe-2, have no obvious ovulation defect, suggesting that an alternate pathway to metabolize IP3 and inhibit signaling exists. Here, we report the characterization of the gene, ipp-5, that encodes the C. elegans type I 5-phosphatase. We demonstrate that it acts downstream of the LET-23 RTK, based on epistasis analyses. We present, for the first time, in vivo characterization of a type I 5-phosphatase in an intact animal by describing ovulation defects of a deletion mutant ipp-5(sy605) in C. elegans, and we place the negative regulatory function of a type I 5-phosphatase in a behavioral context.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Genetic Strains
Standard methods for maintaining C. elegans at 20°C
were used. EMS (50 mM) was used as a mutagen (Brenner, 1974
). Bristol strain N2 was used as the wild type. The following alleles were used:
LG1, unc-57(ad592), lfe-2(sy326); LGII, unc-4(e120),
let-23(sy10), let-23(sa62); LGIV, unc24(e138), lin-3(n1058),
lfe-1/itr-1(sy290), dec-4(sa73); LGX, lon-2(e678),
unc-6(e78), ipp-5(sy605). szT1[lon-2(e678)] is a reciprocal I;X
translocation balancer. mnC1[dpy-10(e128) unc-52(e444)] is
a rearrangement balancer chromosome on LGII. DnT1[nT1[unc(n745dm)let] is a reciprocal IV;V
translocation balancer (strains are from Brenner, 1974
; Ferguson and
Horvitz, 1985
; Fodor and Deak, 1985
; Aroian et al., 1991
;
Iwasaki et al., 1995
; Katz et al., 1996
;
Clandinin et al., 1998
).
Brood Assay
L4 larvae hermaphrodites were serially transferred to fresh plates every 12 h for 4 d at 20°C, and progeny were counted 2 d after eggs hatched.
Polymerase Chain Reaction (PCR)
A PCR-based strategy was used to screen a library of 245, 000 EMS mutagenized N2 haploid genomes for a targeted deletion in ipp-5 (using the method of G. Moulder and R. Barstead, personal communication; http://pcmc41.ouhsc.edu/Knockout/). The deletion removes 242 base pairs (bp) upstream of the ATG through 25 bp of exon 3. The following primers were used to detect the deletion in lysates: Round I, JC43 (5' TGCCTTGCACAAGATTATCG) and JC46 (5' CTCTCCTTCTTCCACCAA); Round II, JC30 (5'CAGCCCATGAGTCACTACTTCC) and JC68 (5' CTAGGAGGTTTTGAATTTTGACCTG). Wild-type animals amplify a 1300-bp product, whereas ipp-5 deletion mutants amplify a 480-bp product. The deletion mutant was backcrossed seven times to lon-2 unc-6. The presence of the deletion in double mutants was verified by PCR using primer pairs JC68 and BY4 (5' CGTTTTCCTTTGACGAAAGCTCGG) in Round II to distinguish homozygotes (700-bp band) from heterozygotes (700 bp, 1600-bp band). The mutants were scored by Nomarski video recordings of ovulation.
Microscopy and Image Processing
Worms were anesthetized for 30 min in a solution of M9 with
0.1% tricaine and 0.01% tetramisole (Sigma, St. Louis, Missouri) before recording (McCarter et al., 1999
). Animals were
mounted on 5% agarose pads with 20 µl of anesthetic, covered with an
18-mm glass coverslip, and the edges of the coverslip were sealed with Vaseline. Observations were made at 20°-23°C. Animals were mounted on an Axioscope (Zeiss, Thornwood, New York) and recorded under Nomarski optics (Plan 100 objective) for no more than 4 h. The microscope was connected to a CCD72 DAGE-MTI (Michigan City,
Indiana) charged-coupled device video camera module and VCR.
Images were recorded on VHS tape in real time. While under anesthetic,
oocyte maturation, and sheath and spermathecal activity at ovulation proceed, whereas pharyngeal pumping and egg laying cease (McCarter et al., 1999
). Spermathecal extension distance was
calculated by direct measurement of length (starting from the side of
the proximal oocyte nearest the spermatheca to the point at which the
spermathecal valve closes to envelop the oocytes) on the monitor during
video production. Distance was calibrated on each set-up to convert
centimeters on the monitor to true micrometer values using a stage
micrometer. For ovulation movies, VHS video recordings were dubbed onto
DVCAM digital tapes, captured as computer DV stream files via fire
wire, and then the frame speed increased by 900% using the software
program Final Cut Pro (Apple Computer, Cupertino, California).
Video compression for Internet playback was performed using the Cleaner
5 Software Application (Autodesk/Discreet Logic Inc., Montreal,
Quebec). Still-frame images (720 × 480 pixels) were grabbed from
the ovulation computer-captured DV stream file (Digital Media Center,
Caltech, Pasadena, California).
For fluorescent microscopy, animals were viewed with ×100 objective under a green fluorescent protein (GFP) filter. Images were collected using a digital camera (C4742-95; Hamamatsu, Middlesex, New Jersey), transferred to a computer (G3 Macintosh; Apple Computer, Cupertino, California) running Open Lab Imaging 1.7.8r3 Software (Improvision, Coventry, England, and assembled in Photoshop (Adobe Systems, Mountain View, California).
ipp-5 cDNA Sequence Analysis
A full-length cDNA, yk341d7, kindly provided by Yuji Kohara
(expressed sequence tag partial sequence GenBank accession
C44206), was sequenced on both strands and compared with the wild-type ipp-5 genomic sequence from the Sequencing Consortium (The
C. elegans Sequencing Consortium, 1998
) to obtain the
splicing pattern. Genefinder predicts a slightly different cDNA
(WormBase WS51) than the full-length cDNA we sequenced (GenBank
accession AF411588). One base pair was found missing in exon 2 in the
cDNA clone yk341d7, creating a frameshift premature stop codon. Genomic
DNA amplified from N2 worms was sequenced on both strands and matched
the sequence provided by the Consortium, indicating the mutation in the
cDNA was an artifact. The mutation was repaired using a QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, California), yielding mut2IP5. Sequencing confirmed the mutation was corrected and
that no other artifactual mutations occurred in the cDNA.
Construction of Transgenes
Standard molecular biology techniques were used (Sambrook
et al., 1989
). To examine the ipp-5 expression
pattern, a 2-kb sequence upstream of the ATG, including exon 1, was
amplified from genomic N2 DNA (using high-fidelity LA Takara
Taq) and cloned into the pGEM TA cloning vector and then
subcloned into the GFP expression vector pPD95.77 (A. Fire) with MluNI
and Kpn sites, yielding pYB10. The entire ipp-5 locus was
amplified from N2 genomic DNA and was subcloned into pPD49.83 (A. Fire)
at the Kpn/EcoRV site, yielding pYB8. The entire
ipp-5 genomic region was sequenced, and no extraneous mutations were found. A 2-kb sequence upstream of the start ATG codon
was subcloned in place of the HS promoter at the MluNI and Kpn sites of
pYB8, yielding pYB11 to test if the native promoter driving expression
of the genomic ipp-5 locus rescues the sy605 phenotype.
Three constructs using heterologous promoters driving
the ipp-5 cDNA were generated. A 1.0-kb region upstream of
ZK370.3 was amplified from pCeh (kindly provided by A. Parker) using
primers SphpCeh (5' CCCGCATGCCTGCAGTTCTCCTCTCTG CC) and KpnpCeh
(5' CCCCGGTACCAAAAAAATTAATTTTTTTGGGGGC) and was cloned into pPD49.83
(A. Fire) at the MluN and Kpn site. A BamHI/Asp718
fragment containing the pCeh promoter was then subcloned into
vector mut2IP5 with BamHI and EcoRI/blunted
sites, yielding pYB13. The promoter was sequenced to verify that no
additional mutations occurred during amplification. We examined
dpy-5(e905) hIs29[pCeh361; pCeh363] (kindly provided by A. Parker), which carries the pCeh::GFP transgene, and we
confirmed that the pCeh promoter shows expression in the adult
spermatheca and not the sheath (A. Parker, personal communication). For
pYB14, the entire cDNA from mut2IP5 was subcloned into the heat shock
vector pPD49.83 (A. Fire) at the Nhe/Kpn site. For pYB15, a 3-kb
nlp-8 promoter (Nathoo et al., 2001
), which
expresses in the sheath (Anne Hart, personal communication), was
amplified using primers AN46 (5' GAAGCTTCTGACTCATGTCGC) and
BamHIAN49 (5'
CCGCGGATCCTGCATGCATTACTGTATTCAAAATTACGGTG) from genomic DNA
and was subcloned into mut2IP5 using BamHI and EcoRI/blunted sites. We examined the strain him-5;
lin-15(n795) rtEx22[nlp-8::GFP, lin-15(+)] (kindly
provided by A. Hart) and confirmed expression in the proximal sheath
cells and not in the spermatheca (Anne Hart, personal communication).
Construction of Transgenic Strains
Transgenic strains were generated as described by Mello et
al. (1991)
. To assess whether the genomic ipp-5 locus,
including the 2-kb 5' sequence upstream of the ATG, rescues the
phenotype in sy605 animals, we injected pYB11 along with
myo-2::gfp as a transformation marker. Rescue of
ipp-5(sy605) was determined by scoring the ovulation
phenotype of three lines under Nomarski optics and recording ovulations
of transgenic ipp-5(sy605) syEx[pYB11; myo-2::gfp] worms. We observed one ovulation event in
each gonad arm per animal. Moreover, sy605 transgenics
containing the heat shock transgene pYB14 and
myo-2::gfp also showed rescue upon induction with
a heat shock pulse of 33°C for 40 min in the young adult stage. The cosmids encompassing ipp-5 did not show the
expected restriction pattern, and thus were not used to assay for
rescue. We built the transgenic strain sy605
syEx[pYB13; myo-2::gfp] to test rescue with
a heterologous spermathecal promoter. Additionally, we built the
transgenic strain sy605 syEx[pYB15; myo-2::gfp]
to test rescue with a heterologous sheath promoter. The
ipp-5::GFP fusion was injected with pRF4
[rol-6(su1006)] as a transformation marker in
sy605 animals or N2 animals to examine the expression pattern. Both transgenic strains show identical expression.
| |
RESULTS |
|---|
|
|
|---|
ipp-5 Encodes a Type I 5-Phosphatase Homolog
To better understand the regulation of IP3
signaling, we sought to identify additional downstream genes involved
in the LET-23 RTK-mediated IP3 signaling pathway
for ovulation in C. elegans (Clandinin et al.,
1998
). Clandinin et al. (1998)
identified lfe-1, an IP3 receptor (IP3R)
homolog, and lfe-2, an IP3K homolog,
as suppressors of lin-3(rf) sterile ovulation defective
mutants, indicating that ovulation is dependent on an evolutionary
conserved IP3 signaling pathway (Figure 1). Video
analysis of lfe-2 mutants shows no obvious ovulation defect
(see Video 1), suggesting the inositol polyphosphate
5-phosphatase, which also metabolizes IP3 in
other systems, may play a critical role inhibiting signaling in
C. elegans ovulation. The C. elegans genome
sequence predicts an ortholog of the human type I inositol
polyphosphate 5-phosphatase (CO9B8.1), which we designate
ipp-5 (The C. elegans Sequencing Consortium,
1998
). We sequenced a full-length ipp-5 cDNA (kindly provided by Y. Kohara) corresponding to this region, and found 11 nucleotides of an SL1 trans-spliced leader and a single open reading
frame (ORF), comprising 7 exons that encode a 400-amino acid protein
42% identical to its human counterpart (Figure
2). The C. elegans IPP-5 lacks
the well-conserved motif (GDLNYRL) present in all members of the type
II 5-phosphatases, as seen in the C. elegans homolog,
C16C2.3 (Figure 2B). However, IPP-5 contains the conserved active site
motif (PAWC/TDRV/ILM) essential for enzymatic activity of all type I
and type II 5-phosphatases (Communi et al., 1996
; Jefferson
and Majerus, 1996
; Majerus, 1996
; Erneux et al., 1998
). On
this basis, we classify IPP-5 as a type I phosphatase. IPP-5 lacks the
C-terminal isoprenylation site CCVVQ present in members of the
5-phosphatase type I family, suggesting that it relies on another
mechanism for targeting to its correct intracellular location.
|
ipp-5 Affects Ovulation and Fertility
To study ipp-5 function, we isolated a deletion mutant, ipp-5(sy605), in which 240 bp upstream of the start codon is deleted through 28 bp of exon 3. We examined ipp-5(sy605) mutant animals for defective ovulation. There are no other obvious visible defects.
In a wild-type hermaphrodite, oocytes align on the proximal-distal
axis of the gonadal sheath and mature in an assembly-line manner as
they proceed proximally toward the spermatheca. Typically, during
ovulation, the sheath contracts and pulls the dilated spermatheca over
the most proximal mature oocyte in the proximal gonad to release it
from the oviduct into the spermatheca (McCarter et al.,
1999
). Animals with defects in ovulation have a reduced brood size. For
example, analysis of Nomarski ovulation videos indicate that
let-23(sa62) RTK gain-of-function (gf) and
dec-4/itr-1 IP3R reduction-of-function
(rf) mutants show mechanical defects in ovulation
[dec-4(sa73), n = 20/20 defective ovulations;
let-23(sa62), n = 12/12 defective ovulations; see
Videos 3 and 4] and have lower broods than wild type (mean brood
121 ± 9 [SD], see Figure 4B, [Dal Santo et al.,
1999
]; let-23(sa62) mean brood 173, range 45-276, n = 24, [Katz et al., 1996
]). In sa62 mutants, the
spermatheca constricts abnormally and tears the ovulated oocyte,
leaving the nucleus behind in the gonad. The defect in sa73
mutants is more pronounced; the basal sheath contraction rate in
sa73 mutants appears reduced relative to wild type, and the
spermatheca dilates and constricts continually during ovulation before
it finally pinches shut, tearing the oocyte and leaving the nucleus
behind. Furthermore, lin-3(rf) or let-23(rf)
mutants are sterile (Aroian et al., 1991
) because they fail
to ovulate (Clandinin et al., 1998
; McCarter et
al., 1999
).
Figure 3 shows a sequential image series
of a wild-type and a sy605 hermaphrodite during ovulation
(see Videos 2 and 5). The deletion mutant shows a novel ovulation
phenotype whereby more than one oocyte is ovulated per cycle. In these
double ovulations, the spermatheca dilates and extends beyond the
proximal oocyte to precociously envelop the second and in some cases
the third oocyte. In sy605, the spermatheca extends on
average 49.1 ± 11.9 µm (n = 18) compared with 33.9 ± 4.7 µm in the wild type (n = 30; p < 0.0001, Fisher's
Exact test). This observation indicates that IPP-5 is required to
prevent excessive spermathecal dilation and extension during ovulation.
|
Prior work by McCarter et al. (1999)
suggests that ovulation
is coupled to oocyte meiotic maturation. In sy605 mutant
animals, along with the proximal oocyte, the secondary oocyte is
ovulated precociously, before the hallmarks of maturation are observed (McCarter et al., 1999
). The presence of the nucleolus and
nuclear envelope in these precocious oocytes indicates they have not
undergone maturation (Figure 4). This
mutant phenotype raises the possibility that there is no absolute
requirement for an oocyte to have undergone maturation to be ovulated.
In ceh-18 mutants, immature oocytes are ovulated but do not
appear to form zygotes (Rose et al., 1997
). In
sy605, the distal oocytes ovulated before maturation are
apparently not fertilized because we have seen oocytes interdigitating
with fertilized multicellular eggs in the uterus (n = 9). Video
analysis of the fate of the secondary oocyte (ovulated precociously)
indicates fertilization and embryogenesis does not ensue, as observed
in the accompanied fertilized primary oocyte (n = 11/11). Taken
together, these results suggest that although meiotic maturation is not required for ovulation, it may be required for fertilization.
|
sy605 homozygotes have a reduced brood of 144 ± 20 (n = 25) relative to the wild-type brood of 337 ± 33 (n = 20, p < 0.001; Table 1). Animals
heterozygous for the deletion have a slightly reduced brood size
(314 ± 36; n = 20) relative to wild type (p = 0.0437;
Table 1). Heterozygotes ovulate one oocyte/cycle (n = 54) as do
wild type, indicating the double ovulation phenotype is recessive.
|
To confirm that the deletion in the ipp-5 locus causes the
observed ovulation defect, we tested whether a transgene containing the
full-length wild-type genomic ipp-5 locus, including the
2-kb sequence upstream of the start ATG codon, could complement the defect in sy605 transgenic animals. In sy605
animals, the ovulation defect is fully penetrant on a per animal basis
(n = 15/15 animals double ovulate); however, looking at successive
ovulations in animals, we observe that every ovulation event is not
mutant (49% of gonad arms ovulate one oocyte/cycle, n = 70; Table
2B). Transgenic sy605 animals
bearing the ipp-5 genomic locus as an extrachromosomal array
showed rescue in all three lines examined (Table 2A). Thus, the
ovulation defect is likely the result of the deletion, which removes
ipp-5 function, because the phenotype can be rescued by adding back wild-type copies of the ipp-5 gene. It is
conceivable that the next in-frame methionine downstream of the
deletion, but upstream of the catalytic domain, initiates protein
synthesis producing a protein. This protein, which lacks the N-terminal region, might result in altered protein activity, and thus the deletion
might result in a gf phenotype. However, we think this possibility is
inconsistent with our rescue data and our genetic epistasis and
interaction data in which ipp-5(sy605) behaves as a stronger
version of lfe-2, which is a loss-of-function (see below).
Thus, the simplest interpretation of the data is that ipp-5(sy605) is a loss-of-function mutation. Based on our
mutant phenotype, we infer that IPP-5 likely regulates
IP3 signaling, which modulates spermathecal
dilation/contraction.
|
IPP-5 Acts in the Adult Spermatheca
To investigate where ipp-5 might function, we examined
the expression of a ipp-5::GFP transcriptional
reporter. A 2-kb fusion of 5' sequence directed expression in the adult
distal spermatheca and weakly in the proximal sheath in transgenic
animals (Figure 5). This same promoter
sequence driving the genomic ipp-5 locus is sufficient to
rescue the defect in sy605 transgenic animals (Table 2A). To
test whether expression in the spermatheca is sufficient for rescuing
the ovulation defect, we used a heterologous spermathecal promoter
(kindly provided by A. Parker) to drive expression of the
ipp-5 cDNA. We observed rescue of the ovulation defect in
two transgenic sy605 lines observed. In sy605
animals, 51% of the gonad arms examined were mutant where more than
one oocyte was ovulated per cycle, whereas 33% mutant gonad arms were observed in sy605 animals bearing the transgene as an
extrachromosomal array (p < 0.0246). In a second line, 20% of
the gonad arms were mutant (p = 0.0002; Table 2B). Thus,
expression of the transgene led to significantly more animals with
normal ovulation, indicating that expression of ipp-5 in the
spermatheca is sufficient to rescue the ovulation defect. Although
ipp-5::GFP expression is also detected in the
vulva and isthmus of the pharynx throughout larval development and
adulthood, we think it unlikely that expression in these tissues affects the spermathecal contraction behavior. Transgenic
sy605 worms injected with a transgene containing a sheath
promoter (kindly provided by A. Hart) driving the ipp-5 cDNA
did not show rescue of the ovulation defect in four lines observed
(Table 2B). Together with the expression data, we infer
ipp-5 likely functions within the adult spermatheca to
regulate ovulation.
|
We did not observe expression of the ipp-5::GFP
reporter transgene before adulthood in the spermatheca, suggesting the
function of ipp-5 is needed in the adult spermatheca for
ovulation rather than for the development or specification of the
sheath and spermatheca lineages, which occurs in the L4 larval stage
(Kimble and Hirsh, 1979
). We observed L4 stage sy605
hermaphrodites under Nomarski optics and found that they had normal
spermathecae and proximal sheath: The numbers of spermathecal cells
were normal, and there was no obvious abnormality in spermathecal
morphogenesis or in the proximal ovarian sheath (n = 13). To
determine if expression of ipp-5 in adult stage is
sufficient for its function in ovulation, we examined whether using a
heat shock promoter driving the ipp-5 cDNA to induce
expression in sy605 adults is sufficient to rescue the
ovulation defect. In two lines observed, induced expression of
ipp-5 function in adults was sufficient to rescue the double ovulation phenotype in transgenic sy605 worms: line 1, 22%
mutant gonad arms after heat shock vs. 53% mutant gonad arms in
control transgenic animals with no heat shock, p = 0.0005;
line 2, 26% mutant gonad arms after heat shock vs. 49% mutant
gonad arms in control transgenic animals with no heat shock,
p = 0.0123 (Table 2C). We conclude that IPP-5 activity is not
required before the L4 larval stage for its function in ovulation. The
temporal and spatial regulation of ipp-5 is consistent with
its regulatory function during adult ovulation rather than in
developmental processes that secondarily affect dilation.
ipp-5 Suppresses the Sterility of lin-3 and let-23
LIN-3 has been proposed to activate LET-23 and an
IP3 signaling pathway (Clandinin et
al., 1998
) that regulates ovulation. This pathway comprises
lin-3, let-23, lfe-1, and lfe-2 encoding an
epidermal growth factor (EGF)-like growth factor, EGFR,
IP3R, and IP3K,
respectively (Figure 1). lin-3(rf) and
let-23(rf) mutants are sterile, producing no
progeny because they fail to ovulate. These mutants have an Emo
phenotype in which the oocytes become trapped in the gonad arm and
undergo multiple rounds of DNA synthesis (Clandinin et al.,
1998
; McCarter et al., 1999
). A gf mutation in
lfe-1 IP3R or a loss-of-function
mutation in lfe-2 IP3K can bypass the
requirement for wild-type levels of LET-23 activity: lin-3(rf);
lfe or let-23(rf); lfe double mutants are fertile
(Clandinin et al., 1998
). We tested whether the C. elegans IPP-5 functions downstream of LET-23 RTK and can suppress
the sterility of either lin-3(rf) or let-23(rf).
lin-3(n1058), which affects vulva induction and fertility, has an
average brood size of 0.2 ± 1.8 (n = 76). In contrast,
lin-3(n1058); ipp-5(sy605) double mutants are 98.7% fertile
(n = 319), having an average brood size of 28 ± 9, n = 47 (Table 1); an allele of lin-3, n378, which affects only
vulva induction (causing a vulvaless phenotype where the animals are unable to lay eggs), has an average brood size of 72 ± 11, n = 17 (Clandinin et al., 1998
). Similarly, ipp-5
suppresses let-23(rf), as 100% of let-23(sy10);
ipp-5(sy605) double mutants are fertile (n = 21; Table 1).
Because sy605 can suppress the sterile defect of
lin-3 as well as let-23, we conclude that
ipp-5 functions downstream of lin-3 and
let-23 to mediate ovulation.
ipp-5 Synergizes with Other Genes in the let-23-mediated Fertility Pathway
We next examined genetic interactions of ipp-5 with
known components of the fertility pathway. lfe-1/itr-1(gf)
or lfe-2(lf) single mutants have a slightly reduced brood
size and ovulate normally (Clandinin et al., 1998
).
ipp-5 synergizes with either lfe-1(gf) or
lfe-2(lf) to produce a synthetic sterile Emo phenotype (Figure 3) similar to that observed in lfe-1(gf); lfe-2(lf)
double mutants (Clandinin et al., 1998
) where the
spermatheca fails to dilate sufficiently. lfe-1(sy290);
ipp-5 double mutants have an average brood of 6 ± 12 (n = 55) compared with lfe-1(sy290), which has an average of
207 ± 35(n = 26). lfe-2(sy326) has a brood of 213 ± 34 (n = 23), whereas lfe-2(sy326); ipp-5
double mutants are sterile, producing no progeny (n = 86; Table
1). The data indicate that ipp-5 interacts with both
lfe-1/itr-1 and lfe-2 and that it likely
functions in the adult spermatheca to regulate the fertility pathway
during ovulation. Consistent with this hypothesis, all three proteins
are expressed in the adult spermatheca (Clandinin et al.,
1998
; Dal Santo et al., 1999
; Gower et al.,
2001
).
ipp-5(sy605) exhibits a semidominant synergistic effect in a sensitized background. Analysis of ovulation videos show that although sy605/+ heterozygotes and lfe-1 or lfe-2 single mutants do not double ovulate, sy605 heterozygotes that are also homozygous for lfe-2 double ovulate and are fertile (n = 17). Similarly, sy605 heterozygotes that are also homozygous for lfe-1 are fertile and double ovulate (n = 10). sy605 synergizes with lfe-1 and lfe-2 mutations in a dose-sensitive manner, because removing two copies of ipp-5 has more severe affects than removing a single copy. The Emo phenotype observed in the lin-3(rf) or let-23 (rf) single mutant and double mutant ipp-5; lfe-1 or ipp-5; lfe-2 suggests that IP3 signaling levels are critical for normal hermaphrodite ovulation and fertility. From our study on ipp-5 mutant phenotypes, we infer that IPP-5 inhibits IP3 signaling after activation to ensure that ovulation occurs properly.
To further examine the affects of varying IP3
signaling on ovulation, we examined double mutants of ipp-5
with a gf allele of let-23(sa62) RTK (Katz et
al., 1996
). sa62 animals have a reduced brood, which
may in part be attributed to the sickness of the homozygotes (average
brood 173, range 24-276 progeny, n = 24; Katz et al.,
1996
), and an ovulation defect where the spermathecal valve contracts
prematurely, closing and tearing the oocyte as it enters (n = 12;
see Video 4). ipp-5 also synergizes with sa62, causing a further reduction in brood size (average brood 7; range 0-27
progeny; n = 31). In these double mutants, the spermatheca extends
beyond the proximal oocyte to the second oocyte, but it then retracts
and has problems ovulating the proximal oocyte, eventually causing an
Emo phenotype (n = 8). Precise control of IP3 levels appears to be crucial in vivo for
proper spermathecal dilation. Thus, both insufficient and excessive
IP3 signaling cause defective ovulation.
IPP-5 and LFE-2 Have Different Roles in Regulating IP3 Signaling
Both the 5-phosphatase and 3-kinase metabolize
IP3; however, their respective contributions in
negatively regulating IP3 signaling are unclear.
Clandinin et al. (1998)
showed that lfe-2(sy326) mutation disrupts kinase activity because it failed to phosphorylate IP3 in an in vitro kinase assay. The point
mutation in lfe-2 and the deletion in ipp-5 are
probably loss-of-function mutations. We examined the ovulation
phenotype of both these alleles by Nomarski video analysis (see Videos
1 and 5). Although lfe-2(lf) mutants display a reduced brood
size, video analysis shows no obvious defects in ovulation (n = 22), unlike ipp-5(sy605). Strikingly, these genes, both of
which likely regulate IP3 levels, have
qualitatively different loss-of-function phenotypes. We infer that
IPP-5 and LFE-2 are both critical for ovulation, but act differently to regulate it. We observe no effect with misexpression of IPP-5 in
wild-type worms (unpublished observations); however,
misexpression of LFE-2 using a heat shock promoter causes the
spermatheca to relax inappropriately (Clandinin et al.,
1998
). The existence of multiple proteins that differentially inhibit
IP3 signaling highlight the importance of
maintaining fine control of IP3 signaling in ovulation.
| |
DISCUSSION |
|---|
|
|
|---|
In an attempt to better understand how IP3
signaling downstream of the LET-23 RTK pathway affects ovulation and
fertility, we have generated and characterized a deletion mutant of the
C. elegans type I inositol polyphosphate
5-phosphatase. ipp-5(sy605) homozygous mutants have reduced
fertility and a novel ovulation phenotype whereby the spermatheca
dilates and extends abnormally. Epistasis analyses place
ipp-5 downstream of let-23. Two mutant loci have
previously been identified that can bypass LET-23 RTK function,
let-23 fertility effectors, lfe-1(gf)/itr-1, an
IP3R homolog, a positive effector, and
lfe-2(lf), an IP3K, a negative effector (Clandinin et al., 1998
). ipp-5(sy605)
enhances lfe-1(gf) and lfe-2(lf)
mutants, causing sterility. Our transgenic rescue data
(Table 2) and reporter GFP expression data (Figure 5) are consistent
with IPP-5 directly controlling contraction and dilation behavior in
the adult spermatheca (Figure 1).
Contributions of the 5-Phosphatase and IP3K and Negative Regulation of IP3 Signaling
We observed that the C. elegans 5-phosphatase deletion
mutant, ipp-5(sy605), and the IP3K
mutant, lfe-2(lf), have qualitatively different ovulation
phenotypes. The double ovulation phenotype of ipp-5 probably
results from increased IP3 signaling upon
removing IPP-5 function. Consistent with this, cell lines that stably
underexpress a type I 5-phosphatase have a sustained 2.6-fold elevation
in IP3, leading to enhanced intracellular calcium
oscillations and cellular transformation (Speed et al.,
1996
, 1999
; Speed and Mitchell, 2000
). By contrast,
lfe-2(lf) shows no noticeable ovulation defect in C. elegans. We infer that eliminating activity of either gene allows
IP3 to accumulate to different levels, resulting
in the two distinct phenotypes and suggesting that they have distinct negative regulatory roles within the context of ovulation. Studies of
IP3 metabolism in Xenopus oocytes
indicate that at low [IP3] and high
[Ca2+], IP3 is
metabolized predominantly by IP3K, whereas as
[IP3] increases, the 5-phosphatase degrades
progressively more IP3, irrespective of the
[Ca2+] (Sims et al., 1996
).
Multiple enzymes that metabolize IP3 imply that
tight regulation of IP3 is essential for ensuring
proper spermathecal dilation/relaxation during ovulation. In C. elegans, elevated IP3 signaling affects
spermathecal dilation, and IPP-5 is critical for inhibiting signaling
for contraction.
Ovulation Is Regulated by IP3 Signaling Levels
Cell culture studies have shown that the mammalian 5-phosphatase
and IP3K metabolize IP3
into either IP2 or IP4,
respectively (Irvine et al., 1986
; Berridge and Irvine,
1989
). Simultaneously removing ipp-5 activity and
lfe-2 activity should create a situation where
IP3 accumulates and exerts negative feedback
inhibition, which blocks further ovulation.
We interpret the effects on spermathecal dilation in the lfe-2;
ipp-5 mutant as being mediated through either too low or
excessively high levels of IP3 signaling.
Moreover, a double mutant with ipp-5 and sa62, a
gf allele of let-23 RTK (Katz et al., 1996
) that
has hyperactive signaling, also shows the same ovulation defect,
further demonstrating the inhibitory effects of excessive
IP3 signaling. Cell culture studies have shown
that EGF stimulates IP3 production and a rise in
intracellular calcium (Hepler et al., 1987
). An activating
mutation in LET-23 RTK likely results in higher levels of second
messenger IP3 production. We presume that the
cooperative effect of removing IPP-5 in the gf LET-23 mutant
dramatically increases IP3 signaling, which
prevents ovulation causing the Emo phenotype.
Examining the spermatheca in these mutants allows us to see a more direct physiological effect of perturbing IP3 signaling in vivo. There appears to be a biphasic phenotypic effect on the extent of spermathecal dilation and extension with increasing levels of IP3 signaling in C. elegans. In lin-3(rf) and let-23(rf) mutants with reduced EGF signaling, IP3 signaling is not sufficient for the spermatheca to dilate. In ipp-5 mutants where IP3 signaling is higher, the spermatheca dilates and extends farther than in the wild type to ovulate the proximal mature oocyte along with the secondary distal oocyte, which has not undergone meiotic maturation. One explanation for this observation is that in sy605, the proximal oocyte, which has undergone meiotic maturation, triggers the spermatheca to dilate. The secondary distal oocyte is passively ovulated precociously, as a consequence of the spermatheca extension beyond the proximal oocyte due to increased IP3 signaling.
Further elevations in IP3 signaling in various
double mutants prevent spermatheca dilation. IP3
positively effects gating of IP3R, but has also
been shown along with calcium to exert negative feedback, which may
explain this phenotype (Berridge, 1993
; Ehrlich and Watras, 1988
;
Besprozvanny et al., 1991
). Multiple layers of regulating
intracellular calcium release allows fine control of many cellular processes.
LET-23 RTK-induced activation of IP3 signaling,
which promotes spermatheca dilation likely through its effect on
calcium release, is reminiscent of arterial smooth muscle relaxation
and arterial dilation by calcium sparks (Nelson et al.,
1995
). The structural architecture of the myoepithelial sheath and
spermatheca resemble smooth muscle. Longitudinal interdigitated thick
and thin filaments make up the sheath. Actin stains the spermatheca,
revealing circumferentially arranged fibers (Strome, 1986
) that may
undergo peristaltic vasoconstrictive and dilatory behavior like that of
epithelial smooth muscle. The tension from the contracting sheath pulls
the dilated spermatheca over the proximal oocyte during ovulation
(McCarter et al., 1999
). Decreases in
IP3 signaling may trigger contraction and closure of the distal spermatheca valve so that only one oocyte is enveloped. A
peristaltic wave of contraction may carry the oocyte from the distal
spermatheca valve through the proximal spermathecal valve into the uterus.
Ovulation is a regulated behavior requiring coordination of the epithelial smooth muscle-like spermatheca and sheath. Animals with defective ovulation have reduced fertility, thus proper regulation of ovulation is important for normal fertility. During ovulation, we propose IPP-5 is necessary to prevent spermathecal hyperextension by negatively regulating IP3 signaling downstream of RTK, thereby ensuring proper spermathecal dilation and contraction behavior.
| |
ACKNOWLEDGMENTS |
|---|
We thank Y. Hadju-Cronin, J. Copeland, and B. Bingol for help isolating sy605; Y. Kohara for cDNA; J. Thomas for sa62 and sa73; A. Fire for GFP and HS vectors; A. Parker for the pCeh promoter and strain KR3738; A. Hart for the nlp-8 promoter and strain PT4; L.R. Garcia, E. Schwarz, other members of our laboratory, and an anonymous reviewer for valuable discussion and comments on the manuscript; and L. Maxfield (Caltech Digital Media Center) for help making web movies. The Caenorhabditis Genetics Center provided some strains. This project was supported by the Howard Hughes Medical Institute, with which P.W.S is an investigator. Y.K.B. is a National Institutes of Health trainee supported by National Institutes of Health grant 5T32GM07737.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: pws{at}caltech.edu.
Online version of this article contains video material. Online
version available at www.molbiolcell.org.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.02-01-0008. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.02-01-0008.
| |
ABBREVIATIONS |
|---|
Abbreviations used: EGF, epidermal growth factor; gf, gain-of-function; GFP, green fluorescent protein; IP3, inositol 1,4,5 triphosphate; IP3K, IP3 3-kinase; IP3R, IP3 receptor; ORF, open reading frame; PCR, polymerase chain reaction; rf, reduction-of-function; RTK, receptor tyrosine kinases.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Deng, D. Xia, B. Fang, and H. Zhang The Flightless I Homolog, fli-1, Regulates Anterior/Posterior Polarity, Asymmetric Cell Division and Ovulation During Caenorhabditis elegans Development Genetics, October 1, 2007; 177(2): 847 - 860. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lorin-Nebel, J. Xing, X. Yan, and K. Strange CRAC channel activity in C. elegans is mediated by Orai1 and STIM1 homologues and is essential for ovulation and fertility J. Physiol., April 1, 2007; 580(1): 67 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Lloyd-Burton, J. C. H. Yu, R. F. Irvine, and M. J. Schell Regulation of Inositol 1,4,5-Trisphosphate 3-Kinases by Calcium and Localization in Cells J. Biol. Chem., March 30, 2007; 282(13): 9526 - 9535. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yan, J. Xing, C. Lorin-Nebel, A. Y. Estevez, K. Nehrke, T. Lamitina, and K. Strange Function of a STIM1 Homologue in C. elegans: Evidence that Store-operated Ca2+ Entry Is Not Essential for Oscillatory Ca2+ Signaling and ER Ca2+ Homeostasis J. Gen. Physiol., October 1, 2006; 128(4): 443 - 459. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Thompson, L. B. Lamont, and J. Kimble Germ-line induction of the Caenorhabditis elegans vulva PNAS, January 17, 2006; 103(3): 620 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Espelt, A. Y. Estevez, X. Yin, and K. Strange Oscillatory Ca2+ Signaling in the Isolated Caenorhabditis elegans Intestine: Role of the Inositol-1,4,5-trisphosphate Receptor and Phospholipases C {beta} and {gamma} J. Gen. Physiol., September 26, 2005; 126(4): 379 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yin, N. J.D. Gower, H. A. Baylis, and K. Strange Inositol 1,4,5-Trisphosphate Signaling Regulates Rhythmic Contractile Activity of Myoepithelial Sheath Cells in Caenorhabditis elegans Mol. Biol. Cell, August 1, 2004; 15(8): 3938 - 3949. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aono, R. Legouis, W. A. Hoose, and K. J. Kemphues PA |