![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 6, 2132-2146, June 2002

and
§
Departments of *Biochemistry,
Medicine, and
Oncology, Molecular Oncology Group, McGill
University Health Centre, Montreal, Quebec, Canada H3A 1A1
| |
ABSTRACT |
|---|
|
|
|---|
The Gab family of docking proteins (Gab1 and Gab2) are phosphorylated in response to various cytokines and growth factors. Gab1 acts to diversify the signal downstream from the Met receptor tyrosine kinase through the recruitment of multiple signaling proteins, and is essential for epithelial morphogenesis. To determine whether Gab1 and Gab2 are functionally redundant, we have examined the role of Gab2 in epithelial cells. Both Gab1 and Gab2 are expressed in epithelial cells and localize to cell-cell junctions. However, whereas overexpression of Gab1 promotes a morphogenic response, the overexpression of Gab2 fails to induce this response. We show that Gab2 recruitment to the Met receptor is dependent on the Grb2 adapter protein. In contrast, Gab1 recruitment to Met is both Grb2 dependent and Grb2 independent. The latter requires a novel amino acid sequence present in the Met-binding domain of Gab1 but not Gab2. Mutation of these residues in Gab1 impairs both association with the Met receptor and the ability of Gab1 to promote a morphogenic response, whereas their insertion into Gab2 increases Gab2 association with Met, but does not confer on Gab2 the ability to promote epithelial morphogenesis. We propose that the Grb2-independent recruitment of Gab proteins to Met is necessary but not sufficient to promote epithelial morphogenesis.
| |
INTRODUCTION |
|---|
|
|
|---|
Hepatocyte growth factor (HGF) is a mesenchymally derived factor
with pleiotropic activities. In vivo, HGF stimulates cell proliferation
and survival, as well as cell dispersal, motility, and a morphogenic
program in a wide range of cellular targets, including epithelial,
endothelial, and hematopoietic cells, and neurons (reviewed in Gherardi
and Stoker, 1991
; Michalopoulos, 1995
; Zarnegar and Michalopoulos,
1995
). These effects are fundamental for the diverse biological
functions of HGF observed in vivo, including embryogenesis,
organogenesis, angiogenesis, tissue regeneration, axonal outgrowth,
wound healing, and invasion by tumor cells (reviewed in Rosen et
al., 1994
; Jeffers et al., 1996
; Birchmeier and
Gherardi, 1998
).
The biological responses to HGF are mediated by its cell surface
receptor, the Met tyrosine kinase. To characterize signaling pathways
downstream of the Met receptor involved in epithelial morphogenesis, we
have used chimeric colony-stimulating factor (CSF)-Met receptors, where
the extracellular domain of Met was replaced with that of the CSF-1
receptor. These approaches have demonstrated that the Met receptor
cytoplasmic domain is sufficient for the biological responses
attributed to HGF and that Met tyrosine kinase activity is required for
these responses (Komada and Kitamura, 1993
; Weidner et al.,
1993
; Zhu et al., 1994b
). Two tyrosines in the C terminus
(1349 and 1356) of Met are crucial for the induction of branching
morphogenesis in epithelial cells (Zhu et al., 1994a
; Fournier et al., 1996
; Weidner et al., 1996
).
Tyrosine 1356 forms a multisubstrate binding site, coupling the Met
receptor directly with the Grb2 and Shc adapter proteins, and
indirectly with the Gab1 docking protein and the Cbl ubiquitin ligase
(Ponzetto et al., 1994
; Fixman et al., 1996
,
1997
; Fournier et al., 1996
; Bardelli et al.,
1997
; Nguyen et al., 1997
), whereas tyrosine 1349 contributes to the direct recruitment of the Gab1 docking protein to
Met (Weidner et al., 1996
). Met receptor mutants
specifically lacking the ability to recruit the Grb2 adaptor protein
(N1358H) fail to elicit a morphogenic response (Fournier et
al., 1996
). This Met receptor mutant has a decreased association
with the docking protein Gab1, and overexpression of Gab1 in these
cells rescues the morphogenesis defect, thereby identifying Gab1 as an
essential mediator of Met receptor-induced epithelial morphogenesis
(Maroun et al., 1999a
).
Gab1 (Grb2-associated binder 1) was originally identified as a Grb2
binding protein from a glioblastoma tumor-derived cDNA library
(Holgado-Madruga et al., 1996
). The Gab family of docking proteins, including Gab1, Gab2, Gab3, Daughter of Sevenless, and Suppressor of Clear-1, belong to a group of docking proteins, including
insulin receptor substrates 1-4, downstream of kinases 1-5, and
fibroblast growth factor receptor substrate 2 (FRS2) (Herbst et
al., 1996
; Holgado-Madruga et al., 1996
; Raabe et
al., 1996
; Carpino et al., 1997
; Kouhara et
al., 1997
; Yamanashi and Baltimore, 1997
; Yenush and White, 1997
;
Gu et al., 1998
; Jones and Dumont, 1998
; Lemay et
al., 2000
; Grimm et al., 2001
; Schutzman et
al., 2001
; Wolf et al., 2002
). These proteins lack
enzymatic activities, but after activation of receptor tyrosine
kinases, cytokine receptors, and G protein-coupled receptors, they
become phosphorylated on tyrosine residues, providing binding sites for multiple proteins involved in signal transduction. In this manner, they
act to potentiate and diversify the signals downstream from receptors
by virtue of their ability to assemble multiprotein complexes.
Gab1 is the major phosphorylated protein downstream of the Met receptor
in epithelial cells (Nguyen et al., 1997
). After stimulation with HGF, Gab1 couples with the p85 subunit of
phosphatidylinositol 3-kinase (PI3-kinase), and the majority of
Met-dependent PI3 kinase activity is associated with Gab1 (Maroun
et al., 1999a
). In response to HGF, Gab1 also associates
with phospholipase C (PLC)-
1, the tyrosine phosphatase
SHP-2, the adapter protein Crk (Garcia-Guzman et
al., 1999
; Maroun et al., 1999a
; Gual et
al., 2000
; Lamorte et al., 2000
; Sakkab et
al., 2000
) and acts to recruit these signaling proteins to the Met
receptor (Maroun et al., 1999a
). The Gab1-dependent recruitment of SHP-2 is required for sustained mitogen-activated protein kinase (MAPK) activity and epithelial morphogenesis downstream from the Met receptor (Maroun et al., 2000
). Gab1 contains
an amino-terminal pleckstrin homology (PH) domain that binds PIP3 in a
PI3-kinase-dependent manner (Isakoff et al., 1998
; Maroun et al., 1999b
; Rodrigues et al., 2000
). This
association is required for localization of Gab1 at cell-cell junctions
in epithelial cells and for Gab1-dependent morphogenic responses
(Maroun et al., 1999b
). Gab1 also contains two binding sites
for the C-terminal Src homology 3 (SH3) domain of Grb2 (Lock et
al., 2000
; Schaeper et al., 2000
; Lewitzky et
al., 2001
).
Gab1 is recruited to the Met receptor by both indirect and direct
mechanisms. Gab1 associates constitutively with the C-terminal SH3
domain of the adapter protein Grb2, allowing for the recruitment of
Gab1 via the interaction of the SH2 domain of Grb2 with Y1356 of the
Met receptor (Bardelli et al., 1997
; Fixman et
al., 1997
; Nguyen et al., 1997
). However, deletion of
the Grb2 SH3 domain binding sites in Gab1, uncoupling Gab1 from Grb2,
does not inhibit the ability of Gab1 to rescue morphogenesis (Lock
et al., 2000
). This implies that Gab1 can also be recruited
to Met in a Grb2-independent manner and provides physiological support
for yeast two-hybrid studies and in vitro association assays,
indicating that Gab1 can associate directly with the Met receptor
through tyrosines 1349 and 1356 (Weidner et al., 1996
;
Nguyen et al., 1997
). The Grb2-independent interaction
requires the proline-rich Met binding domain (MBD) of Gab1, which may
represent a novel type of phosphotyrosine binding domain (Weidner
et al., 1996
).
A Gab1-related protein, Gab2, was identified recently (Gu et
al., 1998
; Nishida et al., 1999
; Zhao et
al., 1999
). Gab1 and Gab2 have highly homologous PH domains;
contain tyrosine residues within a consensus for recruitment of p85,
SHP-2, and Crk (Gu et al., 1998
; Pratt et al.,
2000
; Crouin et al., 2001
); and share conserved Grb2 SH3
domain binding sites (Lock et al., 2000
; Schaeper et
al., 2000
). They are both phosphorylated upon epidermal growth factor (EGF), interleukin-6, interleukin-3, thrombopoietin, and erythropoietin stimulation, as well as T-cell receptor
engagement (Holgado-Madruga et al., 1996
; Gu et
al., 1998
; Nishida et al., 1999
; Wickrema et
al., 1999
; Zhao et al., 1999
; Kong et al.,
2000
; Bouscary et al., 2001
), and have overlapping but
distinct patterns of expression (Gu et al., 1998
; Nishida
et al., 1999
). Studies of knockout mice suggest that both
Gab1 and Gab2 have distinct functions during development; Gab1 is
embryonic lethal and Gab2 is deficient in the allergic response (Itoh
et al., 2000
; Sachs et al., 2000
; Gu et
al., 2001
). However, the contributions of Gab1 and Gab2 to
biological functions downstream from the same receptor have not been evaluated.
We show that both Gab1 and Gab2 are expressed in Madin-Darby canine kidney (MDCK) epithelial cells, show a similar localization to cell-cell junctions, and associate with similar signaling proteins after stimulation with HGF. In spite of this, Gab2, in contrast to Gab1, is unable to rescue the morphogenic program of epithelial cells expressing Met receptor mutants. We have identified amino acids in Gab1 that are absent in Gab2 and are responsible for Grb2-independent association of Gab1 with the Met receptor. We show that these residues are essential for epithelial morphogenesis elicited by Gab1, and when introduced into Gab2 they confer Grb2-independent recruitment of Gab2 to the Met receptor, but are insufficient to allow the rescue of the morphogenic program by Gab2. We propose that the Grb2-independent recruitment of Gab proteins to the Met receptor is necessary but not sufficient to promote epithelial morphogenesis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids and Mutagenesis
Wild-type (WT) Gab1-pCDNA 1.1-HA, Gab1
Grb2, GST-MBD (pGEX
2TK), and GST-MBD
Grb2 were described previously (Lock et
al., 2000
). All mutants were generated with the QuikChange
mutagenesis kit (Stratagene, La Jolla, CA) unless otherwise noted, and
sequenced before use. All primers are written 5' to 3'.
Gab2
Grb2-pEBB-HA was generated by making the mutations
348-355/P500A/R504A in Gab2-bluescriptKS+ by using the following
primers: P518A/R504A-F, GAGATCCAGCCAGCCCCTGTCAACGCAAACCTCAAGCC;
P518A/R504A-R, GGCTTGAG-GT-TTGCGTTGACAGGGGCTGGCTGGATCTC;
348-355-F, CTGGAGATTCAGCGATCGCT-AGTCAGGCAGAAACATC; and
348-355-R, GATGTTTCTGCCTGACTAGCGATCGCTGAATC-TCCAG. Gab2
Grb2 was
then inserted back into the pEBB-HA vector. GST-Gab2MBD
Grb2 was
generated using primers P500A/R504A. The
3P mutation (deletes
prolines 491-493) was generated in WT Gab1, Gab1
Grb2, GST-Gab1MBD,
and GST-Gab1MBD
Grb2 by using the following primers:
491-493-F,
CCTTTGGAATGCAAGTCGC-TCACATGG-GCTTCAGGTCC and
491-493-R
GGACCTGAAGCCCATGTGAGCGACTTGCATTCCAA-AGG. Alanine scanning
mutagenesis on WT Gab1 pCDNA1.1 was performed with the Chameleon
double-stranded mutagenesis kit (Stratagene) by using the following
primers: G487A, GGACCTTTGACTTTTCAAGCTTTGCAATGCGAGTCC-CTCCTCC; R489A,
GGACCTTTGACTTTTCAAGCTTTGGAATGGCAGTCCCTCCTCCTG-CTC; P491A, CTTTTCTTCCTTTGGCATGCGAGTCGCTCCTCCTGCTCATATGG; P492A,
CTTCCTTTGGAATGCGGGTACCTGCTCCTGCTCATATGGGCTTC; and P493A,
CTTCCTTTG-GAATGCGGGTACCTCCTGCTGCTCATATGGGCTTC. The MBD2/MBD1 (484-end)
chimera (Gab2 aa 390-475, Gab1 484-532) was generated by adding in
restriction sites with cohesive ends: XbaI site into Gab2MBD
at nucleotide 1501 (aa 476 Asp to Ser, aa 477 Pro to Arg) and an
NheI site into Gab1MBD at nucleotide 1458 (aa 484 Ser to
Ala). Gab2MBDXbaI-pGEX 4T-1 was digested with
XbaI and PstI, and this fragment was replaced
with the NheI/PstI-digested fragment of
Gab1MBDNheI to destroy the cut site and recreate the original Gab1 amino acid sequence (Ser, Ser). The MBD2/1/2-13aa insert
chimera (Gab1 insert of aa 484-496, replaces aa 476-478 of Gab2) was
generated by creation of an NdeI site in Gab2 at nucleotide
1531 (aa 477 Pro to His, aa 478 Leu to Met). An NdeI site is
found in Gab1 at nucleotide 1491, and MBD2/MBD1 pGEX 4T-1 was digested
with NdeI and PstI and the fragment was replaced the NdeI/PstI-digested fragment from
Gab2MBDNdeI. MBD2/MBD1 (495 to end), which is Gab2 aa
390-484, Gab1 495-532, was created by insertion of the
NdeI/PstI digested fragment of MBD1 into
NdeI/PstI-digested MBD2NdeI pGEX 4T-1 vector.
MBD2/1/2* (Gab1 insert of aa 484-502, replaces aa 476-484 of Gab2)
was generated with MBD2/1/2(484-496) as template, by using the
following primers: 484-502-F,
CTCCTGCTCATATGGGCTTCCGATCGAGTCCACTTCCTA-TTCACAGAGGC; and 484-502-R, GCCTCTGTGAATAGGAAGTGGACTCGATCGGAAGCCCATATGAGCAGGAG. MBD2/1/2*-
3P was generated from MBD2/1/2* with the following primers: 2/1/2
491-F, CTTCCTTTGGAATGCGAGTCGCTCACATGGGCTTCCGATCGAGTCC; and 2/1/2
491-R,
GGACTCGATCGGAAGCCCATGTGAGCGACTCGC-ATTCCAAAGGAAG. MBD2/12*-
Grb2 was generated with the P500A/R504A primers. The full-length Gab2/1/2(484-502), termed Gab2/1/2*, construct was created
in bluecriptKS+ as described above for the MBD2/1/2* construct, and
then placed back into the pEBB-HA vector.
Cell Culture, DNA Transfections, and Whole Cell Extracts
For transient transfections, 293T cells were seeded at 1 × 106/100-mm Petri dish and transfected 24 h
later by the calcium phosphate precipitation method (Wigler et
al., 1979
) with 2 µg of DNA. COS-1 cells were seeded at 8 × 105/100-mm Petri dish and transfected 24 h later with 6 µg of plasmid DNA by a standard DEAE-dextran
precipitation method as described previously (Rodrigues et
al., 1991
). For cotransfections of Met receptor with Gab DNAs, 3 µg of Met receptor DNA and 1 µg of Gab DNA were used. COS-1 and
293T cells were serum starved in 0.1% fetal bovine serum (FBS) for
24 h and harvested in 0.5% Triton X-100 lysis buffer (0.5%
Triton X-100, 50 mM HEPES, pH 8.0, 150 mM NaCl, 10% glycerol, 2 mM
EGTA, 1.5 mM MgCl2, 10 µg aprotinin/ml, 10 µg
leupeptin/ml, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium fluoride,
and 1 mM sodium vanadate). After a 10-min incubation on ice, the
lysates were centrifuged at 13,000 rpm for 10 min. The generation of
MDCK cell lines expressing wild-type CSF-1 Met receptor and mutants
thereof by retroviral infection has been described previously (Zhu
et al., 1994a
; Fournier et al., 1996
). Stable
cell lines expressing WT HA-Gab1, HA-Gab1
Grb2, HA-Gab1
3P, HA-Gab2, HA-Gab2
Grb2, and HA-Gab2/1/2* were generated as described previously (Maroun et al., 1999a
; Lock et al.,
2000
).
Stimulation of MDCK Cells
MDCK cells were seeded at 106/100-mm dish. Twenty-four hours later, they were washed twice with DMEM and then starved for 24 h in 10 ml of DMEM containing 0.02% FBS. HGF was added at 100 U/ml in 2 ml for the indicated time. The cells were immediately lysed on ice in 1 ml of 0.5% Triton X-100 lysis buffer.
Glutathione S-Transferase (GST) Fusion Proteins, In Vitro Association Assays, Immunoprecipitations, and Western Blotting
Fusion proteins were produced in the DH5, or BL 21 gold
Escherichia coli strain, by induction with
isopropyl-1-thio-
-D-galactopyranoside. GST
fusion proteins (0.5-1 µg) immobilized on glutathione-Sepharose beads were incubated with either 300 µg of lysate from 293T cells transiently expressing the Met receptor, or 350 µg of lysate from MDCK cells expressing Gab1 or Gab2, stimulated or not with HGF for 15 min. After rocking in 0.5% Triton X-100 lysis buffer for at least
2 h at 4°C, bound proteins were washed three times with lysis
buffer. Approximately 1 mg of protein was used for immunoprecipitations from 293T or MDCK cell lysates. Immunoprecipitation and Western blotting were performed as described in Maroun et al.
(1999a)
.
Immunofluorescence
MDCK cells overexpressing HA-Gab1 or HA-Gab2 were plated at 1 × 104 for 3 d in DMEM containing 10% serum on glass coverslips in a 24-well dish. For stimulations, 5 × 104 cells were plated overnight in 10% serum-containing medium, washed two times, and serum starved in 0.02% serum for 6 h, and stimulated with 50 U of HGF per milliliter for 15 min. Cells were fixed in 2% paraformaldehyde in phosphate-buffered saline (PBS) for 30 min at room temperature, and washed twice in PBS. Cells were treated for 5 min at room temperature with PBS containing 0.2% Triton X-100. Anti-hemagglutinin (HA) (1:300 in 0.2%Triton-PBS) was added to the cells for 30 min, and after three washes, CY3-conjugated goat anti-mouse IgG (1:2000; Jackson Immunoresearch Laboratories, West Point, PA) was added for 30 min, and the cells were washed three times in 0.2% Triton-PBS and once with water. The glass coverslips were mounted onto slide with Immunofluore medium (ICN, St-Laurent, Quebec, Canada) and visualized with an Axiovert 135 incident-light fluorescence microscope (Carl Zeiss, Thornwood, NY).
Collagen Assays
MDCK cells were resuspended in a collagen matrix as described
previously (Maroun et al., 1999a
). HGF (15 U/ml) or
recombinant CSF rhCSF-1 (50 ng/ml) was added to the medium after 5 d. Quantitation of the morphogenic response was performed as described
previously (Maroun et al., 1999a
).
Antibodies and Reagents
Antibodies against a C-terminal peptide of the human Met
protein were used (Rodrigues et al., 1991
), as well as DL-21
(Upstate Biotechnology, Lake Placid, NY). Anti-phosphotyrosine (4G10)
and anti-Gab1 were purchased from Upstate Biotechnology or RC20H from Transduction Laboratories (Lexington, KY), anti-HA (HA-11) was from
BabCO (Richmond, CA), and anti-GST was from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phosphoMAPK, phosphoJNK, and c-Jun
NH2-terminal kinase (JNK) were obtained from New
England Biolabs (Nepean, Ontario Canada). Rabbit anti-SHP-2 and rabbit
anti-MAPK were kindly provided by Dr. Nicole Beauchemin (McGill Cancer
Centre, Montreal, PQ, Canada), and Dr. John Blenis (Harvard Medical
School, Boston, MA), respectively. HGF and recombinant CSF were
generously provided by Dr. George Van de Woude (Van Andel Research
Institute, Grand Rapids, MI) and Genetics Institute (Boston, MA),
respectively. HA-tagged Gab2, Gab2MBD-pGEX 4T-1, and anti-Gab2 sera
were gifts from Dr. Ben Neel (Beth Isreal-Deaconess Medical Center,
Boston, MA). SH2 domain containing GST fusion proteins was generously provided by Dr. Bruce Mayer (University of Connecticut Health Center,
Farmington, CT) (GST-Crk II SH2); Dr. Tony Pawson (Samuel Lunenfeld Research Institute, Toronto, Ontario, Cananda) (GST-PLC
and GST-p85 SH2); and Dr. Gen-Sheng Feng (Burnham Institute, La Jolla,
CA) (GST-SHP-2).
| |
RESULTS |
|---|
|
|
|---|
Gab1 and Gab2 Show a Similar Localization to Cell-Cell Junctions in MDCK Cells
To assess whether Gab family proteins mediate similar
biological responses, we have examined the functional role of Gab2 in MDCK epithelial cells. Using Gab2 and Gab1 specific sera, we show that
Gab2 is endogenously expressed in MDCK cells, and that Gab2 is
phosphorylated within 5 min after HGF stimulation and is sustained for
at least 2 h, similar to the time course of endogenous Gab1 phosphorylation (Figure 1A). Because both
Gab1 and Gab2 are expressed in MDCK cells and are phosphorylated upon
HGF stimulation, this indicates a potential redundancy of function. To
investigate this possibility, we generated stable cell lines expressing
HA-tagged Gab2. We showed previously that Gab1 is localized to sites of cell-cell attachment in the presence of serum but localizes diffusely to the cytosol after serum starvation (Maroun et al.,
1999a
). In a similar manner to Gab1, Gab2 is localized at sites of
cell-cell contact (Figure 1B). Under serum-starved conditions, both
Gab1 and Gab2 show a similar diffuse localization and are recruited to
the membrane upon HGF stimulation (Figure 1C), indicating that Gab1 and
Gab2 share a similar subcellular distribution.
|
Gab2 Is Tyrosine Phosphorylated at Reduced Levels Compared with Gab1, but Associates with Similar Signaling Proteins
When expressed at similar levels in stable cell lines, an
HA-tagged Gab2 protein is consistently phosphorylated at lower levels than an HA-tagged Gab1 protein (Figure
2A). To address whether Gab2 is
capable of associating with similar signaling proteins as Gab1 after
Met receptor activation, we used cell lines that express Gab2 to levels
higher than Gab1 (highGab2; Figure 2). Under these conditions, Gab1 and
Gab2 show comparable levels of phosphorylation after stimulation of
cells with HGF (Figure 2B, middle panels, and C, top two panels). To
investigate proteins that can associate with Gab1 and Gab2 in MDCK
cells, we performed either coimmunoprecipitation assays to detect
endogenous proteins, or used GST fusion proteins encoding the SH2
domains of signaling proteins known to bind to Gab1 and Gab2 (Nguyen
et al., 1997
; Gu et al., 1998
; Garcia-Guzman
et al., 1999
; Maroun et al., 1999a
; Gual
et al., 2000
; Lamorte et al., 2000
; Pratt
et al., 2000
; Sakkab et al., 2000
; Crouin
et al., 2001
). SHP-2 was identified as a major binding
protein for Gab2 (Gu et al., 1998
), and by
coimmunoprecipitation, both Gab1 and Gab2 associate with endogenous
SHP-2 protein after stimulation of cells with HGF (Figure 2B). GST
fusion protein pull-down assays of cell lysates prepared from the MDCK
cell lines overexpressing Gab1 or Gab2, showed that after HGF
stimulation, Gab2 is able to associate with various SH2
domain-containing fusion proteins, including Crk II, p85, PLC-
, and
SHP-2 (Figure 2C). In addition, after HGF stimulation, cell lines
expressing high levels of Gab2 elicited MAPK and JNK phosphorylation to
similar levels as cell lines expressing Gab1 or parental cells (Figure 2D). Hence, although the level of Gab2 phosphorylation is lower than
that of Gab1, when overexpressed, both Gab1 and Gab2 interact with
similar signaling proteins involved in Met-mediated signaling.
|
Gab2 Overexpression Fails to Rescue Met-dependent Epithelial Morphogenesis
Using chimeric CSF-Met receptor mutants in structure-function
analyses, we demonstrated that receptors that selectively fail to bind
the Grb2 adapter protein (N1358H) fail to promote a morphogenic response in MDCK cells in response to CSF stimulation (Fournier et al., 1996
). The overexpression of WT Gab1 (Maroun
et al., 1999a
), or a Gab1 protein lacking Grb2 binding sites
(Lock et al., 2000
), rescues this morphogenesis defect. To
determine whether Gab1 and Gab2 have similar functions in MDCK cells,
we tested whether overexpression of Gab2 in the N1358H CSF-Met
(Met
Grb2) cell line could rescue the morphogenesis defect upon CSF
stimulation. Multiple stable cell lines that overexpress Gab2 in the
CSF-Met
Grb2 cell line were isolated, and expression levels of
representative lines are shown in Figure
3A. When tested for their ability to
rescue epithelial morphogenesis, cell lines expressing low levels of
Gab2 (i.e., Gab2-B3 and Gab2-H1; Figure 3A) were unable to rescue
tubulogenesis upon stimulation, where cells remained as cysts, similar
to the vector control (Figure 3, B and C). In cell lines expressing 5 to 7 times more Gab2 than Gab1 (i.e., Gab2-C1 and C9; Figure 3A), a few
cysts (<10%) were able to form elongated tubule-like structures. These, however, had a simple structure, in contrast to the complex, branched tubules formed in cells overexpressing Gab1 (Figure 3B) (Maroun et al., 1999a
). The majority of the cysts derived
from cell lines expressing high levels of Gab2 showed either no
response or a partial response (Figure 3B). A partial response is
defined as any structure that is no longer a cyst, but whose length is <5 times its width and is unbranched. These results demonstrate that
even when overexpressed at higher levels than Gab1, Gab2 promotes only
a minor morphogenic response. This response is insignificant compared
with cells expressing Gab1, where branching tubule formation is ~80%
(Figure 3C; Maroun et al., 1999a
). Importantly, all cell lines elicited a morphogenic response after stimulation with HGF, indicating that the signals required for this response are intact (our
unpublished data). These results indicate that Gab2 and Gab1 are
not functionally redundant in MDCK cells.
|
To evaluate the effect of Gab1 and Gab2 overexpression on signaling by
the CSF-Met N1358H (Met
Grb2) receptor, we compared the MAPK and JNK
responses upon CSF stimulation. Although this receptor is unable to
bind Grb2, it is still able to induce MAPK activation upon CSF
stimulation (Figure 3D, vector), possibly due to its ability to recruit
and phosphorylate the Shc adapter protein and to promote Shc-Grb2
coupling (Fournier et al., 1996
). In addition, a recent
article suggests that Met may couple with
4 integrin,
providing an additional signaling platform through which extracellular
signal-regulated kinase (ERK) signals can be elicited (Trusolino
et al., 2001
). Noteably, CSF stimulation of WT MDCK cells
does not induce MAPK phosphorylation (our unpublished data),
indicating that activation of MAPK in the CSF-Met
Grb2 cell lines
occurs exclusively through signals generated from the CSF-Met
Grb2
receptor. Importantly, overexpression of either Gab1 or Gab2 produced
similar MAPK or JNK responses upon stimulation of the CSF-Met
Grb2
mutant receptor (Figure 3D). These results suggest that the inability
of Gab2 to rescue the morphogenic phenotype of the mutant Met
Grb2
receptor cell line is not due to significant alterations in MAPK or JNK activation.
Gab2 Association with Met Is Grb2 dependent
To resolve why Gab2 overexpression fails to rescue the
morphogenesis defect, we established whether Gab2 is phosphorylated upon activation of the CSF-Met
Grb2 mutant receptor. Whereas Gab1 is
readily phosphorylated after stimulation of the CSF-Met
Grb2 mutant,
Gab2 is poorly phosphorylated, even when overexpressed (Figure
4A). However, a noticeable mobility shift
is observed upon CSF stimulation. The lower level of Gab2
phosphorylation relative to Gab1 might reflect differences in the
ability of the Met receptor to induce phosphorylation of Gab2, or in
the mechanism of recruitment of Gab1 and Gab2 to the Met receptor. Gab1
is recruited to the Met receptor by two distinct mechanisms. One is
indirect through the adapter protein Grb2 and tyrosine 1356 on the Met receptor, and the other is Grb2-independent and requires tyrosines 1349 and 1356 of the Met receptor (Weidner et al., 1996
; Bardelli et al., 1997
; Fixman et al., 1997
; Nguyen
et al., 1997
; Lock et al., 2000
). Gab1 contains
two proline-rich motifs that function as binding sites for the
C-terminal Grb2 SH3 domain (Lock et al., 2000
; Schaeper
et al., 2000
). These sites are conserved in Gab2, and
mutation of either of these sites individually reduces the association
of Gab2 with Grb2 (our unpublished data), as shown for Gab1
(Lock et al., 2000
), whereas mutation of both abrogates association with Grb2 as assessed by in vitro association assay (Figure
4B). To define whether Gab2 phosphorylation by the Met receptor was
Grb2 dependent or independent, the phosphorylation of a Gab2
Grb2
protein was assessed in stable MDCK cell lines after stimulation with
HGF. Whereas WT Gab2 was tyrosine phosphorylated after stimulation of
cells with HGF, a Gab2
Grb2 mutant was not detectably phosphorylated
(Figure 4C). In contrast, a Gab1
Grb2 mutant was efficiently
phosphorylated (Figure 4C). These data suggest that Gab2 lacks the
ability to be recruited to the Met receptor in a Grb2-independent
manner.
|
Grb2-independent recruitment of Gab1 to the Met receptor has been
mapped within the Gab1 MBD (Weidner et al., 1996
; Lock
et al., 2000
; Schaeper et al., 2000
). The ability
of the Gab2 MBD region to associate with Met in vitro, was assessed by
pull-down assays of Met receptor proteins expressed by transient
transfection in 293T cells. When overexpressed, the Met receptor is
activated in the absence of growth factor stimulation and is tyrosine
phosphorylated (Lock et al., 2000
). Association of the Met
receptor with GST fusion proteins containing the MBD derived from Gab1
(MBD1) or Gab2 (MBD2) revealed that compared with MBD1, MBD2 binds less efficiently to the Met receptor, even though equal levels of fusion proteins were used (Figure 4D). Elimination of the Grb2 binding site in
the Gab2 MBD (MBD2
Grb2) abolishes this weak association, whereas the
deletion of the Grb2 binding site in the Gab1 MBD1 (MBD1
Grb2)
decreases but does not eliminate the association of the Gab1 MBD1 with
the Met receptor (Figure 4D) (Lock et al., 2000
). To
establish whether, as suggested by these experiments, Gab2 is recruited
to the Met receptor in a Grb2-dependent manner, 293T cells were
transiently cotransfected with the Met receptor and with either WT
Gab1, or Gab2, or Gab1 or Gab2 mutants lacking Grb2 binding sites
(Gab1
Grb2 or Gab2
Grb2; Figure 4E). After immunoprecipitation, WT
Gab1 or a Gab1
Grb2 mutant readily coimmunoprecipitates with the Met
receptor, whereas only low levels of WT Gab2 protein coimmunoprecipitate with Met and the Gab2
Grb2 protein fails to coimmunoprecipitate even though similar levels of proteins are expressed (Figure 4C). These data indicate that Gab1 and Gab2 are
recruited through distinct mechanisms to the Met receptor, where Gab2
is Grb2 dependent and Gab1 recruitment is Grb2 dependent and independent.
Grb2-independent Recruitment of Gab1 Requires Amino Acids Absent in Gab2
By sequence alignment, the MBD regions of Gab1 and Gab2 are poorly
conserved, but share homology within two p85 binding sites, and the
Grb2 SH3 domain binding site (Figure 5A).
Notably, Gab1 contains 10 amino acids that are absent in Gab2. The
mutation of three proline residues within this 10-amino acid region in Gab1 (
3P =
491-493; Figure 5A) severely reduced the
association of a GST-MBD1
3P fusion protein with the Met receptor in
an in vitro association assay, compared with GST-MBD1 WT and
GST-MBD1
Grb2 fusion proteins (Figure 5B). Similarily,
coimmunoprecipitation of the Met receptor with the full-length
Gab1
3P mutant protein is significantly reduced compared with WT Gab1
or Gab1
Grb2 protein (Figure 5C). Moreover, association with the Met
receptor is abolished with either a GST-MBD1
3P/
Grb2 fusion
protein (Figure 5B) or the full-length Gab1
3P/
Grb2 protein
(Figure 5C). The Gab1
3P mutant associates with a GST-Grb2 fusion
protein in vitro to a similar level as WT Gab1 (Figure 5D). Thus, the
reduction in association with the Met receptor is not due to an
impaired ability of the Gab1
3P mutant to associate with Grb2, and
the structure of this mutant has not been grossly altered.
|
To identify the amino acids critical for interaction with Met, we have
individually substituted each proline residue and additional residues
surrounding the prolines with alanines, and tested the ability of these
mutants to coimmunoprecipitate with Met, by using the constitutively
activated form of the Met receptor, Tpr-Met. The substitution of
proline 491 or proline 492 with alanine disrupts the association of
Gab1 with Met, and the substitution of glycine 487 showed reduced
association, whereas the substitution of glutamine 489 or proline 493 had no effect (Figure 4E). Thus, the
3P mutant and more specifically
a substitution of alanine for proline 491 or 492 abrogate the
Grb2-independent recruitment of Gab1 to the Met receptor.
Insertion of Novel Amino Acid Sequence from Gab1 into Gab2 Confers Grb2-independent Binding
To define the domain required for direct recruitment of Gab1 to
Met, we generated chimeric fusion proteins of Gab1 and Gab2 MBD regions
(Figure 6A) and tested these for their
ability to bind to Met in an in vitro association assay (Figure 6B). A
chimeric protein containing the C terminus of the Gab1MBD
[MBD2/1(484-end); Figure 6B, lane 4], showed similar Met binding
capacity to MBD1 (Figure 6B, lane 1), whereas a chimeric
protein, containing the C terminus of the Gab1MBD [MBD2/1(495-end);
Figure 6B, lane 5], showed a reduced ability to associate with the Met
receptor, suggesting that amino acids between 484 and 495 of Gab1 were
important for binding. However, the insertion of these 13 amino acids
from Gab1, into the Gab2 MBD [MBD2/1/2(484-496); Figure 6B, lane 6], was insufficient to confer full binding, whereas a Gab2MBD protein with
the insertion of 19 amino acids from Gab1 (MBD2/1/2*484-502) associated with the Met receptor to the same extent as a WT Gab1 MBD1
fusion protein (Figure 6B, lane 7). This is in agreement with data from
Schaeper et al. (2000)
, who showed that insertion of 13 amino acids, GMQVPPPAHMGFR (aa 487-499), into Gab2 was sufficient to
mediate Met association in a yeast two-hybrid assay (Schaeper et
al., 2000
). The six additional amino acids identified herein reflect our cloning strategy to generate these mutants, and from our
mutational analyses these amino acids are not essential for Grb2-independent binding.
|
Consistent with a requirement of prolines 491-493 for the association
of the Gab1 MBD with Met, the deletion of these three prolines
abolishes the Grb2-independent Met binding of the Gab2 MBD2/1/2*
[MBD2/1/2*
3P; Figure 6B, lane 8]. As expected, a Gab2 MBD2/1/2*
Grb2 fusion protein (lane 9) retained the ability to associate with Met, but showed decreased association, similar to that
of the Gab1 MBD1
Grb2 fusion protein (Figure 5B). The difference
between the MBD2/1/2 (lane 6) and the MBD2/1/2* (lane 7) proteins is
six amino acids of Gab1 (GFRSSP, aa 497-502; Figure 6C), which
correspond to amino acids 479-484 (GYPSTA) in Gab2 (Figure 6C). The
only significant differences between these proteins are Arg 499 and Pro
502 of Gab1 to Pro and Ala, respectively, in Gab2. To define the
requirement for these residues, we generated mutants where Arg 499 and
Pro 502 were substituted with Pro and Ala, respectively, in the context
of the GST-MBD2/1/2* and tested for their abilities to bind to Met. The
Gab2 MBD2/1/2*R499P (Figure 6B, lane 10) has a severely decreased
association with Met, whereas MBD2/1/2*P502A (Figure 6B, lane 11) binds
Met to the same level as MBD2/1/2* (lane 7). GST alone (lane 12) does
not bind Met. Therefore, the ability to confer Grb2-independent binding
on Gab2 is mediated by the substitution of 19 amino acids from Gab1,
SSF GMQVPPPAHMGFRSSP, where the first
and second prolines and the last arginine are critical, and the first
glycine is preferred (Figures 5E and 6B).
In support of this, substitution of these 19 residues into Gab2
generates a Gab2 protein (Gab2/1/2*) that coimmunoprecipitates with the
Met receptor to similar levels as WT Gab1 (Figure 6D). Moreover, in
stable MDCK cell lines expressing the Gab2/1/2* protein, Gab2/1/2* is
phosphorylated to higher levels than Gab2, although it was not as
highly phosphorylated as Gab1 (Figure 6E). In accordance with these
results, in stable MDCK cell lines, the Gab1
3P protein is
significantly less phosphorylated than WT Gab1 (Figure 6E). This
indicates that not only are these amino acids from Gab1 required for
Grb2-independent association with the Met receptor but also they are
required for efficient phosphorylation of Gab proteins by the Met receptor.
Grb2 Independent Recruitment of Gab1 Is Essential for Epithelial Morphogenesis
To evaluate the biological significance of the Grb2-independent
binding of Gab1, we have tested the ability of Gab1
3P and Gab2/1/2*
to rescue tubulogenesis. Overexpression of the Gab1
3P mutant (Figure
7A) was unable to rescue branching
tubulogenesis in response to CSF-1 in five independent cell lines
(Figure 7, C and D; two representative cell lines are shown),
indicating that a functional Met binding motif in Gab1 is essential for
epithelial morphogenesis. Importantly, when overexpressed, the
Gab2/1/2* chimera fails to rescue the tubulogenic defect of the
Met
Grb2 mutant (Figure 7, C-E). In a similar manner to WT Gab2
(Figure 3B), cell lines that express low levels of Gab2/1/2* (Figure
7A) remain as cysts upon stimulation of the Met
Grb2 receptor. Cell lines that express high levels of Gab2/1/2* (Figure 7A) are able to
generate a partial response, with a higher percentage of long, unbranched tubules than Gab2-overexpressing cells (Figure 7C). However
these cell lines are unable to generate a full branching morphogenic
response comparable with that of the Gab1 expressing cell lines (Figure
7A, and C-E; four representative cell lines are shown). Importantly,
Gab2/1/2* protein becomes phosphorylated upon stimulation of the
CSF-Met
Grb2 receptor, although consistently to lower levels than
Gab1 (Figure 7B). These results demonstrate that the direct binding of
Gab1 to Met is essential but not sufficient for branching
tubulogenesis, implying that Gab1 and Gab2 do not have redundant roles
in MDCK cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
Gab1-null mice are embryonic lethal (Itoh et al., 2000
;
Sachs et al., 2000
), whereas those of Gab2 are viable and
generally healthy but have a defect in the allergic response (Gu
et al., 2001
). Whether these differences are mainly
attributed to distinct tissue expression during development or to a
distinct function of Gab proteins has not been directly evaluated. To
address this issue, we have used the MDCK epithelial cell system to
study the roles of Gab1 and Gab2 in epithelial morphogenesis downstream of the Met receptor tyrosine kinase. We show that both Gab1 and Gab2
are expressed in MDCK cells (Figure 1A) and that they show a similar
subcellular localization and concentrate at cell-cell junctions in
colonies of epithelial cells (Figure 1B) (Maroun et al.,
1999a
). Gab2 becomes phosphorylated upon HGF simulation (Figure 1A) and
can associate with similar signaling proteins as Gab1 (Figure 2, B and
C) (Weidner et al., 1996
; Nguyen et al., 1997
;
Maroun et al., 1999a
). However, in contrast to Gab1, Gab2 is
unable to rescue the epithelial morphogenesis defect of the Met
Grb2
receptor mutant (Figure 3, B and C), providing evidence for the first
time for a distinct role for Gab1 and Gab2 downstream from the Met receptor.
We have previously shown that Gab1 is an essential mediator of Met
receptor-induced epithelial morphogenesis (Maroun et al., 1999a
). Overexpression of Gab1 in MDCK epithelial cells rescues the
inability of a Met receptor mutant (Met
Grb2) to induce branching morphogenesis (Maroun et al., 1999a
). In contrast, the
overexpression of Gab2 fails to rescue the morphogenic defect (Figure
3, B and C). Compared with Gab1, only low levels of Gab2 associate with the Met receptor, and Gab2 is phosphorylated only weakly in response to
stimulation of the Met receptor (Figures 2A, and 4, D and E). The
reduced Gab2 association with the Met receptor compared with Gab1
reflects different mechanisms of recruitment of these two related
docking proteins. The recruitment of Gab2 to Met, and its subsequent
phosphorylation, are dependent predominantly on a Grb2 binding site in
Gab2 (Figure 4, C-E), whereas the recruitment of Gab1 to Met is both
Grb2 dependent and Grb2 independent (Figure 5, B and C) (Weidner
et al., 1996
; Nguyen et al., 1997
; Lock et al., 2000
; Schaeper et al., 2000
). The Grb2-independent
association of Gab1 with Met is thought to be direct, as proposed from
yeast two-hybrid studies (Weidner et al., 1996
; Schaeper
et al., 2000
). However, the nature of the interaction
remains undefined.
A comparison of the MBD regions of Gab1 and Gab2 revealed a 10-amino
acid segment in Gab1 (aa 484-493) that is lacking in Gab2 (Figure 5A).
From our structure-function analyses, and in agreement with Schaeper
et al. (2000)
, these amino acids are critical for the
Grb2-independent recruitment of Gab1 to the Met receptor and their
insertion confers Grb2-independent recruitment of Gab2 to Met
(Gab2/1/2*; Figure 6, A-D). The mutation of three proline residues
within this region of Gab1 (Gab1
3P,
491-493) abolishes Grb2-independent recruitment of Gab1 (Figure 5, B and C) and decreases HGF-induced tyrosine phosphorylation of Gab1 (Figure 6E). Noteably, the
Gab1
3P mutant fails to rescue the branching morphogenic program downstream from the Met
Grb2 receptor mutant (Figure 7, C and D).
This identifies for the first time a requirement for Grb2-independent recruitment for Gab1 biological function.
The failure of Gab2 to rescue the Met-dependent morphogenic program in
MDCK cells could therefore be attributed to the absence of the Gab1 Met
binding sequence, and hence the low levels of Gab2 phosphorylated
downstream of a Met
Grb2 mutant (Figure 4, A-E). However, the
inability of Gab2 to rescue morphogenesis cannot solely be attributed
to this difference. A Gab2 protein containing the Gab1 Met binding
sequence does not rescue the morphogenic program (Gab2/1/2*; Figure 7,
C-E), in spite of the increased tyrosine phosphorylation of the
Gab2/1/2* protein (Figure 6E). Hence, although we cannot rule out the
possibility that the signal downstream from the Gab2/1/2* protein is
below a threshold required to rescue the morphogenic response, in spite
of their high homology and similar domain structure, Gab1 and Gab2 may
not be functionally redundant in MDCK cells.
Gab1 and Gab2 have 15 conserved tyrosines, although only 8-10 of the
tyrosines in Gab1 have been shown to be phosphorylated by either the
insulin, EGF, or Met receptors (Lehr et al., 1999
; Gual
et al., 2000
; Lehr et al., 2000
). The Met
receptor may phosphorylate different tyrosine residues in Gab1 or Gab2
and/or other kinases, such as Src family kinases, activated downstream
of Met, may participate in Gab1 phosphorylation and not Gab2. However,
pretreatment of cells with a Src family kinase inhibitor (PP2) did not
alter Gab1 or Gab2 phosphorylation after Met stimulation (our
unpublished data). Moreover, when overexpressed and
phosphorylated after activation of Met, Gab2 can associate with the
same signaling proteins as Gab1, suggesting that Gab2 can be
extensively phosphorylated by Met (Figure 2B). Two potentially
phosphorylated tyrosines (Y307 and Y373) are absent in Gab2. However,
although these tyrosines contain a consensus binding site for
Crk/PLC
, Gab2 retains the ability to bind these signaling proteins
(Figure 2B) (Gual et al., 2000
; Lamorte et al.,
2000
; Sakkab et al., 2000
; Schaeper et al.,
2000
). Alternatively, tyrosines 307 and 373 in Gab1 may be required for
the association with an unidentified protein that is critical for the
morphogenic response. In addition, Gab1 but not Gab2 binds to and is a
substrate of Erk2 MAPK (Roshan et al., 1999
; Yu et
al., 2001
), whereas Gab2, but not Gab1 has been shown to be
negatively regulated by serine phosphorylation by PKB/Akt (Lynch and
Daly, 2002
). The possibility that the distinct biological functions of
Gab1 and Gab2 reflect recruitment of distinct signaling proteins, or
different mechanisms for feedback inhibition, is currently being
evaluated using Gab1/Gab2 chimeric proteins.
The Grb2-independent recruitment of the Gab1 MBD to Met is
phosphotyrosine dependent and requires the presence of two tyrosines in
the Met receptor (Weidner et al., 1996
), although the amino acid motif required for Gab1 recruitment is not known. The Gab1 MBD has
no known homology with other phosphotyrosine binding modules, nor was
any significant homology found with other proteins. From structure-function analysis, we show that Pro 491, 492, and Arg 499 are required for Grb2-independent recruitment of Gab1 to Met (Figures
5E and 6B). A critical arginine in the MBD is reminiscent of SH2
domains, where a conserved arginine is required to directly participate
in binding the phosphotyrosine residue (Marengere and Pawson, 1992
;
Waksman et al., 1993
). Thus, although the Gab1 MBD seems to
be unique, similarity may only be identified by three-dimensional structure analysis. For instance, the Shc and IRS-1 PTB domains share
little primary sequence homology, yet adopt a similar three-dimensional structure and have similar binding specificities (Wolf et
al., 1995
; Eck et al., 1996
; Zhou et al.,
1996
). Although the MBD seems to function as a phosphotyrosine binding
domain, one major difference from other such domains is the presence of
additional protein binding sites within the Gab1 MBD. These include the
p85 SH2 domain, the Grb2 SH3 domain, and Erk1 or 2 (Holgado-Madruga
et al., 1997
; Rocchi et al., 1998
; Roshan
et al., 1999
; Lock et al., 2000
; Schaeper et al., 2000
; Lewitzky et al., 2001
). From our
studies, the binding sites for these proteins, and the amino acids
required for Grb2-independent recruitment of Met are distinct; hence,
it is possible that the Gab1 MBD contains multiple ligand-binding surfaces.
To date, the MBD of Gab1 interacts in a Grb2-independent manner with
only the Met receptor and not with other receptors tested, including
EGF receptor, platelet-derived growth factor-R
v-Sea, TrkA, c-Ros,
the insulin receptor DDR, c-Ret, Sek-1, c-Kit, c-Abl, CSF-1R, and
keratinocyte growth factor receptor (Weidner et al., 1996
; Lock et al., 2000
). Similarly, the PTB domain of
FRS2/SNT2 shows differential binding specificity for receptors. It
binds to canonical NPXpY sequences on TrkA and Ret receptors (Meakin et al., 1999
; Kurokawa et al., 2001
), whereas it
interacts with the fibroblast growth factor receptor through a novel
sequence in a nonphosphotyrosine-dependent manner (Xu et
al., 1998
; Ong et al., 2000
). In addition, the
Grb7/Grb10/Grb14 family of adapter proteins contains novel
receptor-specific interaction domains (BPS/IPS/PIR) in addition to
their SH2 domains (He et al., 1998
; Kasus-Jacobi et
al., 2000
; Stein et al., 2001
). Moreover, whereas both
IRS-1 and IRS-2 contain PTB and PH domains required for efficient association with the insulin receptor, only IRS-2 contains a kinase regulatory loop-binding domain that interacts with the phosphorylated regulatory loop of the insulin receptor
-subunit (Sawka-Verhelle et al., 1996
, 1997
). The presence of domains in docking
proteins that interact differentially with a subset of receptor
tyrosine kinases may thus be a common mechanism through which docking
proteins can modulate different biological responses downstream from
receptor tyrosine kinases. We have shown a distinct mechanism of
recruitment and distinct function for Gab1 and Gab2 downstream from the
Met receptor. It remains to be established whether Gab1 and Gab2 are functionally redundant downstream from other receptors that recruit Gab1 in a Grb2-dependent manner only, and underscores the importance of
further studies to understand these differences.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Drs. Ben Neel and Haihua Gu for providing Gab2 reagents; Drs. Albert Wong and Marina Holgado-Madruga for providing Gab1 cDNA; Dr. G.F. Vande Woude for HGF; the Genetics Institute for recombinant CSF-1; and members of the Park laboratory for helpful comments. This research was supported by an operating grant from the National Cancer Institute of Canada, with money from the Canadian Cancer Society, and a scholarship from the Canadian Institutes of Health Research (to L.L). M.P. is a Scientist of the Canadian Institutes of Health Research.
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: morag{at}molonc.mcgill.ca.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.02-02-0031. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.02-02-0031.
| |
REFERENCES |
|---|
|
|
|---|
to Gab1 is required for HGF-induced branching tubulogenesis.
Oncogene
19, 1509-1518[CrossRef][Medline].
6
4 integrin in the control of HGF-dependent invasive growth.
Cell
107, 643-654[CrossRef][Medline].This article has been cited by other articles:
![]() |
S. Tetzlaff, E. Murani, K. Schellander, S. Ponsuksili, and K. Wimmers Differential expression of growth factors and their receptors indicates their involvement in the inverted teat defect in pigs J Anim Sci, November 1, 2009; 87(11): 3451 - 3457. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. N. Paliouras, M. A. Naujokas, and M. Park Pak4, a Novel Gab1 Binding Partner, Modulates Cell Migration and Invasion by the Met Receptor Mol. Cell. Biol., June 1, 2009; 29(11): 3018 - 3032. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Parachoniak and M. Park Distinct Recruitment of Eps15 via Its Coiled-coil Domain Is Required For Efficient Down-regulation of the Met Receptor Tyrosine Kinase J. Biol. Chem., March 27, 2009; 284(13): 8382 - 8394. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Laramee, C. Chabot, M. Cloutier, R. Stenne, M. Holgado-Madruga, A. J. Wong, and I. Royal The Scaffolding Adapter Gab1 Mediates Vascular Endothelial Growth Factor Signaling and Is Required for Endothelial Cell Migration and Capillary Formation J. Biol. Chem., March 16, 2007; 282(11): 7758 - 7769. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mood, C. Saucier, Y.-S. Bong, H.-S. Lee, M. Park, and I. O. Daar Gab1 Is Required for Cell Cycle Transition, Cell Proliferation, and Transformation Induced by an Oncogenic Met Receptor Mol. Biol. Cell, September 1, 2006; 17(9): 3717 - 3728. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Brummer, D. Schramek, V. M. Hayes, H. L. Bennett, C. E. Caldon, E. A. Musgrove, and R. J. Daly Increased Proliferation and Altered Growth Factor Dependence of Human Mammary Epithelial Cells Overexpressing the Gab2 Docking Protein J. Biol. Chem., January 6, 2006; 281(1): 626 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. van den Akker, T. van Dijk, M. Parren-van Amelsvoort, K. S. Grossmann, U. Schaeper, K. Toney-Earley, S. E. Waltz, B. Lowenberg, and M. von Lindern Tyrosine kinase receptor RON functions downstream of the erythropoietin receptor to induce expansion of erythroid progenitors Blood, June 15, 2004; 103(12): 4457 - 4465. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Podar, G. Mostoslavsky, M. Sattler, Y.-T. Tai, T. Hayashi, L. P. Catley, T. Hideshima, R. C. Mulligan, D. Chauhan, and K. C. Anderson Critical Role for Hematopoietic Cell Kinase (Hck)-mediated Phosphorylation of Gab1 and Gab2 Docking Proteins in Interleukin 6-induced Proliferation and Survival of Multiple Myeloma Cells J. Biol. Chem., May 14, 2004; 279(20): 21658 - 21665. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-C. Chan, Y.-L. Chen, C.-H. Cheng, K.-C. Yu, L. A. Cary, K.-H. Shu, W. L. Ho, and H.-C. Chen Src Phosphorylates Grb2-associated Binder 1 upon Hepatocyte Growth Factor Stimulation J. Biol. Chem., November 7, 2003; 278(45): 44075 - 44082. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Lock, M. M. Frigault, C. Saucier, and M. Park Grb2-independent Recruitment of Gab1 Requires the C-terminal Lobe and Structural Integrity of the Met Receptor Kinase Domain J. Biol. Chem., August 8, 2003; 278(32): 30083 - 30090. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Maroun, M. A. Naujokas, and M. Park Membrane Targeting of Grb2-associated Binder-1 (Gab1) Scaffolding Protein through Src Myristoylation Sequence Substitutes for Gab1 Pleckstrin Homology Domain and Switches an Epidermal Growth Factor Response to an Invasive Morphogenic Program Mol. Biol. Cell, April 1, 2003; 14(4): 1691 - 1708. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Minoguchi, S. Minoguchi, D. Aki, A. Joo, T. Yamamoto, T. Yumioka, T. Matsuda, and A. Yoshimura STAP-2/BKS, an Adaptor/Docking Protein, Modulates STAT3 Activation in Acute-phase Response through Its YXXQ Motif J. Biol. Chem., March 21, 2003; 278(13): 11182 - 11189. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||