![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 6, 2180-2191, June 2002
Princeton University, Department of Molecular Biology, Princeton, New Jersey 08544
Submitted November 13, 2001; Revised January 28, 2002; Accepted February 22, 2002| |
ABSTRACT |
|---|
|
|
|---|
The Saccharomyces cerevisiae Pif1p DNA helicase is the prototype member of a helicase subfamily conserved from yeast to humans. S. cerevisiae has two PIF1-like genes, PIF1 itself and RRM3, that have roles in maintenance of telomeric, ribosomal, and mitochondrial DNA. Here we describe the isolation and characterization of pfh1+, a Schizosaccharomyces pombe gene that encodes a Pif1-like protein. Pfh1p was the only S. pombe protein with high identity to Saccharomyces Pif1p. Unlike the two S. cerevisiae Pif1 subfamily proteins, the S. pombe Pfh1p was essential. Like Saccharomyces Pif1p, a truncated form of the S. pombe protein had 5' to 3' DNA helicase activity. Point mutations in an invariant lysine residue in the ATP binding pocket of Pfh1p had the same phenotype as deleting pfh1+, demonstrating that the ATPase/helicase activity of Pfh1p was essential. Although mutant spores depleted for Pfh1p proceeded through S phase, they arrested with a terminal cellular phenotype consistent with a postinitiation defect in DNA replication. Telomeric DNA was modestly shortened in the absence of Pfh1p. However, genetic analysis demonstrated that maintenance of telomeric DNA was not the sole essential function of S. pombe Pfh1p.
| |
INTRODUCTION |
|---|
|
|
|---|
The Saccharomyces cerevisiae PIF1 is a
nonessential gene that encodes a 5' to 3' DNA helicase (Lahaye et
al., 1991
) that was first identified because it is required for
the stable maintenance of mitochondrial DNA (Foury and Kolodynski,
1983
). In addition, there is a nuclear form of Pif1p that affects
telomeres (Schulz and Zakian, 1994
; Zhou et al., 2000
).
Telomere length is inversely proportional to the amount of Pif1p: cells
lacking Pif1p have long telomeres, whereas cells overexpressing Pif1p
have short telomeres. The catalytic activity of Pif1p is required for
its effects on telomeres as point mutations that eliminate the helicase activity of Pif1p have the same phenotypes as null alleles (Zhou et al., 2000
). Pif1p also inhibits telomerase-mediated
addition of telomeric DNA to spontaneous and induced double strand
breaks (Schulz and Zakian, 1994
; Zhou et al., 2000
; Mangahas
et al., 2001
; Myung et al., 2001
). Because Pif1p
is associated with telomeric DNA in vivo, its effects on telomeres are
likely direct (Zhou et al., 2000
).
The S. cerevisiae PIF1 is the founding member of a helicase
subfamily with homologues found in other fungi, Caenorhabditis elegans, Drosophila melanogaster, and Homo
sapiens (Zhou et al., 2000
; Bessler et al.,
2001
). S. cerevisiae has a second PIF1-like gene,
RRM3, that encodes a protein that is 38% identical to Pif1p over a 485-amino acid region. Like PIF1, RRM3 is
not essential; moreover, cells lacking both genes are also viable
(Ivessa et al., 2000
). RRM3 was first identified
because its mutation increases recombination in the ribosomal DNA
(rDNA; Keil and McWilliams, 1993
). However, the effects of Rrm3p on
rDNA recombination are probably a secondary consequence of defects in
rDNA replication (Ivessa et al., 2000
). In the absence of
Rrm3p, replication stalls at multiple sites within the rDNA. Separation
of converging forks is especially impaired in rrm3 cells.
The effects of Rrm3p on rDNA replication require its catalytic activity
and are probably direct, because Rrm3p is rDNA associated in vivo
(Ivessa et al., 2000
). Rrm3p also affects fork progression
within subtelomeric and telomeric DNA. As in rDNA, sister chromatid
separation within telomeric regions is delayed in an rrm3
strain (A.S. Ivessa, J.-Q. Zhou, V.P. Schulz, E.K. Monson, and V.A.
Zakian, unpublished results).
Most helicases contain seven short motifs spread throughout a 300-500
amino acid region (Ellis, 1997
). Because these motifs are short and
degenerate, their presence alone is not sufficient to confer
significant sequence similarity on proteins containing them. For
example, S. cerevisiae has 134 open reading frames (ORFs) with helicase-like features (Shiratori et al., 1999
), yet
Rrm3p is the only S. cerevisiae protein with significant
similarity to Pif1p by the criterion of a TBLASTN search (Zhou et
al., 2000
; Bessler et al., 2001
). Helicase subfamilies,
such as the Pif1 subfamily, are defined as a group of proteins that
have highly significant sequence similarity to each other but not to
other helicases. The functional significance of the sequence similarity that defines helicase subfamilies is not known. The sequence similarity might reflect common functions, recognition of a common nucleic acid
substrate, or interaction with a common cofactor.
As part of our goal to understand the functions of the PIF1
subfamily of DNA helicases, we isolated and characterized a
PIF1-like gene from the fission yeast
Schizosaccharomyces pombe, called pfh1+ (PIF1 homologue).
(Previously, pfh1 was called rph1; Zhou et al., 2000
; Bessler et al., 2001
.) S. pombe
and S. cerevisiae are distantly related, about as similar to
each other as each is to humans (Russell and Nurse, 1986
), yet many
genes involved in telomere replication and chromosome maintenance are
conserved between them. Although the 3 S. pombe chromosomes
are each much larger than any of the 16 S. cerevisiae
chromosomes, other features of genome organization are similar. For
example, in both organisms telomeres are ~300 base pairs (bp) in
length and have an irregular sequence, C1-3A/TG1-3 in S. cerevisiae (Shampay et al., 1984
) and
C2-8TGTA2/T2ACAG2-8
in S. pombe (Sugawara, 1989
; Hiraoka et al.,
1998
). Likewise, ribosomal DNA is organized and replicated similarly in
both organisms (Brewer and Fangman, 1988
; Linskens and Huberman, 1988
;
Sanchez et al., 1998
). In contrast, the S. cerevisiae mitochondrial DNA is much larger (~75 kb; reviewed in
Pon and Schatz, 1991
) than in S. pombe (~19 kb; Lang and
Wolf, 1984
), and unlike wild-type S. pombe, S. cerevisiae can live without mitochondrial DNA.
Our analysis of Pfh1p showed that it had roughly equivalent similarity
to both Pif1p and Rrm3p, ~60% similar over a ~450 amino acid
region that contains the seven helicase motifs. We purified a truncated
form of Pfh1p and demonstrated that, like Pif1p (Lahaye et
al., 1991
), it had 5' to 3' DNA helicase activity. Unlike both of
its Saccharomyces homologues,
pfh1+ was essential, and its catalytic
activity was required for its essential function. Although cells
lacking Pfh1p had telomeres that were ~50 bp shorter than wild-type
cells, maintenance of telomeric DNA was not the sole essential function
of Pfh1p.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
General Methods and Nomenclature
All S. pombe strains were isogenic to wild-type
strain 972 h
. Strains constructed by
integrative transformation (Rothstein, 1983
) were confirmed by Southern
blotting. Adhering to the conventions appropriate for each yeast
species, the wild-type and mutant versions of the S. cerevisiae
PIF1 gene were designated, respectively, PIF1 and
pif1, whereas the wild-type and mutant versions of the S. pombe PIF1-like gene were designated, respectively,
pfh1+ and
pfh1
. Deletion alleles are noted by a
delta symbol in S. cerevisiae and by a "D" in S. pombe.
Identification and Analysis of pfh1+
The S. pombe pfh1+, was identified
using nested degenerate PCR. S. pombe genomic DNA was first
amplified using the FIE/DMNL primer
TCGAATTCT(C/T)AT(A/C/T)GIATG(C/T)TIA and the QAYVAL primer CAAAGCTTA(A/G)IGCIAC(A/G)TAIGC(CT)TG, where I stands for inosine. Reaction products of 500-1300 bp were isolated and reamplified using
the GAQVM primer TCGAATTCGGIGCICA(A/G)GTIATG and the QGQTL primer
CAAAGCTTA(A/G)IGT(C/T)TGICC(C/T)TG. The major PCR product of 450 bp was
isolated, cloned, and sequenced. To obtain the rest of the
pfh1+ gene, the PCR restriction fragment
was used as a probe to screen a S. pombe genomic library
(generously provided by Wayne Wahls of Vanderbilt University). Nested
deletions of pfh1+ for sequencing were
generated as described (Davies and Hutchinson, 1991
). Sequencing was
done with a combination of manual Sequenase (USB/Amersham) and
automated dye terminator reactions. Both strands of the
pfh1+ gene were fully sequenced. The
pfh1+ sequence was analyzed using GCG
software (Group, 1994
). The sequence was deposited in the database
(Accession number AF074944).
The splicing of the 41-bp intron was confirmed by sequencing a
pfh1+ cDNA. The
pfh1+ cDNA was obtained by amplifying a
S. pombe cDNA library (Becker et al., 1991
) using
the primer 5' ACATTTAATAAACACAGAAG and 5' GATCCTAAAAGAACCAGCAC. The
resulting PCR product was cloned, and the region of the insert that
contains the intron was sequenced. The 5' end of the
pfh1+ gene was also identified by
amplification of the S. pombe cDNA library. The
library was first amplified with an ADC promoter primer 5'
CTTTTTCTGCAGAATATTTCAAGCTATACC and pfh1+
primer SP1403 5' TTAGTACATGGTAAACTCGT. This PCR product was reamplified using the ADC primer and primer 5' TCAAAAACGGGCAGTGAGGG. The PCR product was cloned and sequenced.
Construction and Analysis of pfh1-D1: ura4+ Mutant Strains
The plasmid pVS110 contains a 2.9-kb Sau3A genomic
DNA fragment generated by partial digestion with Sau3A that
begins 35 bp 5' of the start codon and extends to the ClaI
site at the end of the sequence. In the deletion plasmid, the two
EcoRV internal pfh1+ fragments,
a 1492-bp region, were replaced with a 1.8-kb SphI fragment
containing ura4+. The integration was
performed using diploid strain 585 with the genotype
his3-D1/his3-D1
leu1-32
/leu132
ura4-D18/ura4-D18
ade6-m210
/ade6-M216
h+/h
by
selecting for Ura+ transformants. This diploid
strain was made by mating strains of genotype his3-D1
leu1-32
ura4-D18
ade6-m210
h+ and
his3-D1 leu1-32
ura4-D18
ade6-M216
h
, which were
kindly provided by Kathy Gould (unpublished strains).
For sporulation experiments, overnight cultures of diploid strains were
grown in YEA medium. For sporulation, 100 µl of each culture was
spread onto YEPD medium for 2 days at 30°C. The plates were
scraped, and cells were resuspended in water to a final cell density of
~2-5 × 107 cells/ml. Glusulase (Dupont,
Wilmington, DE) was added to 0.5%, and cells were incubated overnight
at 30°C, and then spores were harvested. For germination,
108 spores were inoculated into 50 ml EMM medium
that contained sodium glutamate (EMMG) instead of ammonium chloride as
the nitrogen source. Spores derived from the
pfh1-1D::ura4+/pfh1+
heterozygote 584 were inoculated into EMMG without uracil. In this
medium, only spores that had the
pfh1-D1::ura4+
deletion were able to germinate and grow. Wild-type spores derived from
the
pfh1+/pfh1+
homozygous control were inoculated into EMMG with uracil. Samples of
the germinating spores were taken at various time points, harvested, fixed in 70% ethanol, digested with RNase A, and either stained with
Yo-Yo 2 (Molecular Probes, Eugene, OR) for confocal microscopy or with
propidium iodide for fluorescence-activated cell sorting (FACS)
analysis (Alfa et al., 1993
).
For Southern blot analysis, DNA was prepared by a glass bead procedure
(Runge and Zakian, 1989
), digested with HinfI or
ApaI, and run on a 1% agarose gel. The blots were
hybridized sequentially with a telomeric probe (from plasmid pSPT16;
Sugawara, 1989
), a probe for the entire S. pombe
mitochondrial genome (from plasmid pDG3; Del Giudice, 1981
), a 288-bp
probe that detects the rhp6+ gene that was
made by PCR amplification of genomic DNA (Reynolds et al.,
1990
), and to a 2.4-kb rDNA probe made by PCR amplification. Probes
were labeled with [
-32P]dCTP using the RTS
RadPrime DNA labeling system (Life Technologies, Rockville, MD).
Complementation analysis of the
pfh1-D1::ura4+
deletion strain was performed by plasmid swapping. A 6.1-kb S. pombe genomic DNA fragment was inserted into Bluescript KSII
vector. The 6.1-kb insert began 1.7 kb upstream of the first AUG of
pfh1+ and ended 1.9 kb after the stop
codon. The 6.1-kb fragment was released from the Bluescript KSII vector
by digestion with NotI and PstI, treated with T4
DNA polymerase to generate blunt ends, and inserted into the
SmaI site of pBG2 (Burke and Gould, 1994
), a plasmid
containing the S. pombe his3+ gene and
ars1. This plasmid, called pVS117, was transformed into a
heterozygous
pfh1-D1::ura4+/pfh1+
diploid strain, and the diploid was sporulated to yield a
pfh1-D1::ura4+
haploid strain. The haploid strain was transformed with either of two
plasmids, pREP41X or pREP81X, that carry the
pfh1+ gene under the control of the
thiamine-regulated nmt promoters (Basi et al.,
1993
).
The viability of a ptp1-1
pfh1-D1::ura4+ double
mutant was tested by mating S. pombe strain PTP25
(h+ ura1-161
ade6-216
ptp1-1
rho+)
obtained from T. Fox (Haffter and Fox, 1992
) with a strain of genotype
h
his3-D1
leu1-32
ura4-D18
ade6-M210
pfh1-D1::ura4+/pVS117.
Single amino acid changes (K337A and K337R) in Pfh1p were made using
the Quick-Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla,
CA) and VPS603 plasmid, a his3+ plasmid
containing pfh1+. To make K337A,
oligonucleotides K337A5' and K337A3' were used (K337A5': 5'-gct gga aca
ggC GCC tct gtt ctc ct-3'; K337A3': 5'-ag gag aac aga GGC Gcc tgt tcc
agc-3'). (Mutated residues are capitalized.) This pair of
oligonucleotides generated a SfoI site near K337 in
pfh1 without changing any additional amino acids, which
facilitated identification of the K337A mutation. To make K337R,
oligonucleotides K337R5' and K337R3' were used (K337R5': 5'-ct gga aca
ggt CGa tcG gtt ctc ctc cg-3', K337R3': 5'-cg gag gag aac Cga tCG acc tgt tcc ag-3'). This pair of oligonucleotides generates a
PvuI site near K337 without changing any additional amino acids.
To determine if pfh1+ was essential in
cells that lack telomeric DNA, we used strains CF199 (h-
leu1-32 his3-D1 ura4-D18 ade6-M210; the wild-type
control) and CF448 (isogenic to CF199 except for trt1::his3+ and
having circularized chromosomes), both kindly supplied by T. Nakamura
(Nakamura et al., 1998
). Strains were transformed with a
2.9-kb EcoRI/PstI/BglI fragment from
pVS110 which contained the
pfh1::ura4+
deletion/disruption cassette with or without the LEU2
plasmid pREP41X-pfh1+ (the S. cerevisiae LEU2 gene complements a S. pombe leu1-32
strain.)
Purification and Analysis of Pfh1p-h
To express active recombinant Pfh1p, a 1608-bp fragment that
encoded amino acids 255-789 of Pfh1p was isolated from the
pfh1+ cDNA, cloned into the
SalI site of pEG(KT) (Mitchell et al., 1993
) to
generate pEG(KT)-Pfh1-h, and transformed into a protease-deficient S. cerevisiae strain BCY123 (Bennett et al.,
1998
). Expression of the GST-Pfh1p-h fusion protein was carried out
using minor modifications of methods described in Bennett et
al. (1998)
. Purification was carried out at 4°C. Cells were
harvested, washed, and resuspended in 8 volumes of ice-cold lysis
buffer (50 mM Tris-HCl, pH 7.8, 500 mM NaCl, 4 mM
MgCl2, 40 µg/ml DNase I, 10 mM dithiothreitol (DTT), 0.1% Triton X-100, 0.004% 1-octonal) and a mixture of protease inhibitors (10 µg/ml aprotinin, 5 µg/ml leupeptin, 10 µg/ml
pepstatin A, 100 µg/ml bacitracin, 250 µg/ml soybean trypsin
inhibitor, 0.4 mM phenylmethylsulfonyl fluoride, and 10 mM benzamidine
hydrochloride). Cells were lysed by two passes through a cell disruptor
(EmulsiFlex-C5; Avestin, Ottawa, Ontario, Canada). After centrifugation
(15,000 × g, 15 min), the supernatant was brought to
50% saturation with ammonium sulfate and left on ice for 30 min. The
precipitate was collected by centrifugation (27,000 × g, 30 min), suspended in 20 ml PBS supplemented with 5 mM
DTT, 0.5% Triton X-100, 0.001% 1-octonal, and protease inhibitor mix.
The soluble fraction was recovered by centrifugation (27,000 × g for 30 min) and loaded onto a 4 ml glutathione sepharose
4B column (1.6 × 2) equilibrated with PBS, at a flow rate of 20 ml/h. The column was washed with 20-bed volumes of the same buffer and
20-bed volume(s) of the same buffer containing 1 M NaCl. Protein was
eluted with 10 ml of elution buffer (50 mM Tris-HCl, pH 8.8, 30 mM
reduced glutathione, 50 mM NaCl, 10 mM DTT, 0.1% Triton X-100, 0.001%
1-octanol). The eluate was digested with 200 U of thrombin overnight
and loaded onto a 1-ml heparin column equilibrated with 50 mM Tris-HCl
buffer, pH 7.8 (200 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.002% Triton X-100) at a flow rate of 30 ml/h. The column was washed with the equilibration buffer and eluted with linear NaCl gradient from 200 mM to 1 M in the
same buffer and 1-ml fractions were collected. Recombinant Pfh1p-h
eluted between 700 and 800 mM NaCl, as determined by Coomassie blue-stained SDS-PAGE and immunoblot analysis. The peak
fractions were pooled and concentrated by Centricon (Millipore,
Bedford, MA) centrifugation. The Pfh1p antibody used to follow
expression and purification of Pfh1p-h was made against amino acids
447-708 of Pfh1p expressed in Escherichia coli as a
GST-fusion protein. The fusion protein was purified according to
Pharmacia Biotechnology protocols (Piscataway, NJ) and was used both to
raise polyclonal serum in rabbits and to make an affinity column for
the purification of the antiserum as described in Koff et
al. (1992)
.
ATPase reactions were carried out in 20 µl ATPase buffer (25 mM
HEPES, pH 7.6, 5 mM MgCl2, 2 mM ATP, 1 mM DTT,
100 µg/ml BSA, 200 µg/ml M13 single-strand DNA, with 200 ng of
recombinant Pfh1p-h or 100 ng of recombinant Pif1p), for 30 min at
37°C. Each reaction contained 0.5 µCi of
[
-32P]ATP. Reactions were stopped by the
addition of 1 µl of 0.5 M EDTA, and 0.5 µl of each reaction was
spotted on polyethylimine (PEI) cellulose plate (Baker, Sanford,
ME). The plate was developed in 0.8 M LiCl and dried with hot
air. The ATP hydrolysis was visualized on a Molecular Dynamics
Phosphoimager (Sunnyvale, CA). For helicase assays, a 25-mer
(5'-GTTGTAAAACGACGGCCAGTGAATT-3'), and 36-mer (5'-
CGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATT-3') oligonucleotides were annealed
to single-stranded M13mp7 or M13mp18 DNA. For the helicase assay, 10 pmol of the 36-mer was 32P-labeled at its 5' end
using T4 polynucleotide kinase and
[
-32P]ATP, and 2.5 pmol was annealed with
equal molar single-stranded M13mp18 virion DNA in a 75-µl reaction
mixture. For the helicase polarity assay, 2.5 pmol each of the
32P-labeled 36-mer and of the
32P-labeled 25-mer were annealed with equal molar
single-stranded M13mp7 DNA linearized by digestion with
EcoRI. The labeled substrates were purified with the Chroma
Spin-1000 column (Clontech, Palo Alto, CA). Helicase assays (20 µl
each) contained 20 mM HEPES, pH 7.6, 5 mM MgAc2,
4 mM ATP, 100 µg/ml BSA, 5% glycerol, 1 mM DTT, 2 µl DNA
substrate, and 200 ng of recombinant Pfh1p-h protein (or 100 ng
recombinant Pif1p) and carried out for 10 min at 37°C. The amount of
Pfh1p-h used is comparable to that used to detect helicase activity of
the S. cerevisiae Pif1p (Lahaye et al., 1991
, 1993
; Zhou et al., 2000
) as well as other S. cerevisiae DNA helicases (Sung et al., 1988
; Sedman
et al., 2000
) and the Mcm complex from S. pombe
(Lee and Hurwitz, 2001
) and other organisms (You et al., 1999
; Chong et al., 2000
). Products were analyzed by
electrophoresis in a 10% polyacrylamide (89 mM Tris borate, pH 8.3, 2 mM EDTA) and visualized on a Molecular Dynamics Phosphoimager.
| |
RESULTS |
|---|
|
|
|---|
Isolation of a PIF1-like Gene from S. pombe
We identified a PIF1-like gene from the fission yeast
S. pombe using nested degenerate PCR. To obtain a clone that
contained the entire S. pombe PIF1-like gene, hereafter
called pfh1+, for
PIF1
homologue, the PCR restriction fragment was used as a probe
to screen a S. pombe genomic library (Fikes et al., 1990
). Both strands of the pfh1+
gene were sequenced, and the sequence was deposited in the database (GenBank Accession number AF074944). The DNA sequence and predicted protein sequence are shown in supplementary material.
The conceptual translation of the pfh1+
gene generated an 805 amino acid protein with one small 41-base intron.
The splicing of this intron was confirmed by sequencing a cDNA obtained
from a random library of S. pombe cDNA clones. There
were two out of frame AUG codons in the 5' end of the mRNA before the
first AUG of the pfh1+ ORF. The presence
of the two upstream AUG codons suggests that pfh1+ is either translationally regulated
or poorly translated, because eukaryotic translation usually initiates
at the first AUG in an mRNA (Kozak, 1992
). There are three
MluI sites (MCB, MluI cell cycle box) 5' of the
start of the pfh1+ ORF. MluI
sites are found in the promoter regions of many S. cerevisiae and S. pombe DNA synthesis genes and often
confer cell cycle regulated transcription (reviewed in McIntosh, 1993
).
When the predicted protein sequence of S. pombe Pfh1p was
compared with the translated DNA database using the TBLASTN program (Altschul et al., 1990
), it displayed highly significant
similarity to each of the previously described (Bessler et
al., 2001
) Pif-like proteins (Table 1). Because our last
analysis of PIF1-like genes (Bessler et al.,
2001
), several additional Pif1-like proteins were reported.
Neurospora crassa and the basidiomycete Phanerochaete chrysosporium both encode two Pif1p-like proteins. Like
multicellular eukaryotes (but unlike S. cerevisiae, N. crassa, and P. chrysosporium), S. pombe
encoded only a single Pif1-like protein. Although the helicase domain
of Pfh1p was
36% identical to each of the other Pif1-like proteins
(Zhou et al., 2000
), its amino terminal ~330 and its
carboxyl terminal 52 amino acids had no significant homology to these
portions of other Pif1 subfamily members.
|
The S. pombe Pfh1p Is a 5' to 3' DNA Helicase
To determine if Pfh1p is also a DNA helicase, we purified and
characterized recombinant Pfh1p. Initially we expressed full-length Pfh1p in E. coli, but this protein had poor solubility and
was often degraded. Therefore, a truncated version of Pfh1p consisting of amino acids 255-789 of the 805 amino acid protein, a region that
contained all seven helicase motifs, was fused at its amino terminus to
GST to generate Pfh1p-h (h stands for helicase). DNA encoding the
GST-Pfh1p-h fusion protein was introduced into S. cerevisiae
under the control of a galactose-inducible promoter. Protein extracts
were prepared from both galactose- and glucose-grown cells and examined
by Western analysis using affinity-purified anti-Pfh1p antibodies
(Figure 1). The galactose-grown cells
(induced) contained an ~84-kDa protein, the appropriate size for the
GST-Pfh1p-h fusion protein, that was not detected in control extracts
(Figure 1B, compare uninduced in lane 2, to induced by galactose
addition in lane 3). Because the GST-Pfh1p fusion showed no helicase
activity, the 58.8-kDa truncated Pfh1p-h freed of the GST moiety by
thrombin cleavage was purified to near homogeneity as described in
MATERIALS AND METHODS (Figure 1A, lane 6). The faint Coomassie blue
staining bands in the preparation of purified Pfh1p-h (Figure 1A) were detected by the anti-Pfh1p antibodies (Figure 1B), indicating that they
were likely degradation products of GST-Pfh1p-h.
|
The purified recombinant Pfh1p-h had
Mg2+-dependent ATPase activity (Figure
2A) that was stimulated by single-strand
DNA (Figure 2A, lane 5). Helicase activity of recombinant Pfh1p-h was
demonstrated by its ability to displace a
32P-labeled 36-mer oligonucleotide annealed to
single-stranded circular M13 DNA, a reaction that was both
Mg2+- and ATP-dependent (Figure 2, B and
C). Because the ATPase and helicase activities were not detectable
until the GST-Pfh1p-h was thrombin cleaved, these enzymatic activities
were due to Pfh1p-h itself, rather than to a minor contaminant.
|
The polarity of the recombinant Pfh1p-h helicase was established using a substrate in which kinase-labeled 25- and 36-mer oligonucleotides were annealed at, respectively, the 5' and 3' ends of linearized single-stranded M13 DNA (Figure 2C). A 5' to 3' DNA helicase will displace the 36-mer, whereas a 3' to 5' DNA helicase will remove the 25-mer. Like purified recombinant Pif1p (Figure 2C, lane 6), recombinant Pfh1p-h displaced the 36-mer but not the 25-mer from the M13 DNA (Figure 2C, lane 5). Thus, Pfh1p-h is a 5' to 3' DNA helicase.
The S. pombe pfh1+ Gene Is Essential
Integrative transformation was used to delete 1492 bp from one of
the two copies of pfh1+ in a diploid
strain. The deletion was marked by insertion of the
ura4+ gene in an otherwise ura4
strain. The
pfh1+/pfh1-D1::ura4+
diploid was sporulated, and 100 random spores were all found to be
ura4
. When tetrads from a
pfh1+/pfh1-D1::ura4+
diploid were dissected, only two of the four spores formed large colonies, and the large colonies were all
ura4
, confirming that
pfh1+ was an essential gene (Figure
3A). The
pfh1-D1::ura4+ spores
formed microcolonies with 1-10 cells in which the individual cells
were often elongated (as in Figure 3B).
|
We constructed versions of pfh1+ that were
expressed from the thiamine-repressible nmt promoter (Basi
et al., 1993
; Maundrell, 1993
). These plasmids were
introduced into the
pfh1+/pfh1-D1::ura4+
diploid strain, and the diploid sporulated. Even when the weakest nmt1 promoter was used, the nmt1-driven
pfh1+ gene was able to complement the
pfh1-D1 strain in medium containing thiamine. This
nmt-driven pfh1+ gene's
ability to rescue the lethality of the
pfh1-D1::ura4+ strain
showed that the phenotypes attributed to loss of Pfh1p were not due to
reduced expression of a neighboring gene and also demonstrated that
very little Pfh1p was needed for viability.
S. pombe Cells Lacking Pfh1p Proceed through S Phase but Have Shorter Telomeres and an Elongated Cellular Phenotype
To obtain larger numbers of
pfh1-D1::ura4+ cells,
the
pfh1+/pfh1-D1::ura4+
diploid was sporulated, and then spores were grown in liquid medium
lacking uracil. As a control, a
pfh1+/pfh1+
ura4
/ura4
diploid strain was treated in the same way. As demonstrated by others,
ura4
spores do not germinate in medium
lacking uracil (see, for example, Waseem et al., 1992
). As
expected, no germinated spores were seen in the wild-type culture. In
contrast, the
pfh1+/pfh1-D1::ura4+
culture germinated, and at least some cells divided one or more times,
producing a culture in which the cell number was two- to threefold
higher than in the starting culture. Because only the pfh1-D1::ura4+ cells
could divide in the absence of uracil, these methods yielded a
population of cells depleted for Pfh1p.
The DNA of the
pfh1-D1::ura4+ cells
was stained, and cells were observed by confocal microscopy (Figure
3B). For comparison, we sporulated a
pfh1+/pfh1+,
but otherwise isogenic diploid strain in media containing uracil (Figure 3C). By 20 h postsporulation,
pfh1-D1::ura4+ cells
appeared elongated compared with wild-type cells, indicative of cells
that are able to grow but not divide (Waseem et al., 1992
;
see, for example, Kelly et al., 1993
). This difference in cellular morphology was apparent at ~14 h postsporulation. At various
times during germination, samples of wild-type and the pfh1-D1::ura4+ mutant
cells were stained with propidium iodide and analyzed by FACS. Like
wild-type cells, DNA replication was detectable 10 h
postgermination in the
pfh1-D1::ura4+ cells
(Figure 4). By 20-22 h, the vast
majority of cells in both the wild-type and mutant cultures had a 2C
DNA content. Thus, upon depletion of Pfh1p, arrested cells accumulated
with replicated genomes resembling the steady-state distribution of
wild-type cultures.
|
We also examined telomere length in DNA from
pfh1-D1::ura4+ mutant
cells (Figure 5A). S. pombe
has six telomeres, each bearing ~300 bp of telomeric repeats
(Sugawara, 1989
). Five of the six telomeres also have at least 19 kb of
subtelomeric DNA. The other telomere, which generates a 0.9-kb fragment
after HinfI digestion (Figure 5A, righthand lanes) is
immediately abutted to the rDNA locus (Sugawara, 1989
). Telomeric DNA
from pfh1-D1::ura4+
cells was 40-60 bp shorter than telomeric DNA from
pfh1+ cells (Figure 5A). The telomere
adjacent to the rDNA that generates the 0.9-kb HinfI
fragment appeared to be less affected than the other telomeres.
Although the effect on telomere length was small, it was reproducible,
being seen in DNA prepared from two independent sporulations,
restricted with three different enzymes (HinfI and ApaI, Figure 5A, and EcoRI), and run on
multiple gels. Similar amounts of telomere shortening were seen 16, 20, and 24 h after germination (Figure 5A). The shortening of DNA was
specific to telomeres, because rehybridization of the same gels with a
subtelomeric or other internal sequences (Figure 5, B and C)
showed that the mobility of these sequences was not affected. There was
no detectable change in rDNA (Figure 5B) or mitochondrial DNA (Figure
5D) in pfh1-D1::ura4+
cells.
|
Maintenance of Telomeric DNA Is Not the Sole Essential Function of Pfh1p
Although most S. pombe cells die when they lack
telomerase, a small subset of cells survives. In most of these
survivors, the three S. pombe chromosomes lose the simple
repeats at the very ends of the chromosomes as well as much of the
subtelomeric TAS elements and fuse end to end to generate circular
chromosomes (Naito et al., 1998
; Nakamura et al.,
1998
). If replication of telomeric DNA were the sole essential function
of Pfh1p, it should be possible to delete
pfh1+ in a strain with circular chromosomes.
Because cells with circular chromosomes are not viable in meiosis
(Naito et al., 1998
; Nakamura et al., 1998
), we
could not sporulate a
pfh1+/pfh1-D::ura4+
diploid having circular chromosomes to obtain the desired strain. Rather, we used two alternative approaches. In the first experiment, we
used a trt1
survivor strain CF448
(Nakamura et al., 1998
) that had been shown previously to
have circularized chromosomes. We transformed this haploid strain with
the pfh1D1::ura4+
fragment that was used previously to disrupt
pfh1+ in diploid cells, selecting for
Ura+ cells. As a control for transformation
efficiency, we transformed the same strain with both the
pfh1D1::ura4+
fragment and a LEU2 pfh1+ plasmid,
selecting for Ura+ Leu+
cells. Although we got hundreds of transformants when we cotransformed with the pfh1+ plasmid, in two independent
experiments, we obtained only a few Ura+
transformants with the pfh1 disruption fragment alone, and
Southern analysis revealed that none of these rare
Ura+ transformants had integrated at the
pfh1+ locus. In the second approach, we
disrupted the trt1+ gene as described
(Nakamura et al., 1998
) in a
pfh1-D1::ura4+
haploid yeast that carried a LEU2 plasmid with the
pfh1+ gene. We isolated survivors and then
asked if these survivors could lose the
pfh1+ LEU2 plasmid. Out of 700 survivors, none generated subclones that were able to grow on plates
lacking leucine. In contrast, 17% of the survivors generated in a
trt1- pfh1+ strain lost a LEU2
pfh1+ plasmid. Thus,
pfh1+ is essential even in strains that
lack telomeric DNA.
The Inviability of pfh1-D1::ura4+ Cells Was Not Due to Lack of Mitochondrial DNA
Mitochondrial DNA is lost at a high rate in S. cerevisiae cells that lack Pif1p (Foury and Kolodynski, 1983
;
Schulz and Zakian, 1994
). Because wild-type S. pombe cannot
survive without mitochondrial DNA (Munz et al., 1989
), if
Pfh1p were needed to maintain mitochondrial DNA, it would explain the
inviability of
pfh1-D1::ura4+
strains. Although wild-type S. pombe cells require
mitochondrial DNA, cells lacking mitochondrial DNA are viable in a
ptp1-1
strain (Haffter and Fox, 1992
).
Thus, if the only essential function of Pfh1p is to maintain
mitochondrial DNA, a ptp1-1
pfh1-D1::ura4+ strain
should be viable. To test this possibility, a
ptp1-1
haploid strain was mated to a
pfh1-D1::ura4+ strain
that carried the pfh1+ gene on a plasmid.
Twenty-five of the 33 tetrads that were dissected from this cross had
only two viable spores, and the two nonviable spores often gave rise to
cells with an elongated phenotype similar to that of the
pfh1-D1::ura4+ cells
shown in Figure 3B. The four tetrads with more than two viable spores
were due to the pfh1+ plasmid being
retained in a
pfh1-D1::ura4+ spore.
Because 14 of 30 viable spore progeny had the
ptp1-1
mutation,
ptp1-1
was not genetically linked to
pfh1-D1::ura4+.
Because the ptp1-1
mutation did not
rescue a
pfh1-D1::ura4+
strain, maintenance of mitochondrial DNA cannot be the sole essential function of pfh1+. The presence of
mitochondrial DNA in
pfh1-D1::ura4+ cells
supports this interpretation (Figure 5D).
|
strains
have no evident mitochondrial defect, deleting RRM3 in a
pif1
strain partially suppresses the loss of
mitochondrial DNA caused by deleting PIF1. These results suggest that Rrm3p has some role in mitochondrial DNA metabolism, at
least in the absence of Pif1p (V.P. Schulz and V.A. Zakian, unpublished
results). Although Pfh1p did not appear to be required to maintain
mitochondrial DNA, it is possible that Pfh1p, like the S. cerevisiae Rrm3p, has some role in mitochondria. To assess if
Pfh1p might function in mitochondria, we used computer programs to
predict its likely subcellular localization. The subcellular localization program PSORT II (http://psort.nibb.ac.jp) predicted that the S. pombe Pfh1p as well as the S. cerevisiae Pif1p and Rrm3p are targeted to both the nucleus and to
mitochondria. In addition, we scanned Pfh1p for mitochondria targeting
signals using MitoProt II
(http://www.mips.biochem.mpg.de/proj/medgen/mitop/). Both PSORT II and
MitoProt II base the likelihood of mitochondria targeting on the amino
acid composition of the N-terminal region of the protein. MitoProt II
predicts the probability of localization to the mitochondria to be
0.9877, 0.9326, and 0.9264 for Pif1p, Rrm3p, and Pfh1p, respectively.
Importantly, other helicases not believed to be found in the
mitochondria such as Sgs1p and Rqh1p, the S. cerevisiae and
S. pombe homologues of the Bloom's and Werner's syndrome
helicases, were not predicted to possess mitochondria targeting
sequences by these programs.
The ATPase/Helicase Activity Is Required for Its Essential In Vivo Function
Some genes that encode DNA helicases, for example the S. cerevisiae RAD3 and DNA2 genes, are essential for
viability yet the helicase activity of their products is not required
for their essential function (Sung et al., 1988
; Formosa and
Nittis, 1999
; Budd et al., 2000
). To determine if the
helicase activity of Pfh1p is essential, we used site-directed
mutagenesis to modify an invariant lysine in the ATP-binding domain of
motif I to either alanine (K337A) or arginine (K337R). Mutations in
this residue eliminate the activity of all helicases in which they have
been tested (Gorbalenya and Koonin, 1993
), including Pif1p (Zhou
et al., 2000
). A his3+ plasmid
carrying either the wild-type pfh1+ gene
or one of the two point mutation alleles, pfh1-K337A or pfh1-K337R, were introduced into two different
pfh1-D1::ura4+
strains, VPS612 and VPS613. The two S. pombe strains were
identical except that VPS612 had a LEU2 plasmid containing
the wild-type pfh1+ gene under the control
of its own promoter and VPS613 had a LEU2 plasmid containing
the pfh1+ gene under the control of the
nmt1 promoter (the S. cerevisiae LEU2 gene
complements an S. pombe leu1
strain).
Leu+ His+ transformants
were isolated and then streaked two times on medium lacking histidine
but containing leucine. Growth on medium containing leucine allowed
cells to lose the LEU2 plasmid. However,
Leu
cells could only be generated if the
his3+ plasmid could supply the essential
function of Pfh1p. S. pombe strains VPS612 or VPS613
carrying the wild-type pfh1+
his3+ plasmid readily lost the
LEU2 plasmid: in these strains, 74% or 98% of the cells
were Leu
after cells were streaked twice on
medium containing leucine. In contrast, Leu
cells were not recovered when the his3+
plasmid had either the pfh1-K337R or pfh1-K337A
alleles (Table 2). Thus, the K337A and the K337R alleles were unable to
supply the essential function(s) of Pfh1p.
|
| |
DISCUSSION |
|---|
|
|
|---|
's. The sequence ends with the ClaI site (denoted with
italics) used to clone phf1+ into plasmid pVS110
(see MATERIALS AND METHODS).
We purified a truncated form of Pfh1p (Figure 1) and demonstrated that
it had both ATPase (Figure 2A) and 5' to 3' DNA helicase activity
(Figure 2D). Because alleles with point mutations in the ATP binding
motif of Pfh1p were indistinguishable from null alleles (Table 2), the
ATPase/helicase function of Pfh1p was essential. Cells lacking Pfh1p
underwent essentially a complete or nearly complete round of DNA
replication (Figure 4) before arresting as elongated cells (Figure 3B).
Although elongated cell morphology is not a highly specific phenotype,
many S. pombe mutants with postinitiation defects in DNA
replication have an appearance similar to that of
pfh1-D1::ura4+ cells
(Muris et al., 1996
; Gould et al., 1998
).
Although the S. cerevisiae Pif1 and Rrm3 proteins affect
mitochondrial DNA and rDNA (see Introduction), we saw no difference in
the structure of mitochondrial DNA or rDNA in mutant versus wild-type
cells by Southern hybridization (Figure 5). This level of Southern
analysis would detect the types of differences seen in the
mitochondrial DNA of most mitochondrial-deficient S. cerevisiae strains but would not detect more subtle changes in
abundance or structure of either ribosomal or mitochondrial DNA (Figure 5, B and D). Cytological observations also showed that many
Pfh1p-depleted cells contained mitochondrial DNA (Figure 3B), and the
lethality of the
pfh1-D1::ura4+
mutation was not bypassed by the ptp1-1 mutation, which
allows growth of S. pombe cells lacking mitochondrial DNA
(Haffter and Fox, 1992
). Taken together, these data argue that
maintenance of mitochondrial DNA is unlikely to be the essential
function of Pfh1p. However, given that Pfh1p was predicted to localize to both mitochondria and nuclei, it might have a nonessential role in
mitochondrial DNA metabolism.
Cells lacking Pfh1p exhibited a modest decrease in telomere length
(Figure 5A). Because this decrease was manifest by 16 h, persisted
for at least 8 h, and was not seen with nontelomeric DNA
fragments, it was unlikely to be due to DNA degradation in dying cells.
The extent of telomere shortening in
pfh1-D1::ura4+ cells
was similar to that seen in several mutants defective in both DNA
replication and DNA damage checkpoints (Dahlen et al., 1998
)
or for mutants in either of the two S. pombe ATM-like genes (Naito et al., 1998
). Despite the role of Pfh1p in
maintaining wild-type length telomeres, eliminating telomeric DNA did
not eliminate the requirement for Pfh1p. Thus, although Pfh1p may affect telomeres, maintenance of telomeric DNA cannot be its sole essential function.
Our data suggest that Pfh1p is essential because it plays a vital role
in chromosomal DNA replication. The strongest support for this
hypothesis is the essentiality (Table 2) of the 5' to 3' DNA helicase
activity it encodes (Figure 2). A terminal phenotype similar to that of
mutants with defects in DNA replication (Figure 3B) is consistent with
a role for Pfh1p in chromosome replication. An appealing possibility is
that Pfh1p, like the S. cerevisiae Rrm3p (Ivessa et
al., 2000
), is required to separate converged replication forks in
specific regions of the genome.
| |
ACKNOWLEDGMENTS |
|---|
We thank T. Fox for strains and probes for studying S. pombe mitochondrial DNA, L. Guarente for the S. pombe cDNA library, W. Wahls for the S. pombe genomic library, and C. Davies for the Tn3 sequencing deletion kit. They also thank T. Enoch, S. Forsburg, K. Gould, T. Nakamura, P. Szankasi, W. Wahls, and N. Walworth for S. pombe methods and advice; A. Ivessa, J. Torres and L. Vega for comments on the manuscript; and R. Jiang for help with one of the experiments. This work was funded by postdoctoral fellowships from the U.S. Army Breast Cancer program (H.Q.), the American Cancer Society (V.P.S.), the Cancer Research Fund of the Damon Runyon-Walter Winchell Foundation (M.K.M.), and the National Institutes of Health (E.M.) as well as by grants R37 GM26938 and PO1 CA41086 (V.A.Z.).
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
vzakian{at}molbio.princeton.edu.
* Both authors contributed equally to this work.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.02-02-0021. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.02-02-0021.
| |
REFERENCES |
|---|
|
|
|---|
genomes having tandemly arrayed repeat units in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
80, 5345-5349
function relationships.
Curr. Opin. Structr. Biol.
3, 419-429.
and cloning of the genome in small fragments.
Mol. Gen. Genet.
196, 465-472[CrossRef][Medline].
accessory protein PCNA.
EMBO J.
11, 5111-5120[Medline].This article has been cited by other articles:
![]() |
S. F. Pinter, S. D. Aubert, and V. A. Zakian The Schizosaccharomyces pombe Pfh1p DNA Helicase Is Essential for the Maintenance of Nuclear and Mitochondrial DNA Mol. Cell. Biol., November 1, 2008; 28(21): 6594 - 6608. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gu, Y. Masuda, and K. Kamiya Biochemical analysis of human PIF1 helicase and functions of its N-terminal domain Nucleic Acids Res., November 1, 2008; 36(19): 6295 - 6308. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Rossi, J. E. Pike, W. Wang, P. M. J. Burgers, J. L. Campbell, and R. A. Bambara Pif1 Helicase Directs Eukaryotic Okazaki Fragments toward the Two-nuclease Cleavage Pathway for Primer Removal J. Biol. Chem., October 10, 2008; 283(41): 27483 - 27493. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Rogers, M. P. Challen, S. Muthumeenakshi, S. Sreenivasaprasad, and J. M. Whipps Disruption of the Coniothyrium minitans PIF1 DNA helicase gene impairs growth and capacity for sclerotial mycoparasitism Microbiology, June 1, 2008; 154(6): 1628 - 1636. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Snow, M. Mateyak, J. Paderova, A. Wakeham, C. Iorio, V. Zakian, J. Squire, and L. Harrington Murine Pif1 Interacts with Telomerase and Is Dispensable for Telomere Function In Vivo Mol. Cell. Biol., February 1, 2007; 27(3): 1017 - 1026. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-B. Boule and V. A. Zakian Roles of Pif1-like helicases in the maintenance of genomic stability Nucleic Acids Res., September 10, 2006; 34(15): 4147 - 4153. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-H. Zhang, B. Zhou, Y. Huang, L.-X. Xu, and J.-Q. Zhou The human Pif1 helicase, a potential Escherichia coli RecD homologue, inhibits telomerase activity Nucleic Acids Res., March 6, 2006; 34(5): 1393 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Mohanty, N. K. Bairwa, and D. Bastia The Tof1p-Csm3p protein complex counteracts the Rrm3p helicase to control replication termination of Saccharomyces cerevisiae PNAS, January 24, 2006; 103(4): 897 - 902. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-B. Chen, C.-P. Yang, R.-X. Li, R. Zeng, and J.-Q. Zhou Def1p Is Involved in Telomere Maintenance in Budding Yeast J. Biol. Chem., July 1, 2005; 280(26): 24784 - 24791. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Bessler and V. A. Zakian The Amino Terminus of the Saccharomyces cerevisiae DNA Helicase Rrm3p Modulates Protein Function Altering Replication and Checkpoint Activity Genetics, November 1, 2004; 168(3): 1205 - 1218. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-H. Ryu, H. Tanaka, D.-H. Kim, J.-H. Kim, S.-H. Bae, Y.-N. Kwon, J. S. Rhee, S. A. MacNeill, and Y.-S. Seo Genetic and biochemical analyses of Pfh1 DNA helicase function in fission yeast Nucleic Acids Res., August 9, 2004; 32(14): 4205 - 4216. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tanaka, G.-H. Ryu, Y.-S. Seo, K. Tanaka, H. Okayama, S. A. MacNeill, and Y. Yuasa The fission yeast pfh1+ gene encodes an essential 5' to 3' DNA helicase required for the completion of S-phase Nucleic Acids Res., November 1, 2002; 30(21): 4728 - 4739. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||