Molecular Biology of the Cell track citations

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E02-01-0022 on June 20, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E02-01-0022v1
13/8/2933    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sánchez-Pérez, I.
Right arrow Articles by Perona, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sánchez-Pérez, I.
Right arrow Articles by Perona, R.

Vol. 13, Issue 8, 2933-2945, August 2002

Cell Stress and MEKK1-mediated c-Jun Activation Modulate NFkappa B Activity and Cell Viability

Isabel Sánchez-Pérez, Salvador Aznar Benitah, Montserrat Martínez-Gomariz, Juan Carlos Lacal, and Rosario Perona*

Instituto de Investigaciones Biomédicas Consejo Superior de Investigaciones Cientificas-Universidad Autónoma de Madrid, 28029 Madrid, Spain

Submitted January 15, 2002; Revised April 29, 2002; Accepted May 31, 2002
Monitoring Editor: Carl-Henrik Heldin

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Chemotherapeutic agents such as cisplatin induce persistent activation of N-terminal c-Jun Kinase, which in turn mediates induction of apoptosis. By using a common MAPK Kinase, MEKK1, cisplatin also activates the survival transcription factor NFkappa B. We have found a cross-talk between c-Jun expression and NFkappa B transcriptional activation in response to cisplatin. Fibroblast derived from c-jun knock out mice are more resistant to cisplatin-induced cell death, and this survival advantage is mediated by upregulation of NFkappa B-dependent transcription and expression of MIAP3. This process can be reverted by ectopic expression of c-Jun in c-jun-/- fibroblasts, which decreases p65 transcriptional activity back to normal levels. Negative regulation of NFkappa B-dependent transcription by c-jun contributes to cisplatin-induced cell death, which suggests that inhibition of NFkappa B may potentiate the antineoplastic effect of conventional chemotherapeutic agents.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Induction of apoptosis is the primary mechanism of tumor cell killing by radiation and chemotherapeutic agents. Abundant literature has implicated different caspases as the executionery elements at the onset stage of the apoptotic process (Enari et al., 1998). However, the initial events responsible for the later phases of cell death are poorly understood.

Different types of stress such as treatment with DNA-damaging agents used in cancer therapy induce the activation of protein kinase cascades that include the c-jun-N-terminal kinases (JNKs) and the p38 MAP kinase. Each MAP kinase subfamily is activated by a specific upstream MAP kinase kinase (MKKs), which phosphorylates both threonine and tyrosine residues within a conserved T-X-Y motif (Hibi et al., 1993; Dérijard et al., 1994; Kyriakis et al., 1994). These residues are dephosphorylated by dual-specific protein phosphatases, resulting in the inactivation of MAP kinases (Keyse, 2000). Activation of MAP kinase family members leads to phosphorylation of numerous cellular effectors, including protein kinases such as MAPKAPK1, MAPKAP-K2/3, Mnk1/2, and transcription factors such as c-jun, ATF-2, MEF2c, and CHOP, which are responsible for the fate of the cell (Alpert et al., 1999).

cis-Diaminedichloroplatinum (c-DDP, cisplatin) is a DNA-reactive agent commonly used in chemotherapy protocols in the treatment of several kinds of human cancers. Lesions of c-DDP on DNA include intrastrand 1,2-d(GpG), 1,2-d(ApG), 1,3-d(GpNpG), and interstrand cross-link (Fichtinger-Shepman et al., 1985). Like many anticancer agents, c-DDP induces a sustained activation of JNK and p38 (Sánchez-Pérez et al., 2000). Activation of JNK takes place via the MEKK1/SEK1 cascade and is directly related to cell death (Sánchez-Pérez and Perona, 1999). Dephosphorylation and inactivation of JNK by the dual-specific phosphatases CL100 and hVH5 result in protection against cisplatin-induced apoptosis (Sánchez-Pérez et al., 2000). Furthermore, both phosphatases are able to inhibit transcriptional activation of c-Jun, the main physiological substrate of JNK (Kyriakis et al., 1994).

We have previously shown that c-Jun is necessary for the induction of apoptosis in response to cisplatin. A cell line derived from a c-jun knock out mouse is more resistant than normal cells to cisplatin-induced cell death (Sánchez-Pérez and Perona, 1999). This effect is specific to c-Jun because transfection of c-jun into the c-jun-/- cell line, restores its endogenous activity, which results in a phenotype similar to that of parental cells. The role of c-Jun in apoptosis has been described in other cell lines, such as PC12 cells, which undergo apoptosis after NGF withdrawal in a c-jun-dependent mechanism (Ham et al., 1995). In agreement with these results, constitutive expression of c-Jun in NIH3T3 cells induces apoptosis upon serum deprivation (Ham et al., 1995; Bossy-Wetzel et al., 1997).

Little is known about molecules involved in the induction of apoptosis whose expression is regulated by the c-Jun transcription factor. Fas Ligand appears to participate in DNA-damage-induced apoptosis, and its expression seems to depend partially on activation of the JNK pathway (Kasibhatla et al., 1998)

NFkappa B comprises a family of inducible transcription factors that act as regulators of the host immune and inflammatory response (Collart et al., 1990; Libermann and Baltimore, 1990; Zhang et al., 1990). They also have been involved in protecting cells from apoptosis induced by chemotherapeutic agents (Wang et al., 1999; Baldwin, 2001) or cytokine treatment (Baldwin, 2001). NFkappa B is a heterodimer composed of p50 and p65/RelA subunits. In unstimulated cells, NFkappa B is found mainly in the cytoplasm associated with a family of inhibitory molecules known as Ikappa Bs (Finco and Baldwin, 1995; Matthews and Hay, 1995; Yin et al., 1998). The activation mechanism of NFkappa B involves the phosphorylation of Ikappa Bs in two critical serine residues (Ser32 and Ser36) via the Ikappa B kinase (IKK) signalosome complex (Brown et al., 1995; Traenckner et al., 1995; Whiteside et al., 1995; DiDonato et al., 1996; O'Connell et al., 1998). Two different kinases that phosphorylate IKKs have been described: NFkappa B-induced kinase (NIK; Malinin et al., 1997) and MEKK1 (Lee et al., 1998). Once Ikappa Bs are phosphorylated, they are targeted for ubiquitination and subsequent degradation by the 26S proteosome. Free p50/p65 heterodimers translocate to the nucleus, where they activate transcription of NFkappa B responsive genes (Baldwin, 1996; Ghosh et al., 1998). However, there is increasing evidence that an alternative mechanism of NFkappa B activation that involves phosphorylation of the p65/RelA transactivation subunit takes place (Schmitz et al., 2001). A number of kinases have been shown to phosphorylate p65 NFkappa B, including the catalytic subunit of protein kinase A (PKAc), whose activity leads to association of p65/RelA with the CREB-binding protein/p300 (CBP/p300) transcriptional activator (Zhong et al., 1998). In addition, AKT/PKB a potent regulator of cell survival, can stimulate the transactivation domain of p65/RelA in a manner that is dependent on IkB kinase and the p38 MAPK activities (Baldwin, 1996; Madrid et al., 2001).

Here we show that treatment of cells with cisplatin induces cell death by modulating both survival and proapoptotic pathways. We have found that activation of MEKK1 by cisplatin upregulates cell death by inducing AP-1-mediated FasL transcription. In parallel, cisplatin also activates NFkappa B through MEKK1, and this activation is modulated by c-Jun, the main substrate of the JNK pathway. In the absence of c-Jun expression, cells are more resistant to cisplatin, and this correlates with an increase in MEKK1-NFkappa B-dependent transcription. Accordingly, when NFkappa B activation was impaired in jun-/- fibroblasts by expression of the Ikappa B---SR (a degradation resistant form of Ikappa Balpha ), resistance to cisplatin was reverted to levels similar to that of wild-type cells. The regulation of NFkappa B-dependent transcription occurs by the interference of c-jun with p65 transcriptional activation. These findings suggest that chemotherapeutic agents such as cisplatin upregulate proapoptotic pathways, through c-jun-dependent FasL transcription and simultaneous downregulation of survival pathways that are dependent on NFkappa B transcription.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell Culture, Antibodies, and Reagents

Human embryonic kidney fibroblast cells (293T) were maintained in DMEM supplemented with 10% fetal bovine serum. NIH3T3 cells derived from c-jun knock out mice were cultured in the same medium but supplemented with 5% fetal bovine serum. c-jun-/- and WT cells were obtained from Erwin Wagner (Hilberg et al., 1993; Schreiber et al., 1995). Jun-/+ cells have been previously described (Sánchez-Pérez and Perona, 1999). Phosphorylated forms of JNK were detected with antiphospho JNK (Promega, Madison, WI) antibody. Anti-Fas ligand, anti-Ikappa Balpha (C-21), antiphospho.-Ikappa Balpha (B9) and anti-IKKalpha (77-280) were from Santa Cruz Biotechnology (Santa Cruz, CA). Cisplatin, etoposide, cycloheximide, and thricostatin were purchased from Sigma (St. Louis, MO), and TNF-alpha was purchased from Upstate Biotechnology (Lake Placid, NY).

Plasmids

(-453/+80) HIVLUC contains the NFkappa B sites of the HIV promoter, and Delta  NFkappa B HIVLUC contains a three-base pair substitution in each of the NFkappa B binding sites (Devary et al., 1993). The following plasmids have been already described: GAL4c-Jun (1-223), pCDNAIII derived-MEKK1, pMEKK1 (K-R; Perona et al., 1997), pMEKK6 and p38alpha (Tamura et al., 2000), RC-CMV-IkBalpha -Ala32/Ala36 (IkBalpha -SR; Whiteside et al., 1995), pSG5CL100 (Sánchez-Pérez et al., 2000), and 1xSIE-CAT (Aznar et al., 2001). PCDNAI-c-jun and RCCMV-p65 were obtained from Rodrigo Bravo (Montaner et al., 1998). P-Gal4-p65TAD1 was obtained from Lienhard Schmitz (Schmitz et al., 1995). PCMV-CBP was obtained from Harel-Bellan (Polesskaya et al., 2001). Fas ligand luciferase reporter constructs encoding for a 0.9-kb fragment of the FasL promoter were provided by Douglas Green (Kasibhatla et al., 1998), and p-GST-IkBalpha was obtained from Mark Hannink (Sachdev and Hannink, 1998).

Transfection and Analysis of Gene Expression

For transient transfection assays, 293T cells were transfected by the calcium phosphate method as described previously (Sánchez-Pérez and Perona, 1999). The total amount of DNA was kept constant at 5 µg per plate with the corresponding empty vector. When indicated, the cells were stimulated for different times and harvested 24 h after transfection. Protein extracts were prepared by lysis with the commercially available reporter lysis buffer (Promega). The total amount of protein was determined with a commercial kit based on the Bradford method (Bio-Rad, Richmond, CA). NIH cells were transfected with Lipofectamine (GIBCO/BRL, Rockville, MD) in six-well plates with 2 × 105 cells per well. For transient transfection assays, the total amount of DNA transfected was brought up to 4 µg per well by addition of empty vector DNA.

For stable transfection, cells were transfected with 3.5 µg of pIkappa Balpha -SR expression plasmid and 0.5 µg of p-PUR plasmid (Clontech, Palo Alto, CA). Twenty-four hours after transfection, cells were selected for puromycin resistance. Luciferase assays were performed according to manufacturer's instruction (Promega), and beta -galactosidase (beta -gal) assays were done as previously described (Perona et al., 1997). Transfection efficiencies were corrected by cotransfection of p-CMVbeta -gal and by measuring beta -gal activity. Each assay was performed in triplicate, in a single experiment, and repeated in three different experiments with similar results. Chloranphenicol acetyltransferase (CAT) activity was assayed by using a xylene-based method, as described (Aznar et al., 2001).

Cell Extracts and Immunoblotting

Whole-cell lysates and nuclear extracts were prepared as described previously (Perona et al., 1997; Sánchez-Pérez et al., 1998). Western blotting was carried out by standard methods (Sánchez-Pérez et al., 1998).

EMSA

Nuclear extracts (2 µg of protein) from c-DDP (20 µg/ml) or TNF-alpha (10 ng/ml) treated cells were incubated with a 32P-labeled probe containing the NFkappa B binding site (Perona et al., 1997). Samples treated with c-DDP or TNF-alpha were incubated for supershift assays with preimmune serum, or antibodies specific for either p50 or p65. Extracts were incubated 15min with the corresponding antibody before probe binding. The protein-DNA complexes were analyzed by EMSA as previously described (Perona et al., 1997).

RNA Extraction and Reverse Transcriptase (RT)-PCR

Total RNA was isolated from cells using Trizol reagent (Life Technologies, Rockville, MD) following the manufacturer's instructions. For RT-PCR single-strand cDNA was synthesized from total RNA using a primer oligo(dT)12-18 and the Superscript reverse transcriptase (Clontech). Each cDNA was amplified by PCR using Taq DNA polymerase. The sequences of the primers were MIAP3-F (5'AGTGGGGCACCACATGTTAT-3') and MIAP3-R (5'CGGAAACAGTGCTGTTAGCA-3') and mouse beta -actin-F (5'GGTATGGAATCCTGTGGCATCCATGAAA3') and beta -actin-R (5'GTGTAAAACGCAG-CTCAGTAACAGTCCG 3'). The conditions for reactions were as follows: 1× (95°C, 1 min), 25× (95°C, 30 s; 55°C 1 min; 72°C, 30 s) and 1× (72°C, 3 min) and for beta -actin 1× (95°C, 1 min), 25× (95°C, 30 s; 60°C, 1 min; 72°C, 30 s) and 1× (72°C, 3 min). The products were analyzed on a 1% agarose gel and stained with ethidium bromide.

Inmunoprecipitation and Kinase Assays

Cells treated with c-DDP (20 µg/ml) were lysed in buffer A containing 100 mM NaCl, 50 mM Tris (pH 8.0), 1 mM sodium orthovanadate, 1 mM NaF, 0.5 mM B-glycerophosphate, and protease inhibitors. Two hundred micrograms of protein of each cell lysate were incubated with anti-IKKalpha antibody during 4 h, and 20 µl of protein A-agarose beads were added for 1 h. The inmunoprecipitation complex was extensively washed, and the kinase reaction mixture (10 µCi [32P]ATP, 2 mM MgCl2, 1 mM DTT in buffer A) was added to the agarose beads. All incubations were performed at 4°C. GST-Ikappa Balpha fusion protein containing amino acids 1-54 was incubated at 30°C for 25 min. The reaction mixtures were then subjected to SDS-PAGE and autoradiography.

Cell Viability Assay

The cell viability was determined using a crystal violet staining method as previously described (Sánchez-Pérez et al., 1998).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cisplatin Treatment Increases NFkappa B Activity

We have previously shown that persistent activation of JNK is involved in cisplatin-induced apoptosis (Sánchez-Pérez et al., 1998). In addition, cisplatin has been reported to induce activation of NFkappa B (Sodhi and Singh, 1998), a transcription factor involved in antiapoptotic processes. Thus, we have investigated the relationship between both pathways in cisplatin-induced cell death. 293T cells were treated with 20 µg/ml cisplatin, nuclear extracts were obtained, and NFkappa B binding activity was assayed by EMSA. A consensus kappa B binding sequence and specific antibodies to investigate the composition of the complexes were used for this purpose. We observed that cisplatin induces an increase in NFkappa B binding activity, with slow kinetics displaying maximal DNA-binding between 3 and 6 h after treatment and decreasing after 9 h (Figure 1). Both p50 and p65/RelA proteins were found in the retarded bands as demonstrated by inhibition in binding of the complexes to DNA by p50 and RelA specific antisera (Figure 1). Similar results were obtained with Pam212 or NIH3T3 cells.


View larger version (41K):
[in this window]
[in a new window]
 
Figure 1.   NFkappa B activation by c-DDP. 293T cells were treated with c-DDP (20 µg/ml) at the indicated times. Nuclear extracts were prepared, and EMSA was performed as described in MATERIALS AND METHODS. Lanes 10-12 represent competition of nuclear extracts obtained after stimulation with c-DDP for 3 h with p50, p65-specific antibodies, or cold NFkappa B consensus oligonucleotide (kappa B), respectively. Arrows show the migration of different NFkappa B complexes.

As we have reported before, cisplatin also induces activation of JNK via MEKK1/SEK1, with a delayed kinetics (Sánchez-Pérez and Perona, 1999) very similar to that observed for activation of NFkappa B complexes. Because MEKK1 also activates NFkappa B (Lee et al., 1998), we verified if activation of both NFkappa B and JNK upon cisplatin treatment share a common MEKK1-dependent pathway. 293T cells were transfected with the HIV luciferase (HIVLUC) reporter, and NFkappa B-dependent transcription was measured (Devary et al., 1993). Cisplatin treatment led to an increase in NFkappa B-dependent transcription. As well, transfection of an MEKK1 expression plasmid was able by itself to induce activation of NFkappa B, and a further increase in activity was observed upon treatment with cisplatin of MEKK1-expressing cells. Accordingly, transfection of a dominant negative form of MEKK1 (MEKK1/KR) prevented activation of NFkappa B, further indicating the role of this kinase in cisplatin-induced activation of the transcription factor. This activity was kappa B dependent, because no activation was observed when a HIVLUC reporter containing three-base pair substitutions in each NFkappa B binding site was used (Figure 2a). DNA-binding of NFkappa B upon cisplatin treatment was also dependent on MEKK1 activity, because ectopic expression of MEKK1 in 293T cells was able to induce translocation of kappa B binding complexes and expression of MEKK1 (KR) partially blocks the translocation (Figure 2b) in response to cisplatin. The translocation of active complexes (p50/p65) was also inhibited by expression of a plasmid repressor of Ikappa Balpha containing mutations in the two serines 32/36, phosphorylated by the Ikappa K complexes (Ikappa Balpha -SR).


View larger version (41K):
[in this window]
[in a new window]
 
Figure 2.   Activation of NFkappa B by c-DDP requires MEKK1. (a) Activation of the HIV promoter in 293T cells. 293T cells were cotransfected either with 0.5 µg of (-453/-80) HIVLUC or 0.5 µg. of Delta  NFkappa B (-453/-80) HIV-LUC per 60-mm plate, together with the following vectors: pcDNAIII and the derived vectors expressing MEKK1, MEKK1(KR). The total amount of expression vectors was 5 µg per 60-mm plate. Twenty-four hours after transfection, cells were treated with c-DDP (2.5 µg/ml), and luciferase activity was determined 8 h after treatment. Ratios obtained for the empty vectors were considered 1. Data shown in this figure represent the mean of a single experiment performed in triplicate ±SD and are representative of at least three experiments with similar results. (b) EMSA analysis of NFkappa B complexes induced by c-DDP in transiently transfected 293T cells. 293T cells were cotransfected with 3.5 µg of pcDNAIII empty vector or the derived vector containing Ikappa Balpha -SR, MEKK1, or MEKK1(KR). After 24 h cells were stimulated, when indicated, with 20g/ml c-DDP during 3 h. Nuclear extracts were assayed for gel retardation assay as indicated in Figure 1. Lanes 8 and 9: competition of nuclear extracts stimulated with c-DDP for 3 h with cold NFkappa B consensus oligonucleotide (CE) or mutated NFkappa B consensus oligonucleotide (CI). Arrows show the migration of different NFkappa B complexes. The experiment was repeated twice with similar results.

Cisplatin Induces FasL Expression through Activation of the SAPK Pathway

Recent studies have shown that the apoptotic response to chemotherapeutic agents in some cell types may proceed through the expression of FasL (Faris et al., 1998; Kasibhatla et al., 1998). To verify if FasL expression was induced by cisplatin, we treated 293T cells with cisplatin at various times and studied its expression by Western blot (Figure 3a). Expression of FasL was detected 9 h after treatment with cisplatin, at a time when both JNK and NFkappa B activities were present (Figure 1; Sánchez-Pérez et al., 1998). Regulation of FasL expression by some chemotherapeutic agents occurs at the transcriptional level and might involve the activation of NFkappa B and the SAPK pathway (Kasibhatla et al., 1998). Therefore, we next investigated whether cisplatin was able to modulate the FasL transcription. 293T cells were transiently transfected with a plasmid containing the FasL promoter joined to the luciferase gene as a reporter, and cells were treated for different times with cisplatin. The results shown in Figure 3b indicate that cisplatin induces activation of the FasL promoter almost up to fourfold, in a similar magnitude to the positive control etoposide (Kasibhatla et al., 1998). Because cisplatin seems to activate both SAPK/JNK and the NFkappa B pathway through activation of MEKK1, we tested the involvement of this kinase in the activation of FasL promoter by cisplatin. 293T cells were contransfected with the FasL promoter reporter and either the MEKK1 or MEKK1(KR) expression vectors. The results shown in Figure 3c indicate that expression of MEKK1 increases both the basal and cisplatin-induced activity of this promoter. MEKK1 is required for activation of the FasL promoter in response to cisplatin because expression of the MEKK1(KR) construct abolishes transcription of the FasL promoter by this drug. The promoter construct used in our assays contains both the AP-1 and NFkappa B binding sites that control FasL transcription (Kasibhatla et al., 1998). Thus the relative contribution of these two transcription factors in FasL transcription was verified by specifically inhibiting both pathways. 293T cells were cotransfected with the Ikappa Balpha -SR and MEKK1 expression vectors together with the FasL promoter construct. Transcriptional activation of FasL promoter was not dependent on the NFkappa B pathway (Figure 3d, top panel). As a functional control of IkBalpha -SR inhibition, MEKK1-dependent transcription of HIV-luc is inhibited under similar conditions (Figure 3d, bottom panel). However, inhibition of JNK by transient expression of the CL100 dual phosphatase (Sánchez-Pérez et al., 2000) abolishes MEKK1-dependent activation of the FasL promoter (Figure 3e). Altogether these results indicate that although cisplatin and MEKK1 activate both NFkappa B and JNK pathways, only JNK plays a positive role in the transcription of the FasL promoter, and therefore, this could represent a proapoptotic mechanism of the JNK pathway in response to cisplatin.


View larger version (24K):
[in this window]
[in a new window]
 
Figure 3.   c-DDP induces Fas ligand expression through the activity of the JNK pathway. (a) Levels of expression of FasL after treatment with c-DDP. 293T cells were exposed to c-DDP at 10 µg/ml. At the indicated times cultured cells were collected, and FasL expression examined by immunoblotting using a polyclonal antiserum against FasL. (b) Regulation of the transcriptional activation of the FasL promoter by c-DDP and etoposide. 293T cells were transiently transfected with 1 µg of FasL-LUC reporter plasmid. Twenty-four hours after transfection, cells were treated with 2.5 µg/ml c-DDP or 5 mM Etoposide for different times. Cells were lysed and analyzed for luciferase activity. The fold increase in luciferase activity was calculated based on the values for untreated cells. These data are representative of three experiments. (c) Luciferase activity showing the effect of MEKK1 and MEKK1 (KR) expression on FasL promoter activation by stress stimuli. 293T cells were transiently cotransfected with 1 µg of FasL-Luc construct and 2 µg of MEKK1 or MEKK1 (KR). Twenty-four hours after transfection cells were treated with c-DDP. The cells were lysed 5 h later and analyzed for luciferase activity. Fold increase in luciferase activity was calculated based on the value for untreated control cells. (d and e) Contribution of AP1 and NFkappa B transcription factor on FasL promoter activation. 293T cells were transiently cotransfected with 1 µg of FasL-Luc (d, top panel) or HIV-LUC (d, bottom panel) construct and either 2 µg of pMEKK1, 2 µg of IKBalpha -SR, or 2 µg of CL100. Luciferase activity was analyzed as in c. Data shown in this figure represent the mean of a single experiment performed in triplicate ±SD and are representative of at least three experiments with similar results.

Inhibition of the NFkappa B Pathway Reverts Cisplatin Resistance of Cells

We have previously demonstrated that fibroblasts derived from jun-/- embryos show a higher ID50 for cisplatin than parental NIH3T3 cells (Sánchez-Pérez and Perona, 1999). Moreover, when c-jun expression is restored in c-jun-/- cells, the resultant cell line c-jun-/+ is more sensitive to cisplatin (Sánchez-Pérez and Perona, 1999). As well, inhibition of JNK activation by expression of the CL100 dual phosphatase specifically inhibits cisplatin-induced apoptosis (Sánchez-Pérez et al., 2000). Work from other laboratories has identified NFkappa B-regulated genes as mediators of cell survival to proapoptotic stimuli (Baldwin, 2001; Barkett and Gilmore, 1999) Thus, we investigated the physiological role of NFkappa B activation in the behavior of the parental WT cells and jun-/- cells upon cisplatin treatment. Stable cell lines were generated by transfecting Ikappa Balpha -SR into WT and c-jun-/- cells (WT/Ikappa Balpha and c-jun-/-/IkBalpha , which were tested for sensitivity to cisplatin. As a functional control of the dominant negative activity of Ikappa Balpha -SR, these cells were treated with TNF-alpha and HIVLUC reported activity was assayed. As shown in Figure 4a, both cell lines showed impaired NFkappa B activation upon TNF-alpha treatment when compared with the parental cell lines.


View larger version (20K):
[in this window]
[in a new window]
 
Figure 4.   (a) Activation of HIV promoter by TNF-alpha in NIH cell lines of different genotypes for c-jun. Cells were transfected by lipofectamine with 0.5 µg of (-453/-80) HIVLUC per well. Twenty-four hours after transfection cells were exposed to TNF-alpha 10 ng/ml for 5 h. The luciferase activity was determined as in Figure 2. Data shown in this figure represent the mean of a single experiment performed in triplicate ±SD and are representative of at least three experiments with similar results. (b) Cell viability after incubation with different doses of c-DDP in WT, Jun -/-, WT/Ikappa B, Jun -/-/Ikappa B. Viability was measured by the crystal violet-based staining method 48 h after treatment. (c) jun-/- and jun-/-/IKB cell lines were exposed to 10 µg for the indicated times. Activated JNK was detected in Western blots using a specific antibody for phospho-JNK1/JNK2.

It should be noted that c-jun-/- cells showed a fivefold increase in basal NFkappa B activity with respect to WT cells (Figure 4a). We then used all four cell lines to test the viability after cisplatin treatment. As expected, c-jun-/- cells are more resistant to cisplatin-induced cell death (Sánchez-Pérez and Perona, 1999) than the parental WT cells. On the other hand c-jun-/-/Ikappa Balpha showed a similar increase in sensitivity to cisplatin and became similar to that of the parental WT cells. Moreover, expression of Ikappa Balpha -SR in the WT cells did not result in noticeable changes in viability toward cisplatin. The prolonged kinetics for JNK activation after cisplatin treatment is important for the induction of apoptosis (Sánchez-Pérez et al., 1998). However, we have observed that the differences observed in cisplatin sensitivity between c-jun-/- and c-jun-/-/Ikappa Balpha cells are not due to differences in the kinetics of JNK activation by cisplatin (Figure 4c). Thus, altogether these results suggest that the lower sensitivity to cisplatin observed in c-jun-/- cells is NFkappa B dependent.

Activation of c-Jun by the MEKK1/JNK Pathway Downregulates NFkappa B Transcription

Exposure of 293T cells to cisplatin activates MEKK1, and this pathway contributes, on one hand to c-Jun transcriptional activation and on the other to NFkappa B activation. Because c-jun-/- cells are less susceptible to cisplatin-induced cell death in a NFkappa B-dependent manner, we have studied the contribution of MEKK1 to NFkappa B activation in these cells. Cells of the three genotypes (c-jun+/+, c-jun-/-, and c-jun-/+) as well as the Ikappa B-alpha -expressing cells (WT/IkBalpha and jun-/-/Ikappa Balpha ) were cotransfected with the MEKK1 expression vector and the HIVLUC reporter plasmid (Figure 5a). Expression of MEKK1 is able to induce activation of the HIVLUC reporter in all cell lines with the exception of the IkBalpha degradation resistant-expressing cells. Interestingly, c-jun-/- cell line displays a drastic increase in NFkappa B activity with respect to WT cells, even if the basal NFkappa B activity in these cells is already higher than that of the WT cells (fivefold). This effect is specific of c-Jun, because c-jun-/+ cells showed an induction similar to that of WT cells. The differences observed are not due to changes in transfection efficiencies, because all luciferase values were normalized to that of an internal beta -gal control. As well, these differences between WT and c-jun-/- cells are specific for NFkappa B, because transcription dependent of STAT-3 (Figure 5b) and SRF was almost equal in both cell lines. Furthermore, the differences in NFkappa B activity are not due to changes in the levels of p65 or p50 because no variations in the expression of both transcription factors in cells treated with cisplatin were observed. Altogether, the results suggest that transcriptional activation of c-Jun triggered by MEKK1 in WT cells negatively regulates NFkappa B activation.


View larger version (19K):
[in this window]
[in a new window]
 
Figure 5.   (a) Cells from different genotypes for c-Jun, (WT, c-jun-/- c-jun-/+, WT/Ikappa Balpha , jun-/-/Ikappa B-alpha ) were transfected by lipofectamine with 0.5 µg of (-453/-80) HIVLUC per well and the expression vector encoding MEKK1 (0.5 µg). Luciferase activity was determined as in Figure 4. (b) WT and c-jun-/- cells were transfected with lipofectamine with 0.5 µg of SIE-CAT per well, and when indicated the cells were stimulated with 20% fetal bovine serum. CAT activity was determined as indicated in MATERIALS AND METHODS. Relative fold induction for each cell line has been included under the corresponding figure. Data shown in this figure represent the mean of a single experiment performed in triplicate ±SD and are representative of at least three experiments with similar results

To further prove if the inhibitory effect of c-jun over NFkappa B on MEKK1 expression is specific, we transfected a MEKK1/JNK or MEKK6/p38 combination of expression vectors in the different cell lines. As observed in Figure 6a, expression of increasing amounts of JNK1 in WT cells was able to repress NFkappa B activation by MEKK1 in a dose-dependent manner. However, whereas coexpression of MEKK1 and a high dose of the JNK expression plasmid in c-jun-/- cells have a mild effect on NFkappa B transcription, the constitutively c-jun-expressing cells, c-jun-/+, behave like the control WT cells. Furthermore, activation of p38 in cell lines of the three genotypes in response to cisplatin does not show any difference in the kinetics of activation, indicating that p38 is not responsible for the high levels of NFkappa B activation observed in c-jun-/- cells transfected with MEKK1. Accordingly expression of MEKK6 alone in WT cells induces only a minor increase in NFkappa B activation (Figure 6b), and no inhibition was observed with increasing doses of the p38alpha expression vector in contrast with the results obtained with MEKK1/JNK.


View larger version (21K):
[in this window]
[in a new window]
 
Figure 6.   (a) Cells from different genotypes for c-Jun, (WT, c-jun-/-, c-jun-/+) were transfected by lipofectamine with 0.5 µg of (-453/-80) HIVLUC and the indicated amounts of the JNK expression vector. Luciferase activity was determined as in Figure 4. (b) WT cells were transfected with lipofectamine with 0.5 µg of (-453/-80) HIVLUC per well and expression vectors encoding MEKK6 (0.5 µg). And the indicated amounts of a p38alpha expression vector. Luciferase activity was determined as in Figure 4. Data shown in this figure represent the mean of a single experiment performed in triplicate ±SD and are representative of at least three experiments with similar results.

Increased NFkappa B Activation in c-jun-/- Cells Is Mediated by Transcriptional Activation of p65/RelA Subunit

NFkappa B is regulated in part by a cellular process that involves phosphorylation and degradation of its inhibitory subunit IkBalpha that allows active NFkappa B complexes to translocate to the nucleus and activate transcription (Schmitz et al., 2001). Thus, we have studied whether cisplatin stimulation of c-jun-/- cells results in nuclear translocation of NFkappa B complexes more efficiently than in cells expressing c-jun, accounting for the high NFkappa B activity observed. To this purpose, WT, c-jun-/-, and c-jun-/+ cells were treated with cisplatin in a time range of 0-6 h, and nuclear extracts were isolated to perform EMSA with a radiolabeled kappa B element. As shown in Figure 7, all three cell lines display an increase in NFkappa B DNA-binding activity between 3 and 6 h of cisplatin treatment. Interestingly, nuclear extracts from c-jun-/- cells failed to show a significant increase in NFkappa B binding activity that would account for the differences observed in NFkappa B-dependent transcription (Figure 5a). On the contrary, cells constitutively expressing c-jun show a faster and stronger induction in kappa B binding than WT cells. Furthermore, all three cell lines respond to TNF-alpha in a similar manner and show a similar pattern of NFkappa B binding (Figure 7). Moreover, although jun-/- cells show an attenuated translocation of NFkappa B complexes, both c-jun-/+ and WT cells show the same profile of NFkappa B activation. These results suggest that although expression of c-Jun is required for optimal induction of NFkappa B translocation and binding to DNA after activation with cisplatin or TNF-alpha , a second mechanism of NFkappa B modulation takes place that accounts for the high NFkappa B activity present in the jun-/- cells.


View larger version (46K):
[in this window]
[in a new window]
 
Figure 7.   The amount of NFkappa B DNA-binding complexes is not higher in c-jun-/- cells than in WT cells. Nuclear extracts prepared from cells of the three c-Jun genotypes were treated with c-DDP or TNF-alpha and were analyzed by EMSA for NFkappa B binding activity as in Figure 1. The data are representative of three independent experiments.

Even though we could not detect important differences in nuclear translocation of NFkappa B active complexes between WT and c-jun-/- cells, we measured the kinetics of IkBalpha degradation upon cisplatin exposure. As shown in Figure 8a, the half-life of Ikappa Balpha in c-jun-/- cells after treatment with cisplatin is longer than 6 h in contrast with WT cells. We therefore analyzed the rate of Ikappa Balpha turnover in both cell lines. Exponentially growing WT or c-jun-/- cells were treated with the protein synthesis inhibitor cyclohexymide for periods of 30 min, 1, 3, and 6 h (Figure 8a), and the same experiment was carried out after stimulation with cisplatin. Cytoplasmic extracts were then isolated and subjected to immunoblot analysis of Ikappa Balpha expression. In WT and c-jun-/- cells, the half-life of the IkBalpha protein upon cisplatin treatment is similar (3-6 h), and after incubation with cyclohexymide decreases to <3 h in WT cells and is slightly lower in jun-/- cells. These results suggest that the levels of Ikappa Balpha in c-jun-/- cells are maintained by new protein synthesis, and this could be responsible for the results obtained in the gel retardation assays described in Figure 7, because c-jun-/- cells have lower levels of NFkappa B complexes than WT cells treated.


View larger version (31K):
[in this window]
[in a new window]
 
Figure 8.   c-jun inhibits p65 transcriptional activation. (a) Sustained levels of Ikappa Balpha in jun-/- require de novo protein synthesis. WT and jun-/- fibroblast were preincubated during 1 h with CHX (2 µM), then treated with c-DDP, and collected after different times, as indicated. Western blots were performed using anti-Ikappa Balpha antibody. (b) WT and c-jun-/- cells were stimulated with cisplatin at different times, and IKK activity was determined in an immunocomplex assay using IkBalpha as a substrate. Bottom: panel: the levels of phosphorylated IkBalpha were determined by Western blot with a specific antiphospho-IkBalpha antibody. (c) Top panel: WT, jun-/-, and jun-/- cells were cotransfected with a 5X-Gal-luc reporter plasmid (0.25 µg) and expression vectors encoding GAL4-p65 TAD1 (0.25 µg) and MEKK1 (0.5 µg), as indicated. After 24 h cells were collected, and relative luciferase activity was determined. Bottom panel: jun-/- cells were- cotransfected with a 5X-Gal-luc reporter plasmid (0.25 µg) and expression vectors encoding GAL4-p65 TAD1 (0.25 µg), MEKK1 (0.5 µg), and c-Jun (2 µg), as indicated. After 24 h cells were collected, and relative luciferase activity was determined. (d) Expression of p65/RelA does not inhibit c-Jun transcriptional activity. WT fibroblasts were cotransfected with a 5X-Gal-luc reporter plasmid (1 µg) and expression vectors encoding GAL4-c-Jun (1-223) (0.5 µg), MEKK1 (0.5 µg), and RC-CMVp65 (0.5-2 µg), as indicated. Luciferase activity was determined as in c. Data shown in this figure represent the mean of a single experiment performed in triplicate ±SD and are representative of at least three experiments with similar results.

We have also analyzed IKK activation upon cisplatin treatment in both cell lines either by directly measuring IKK activity or by determining the phosphorylation state of Ikappa Balpha (Figure 8b). We could not observe important differences that would justify the increased basal or MEKK1-induced NFkappa B transcriptional activity in c-jun-/- cells. These results are in agreement with work from other laboratories that indicated that MEKK1 is not a physiological IKK kinase (Xia et al., 2000; Yujiri et al., 2000).

There are different cellular stimuli that can activate NFkappa B transcription by a mechanism independent of its nuclear translocation (Schmitz et al., 2001). These alternative mechanisms involve stimulation of the transactivation domain of both the basal and induced levels of the p65 subunit of NFkappa B. Therefore, we studied if the differences observed were dependent on the transcriptional activation of p65. To address this question, we used a plasmid encoding the Gal4-p65 fusion protein, where the sequences encoding the DNA binding domain of Gal4 have been joined with sequences encoding the TAD1 of p65 (Schmitz et al., 1995). This construction once transfected with the Gal4-Luc reporter allowed us to determine if cellular signals triggered by MEKK1 regulate gene expression by specifically targeting TAD 1 of the p65/relA protein. WT, c-jun-/-, and c-jun-/+ cells were cotransfected with 4x-Gal4-Luc reporter and the Gal4-p65 expression construct and when indicated with an expression vector of MEKK1. As shown in Figure 8c, basal activation of the p65 TAD 1 was very similar in cell lines with the three genotypes. However, in c-jun-/- cells transfected with MEKK1, the activation of p65 TAD1 was almost 50-fold higher than in the other two cell lines. These results indicate that MEKK1 stimulates NFkappa B transcriptional activity in c-jun-/- cells mainly by increasing p65 transactivation potential. Therefore, because the increase in NFkappa B-dependent transcription measured by HIVLUC reporter activity and p65 activation in c-jun-/- cells are very similar in magnitude, c-Jun might act as an attenuating factor at some point in the pathway in c-Jun-expressing cells. Accordingly, the high transcriptional activation observed in c-jun-/- cells is reverted back to normal levels when c-jun is transiently expressed. The inhibitory effect of c-Jun on p65 transcriptional activation is not reciprocal. We analyzed the effect of p65 on transactivation of c-Jun with a hybrid Gal4-c-jun protein that contains the Gal4 DNA binding domain fused to the transcriptional activation domain of c-Jun. As shown in Figure 8d, transactivation of the Gal-4-dependent reporter plasmid is induced by expression of Gal4-c-jun and MEKK1, but expression of p65 is not able to inhibit c-Jun transcriptional activation. Altogether these results are compatible with two hypotheses: either MEKK1 activates a signaling pathway that inhibits p65 transcriptional activation or alternatively c-Jun by itself interferes with p65 transcriptional efficiency.

Coregulatory activator or repressor proteins have been shown to be required for the regulation of gene expression by various transcription factors. We have explored the possible involvement of some of the coregulatory proteins in the regulation of NFkappa B activity by c-Jun. Recently, it has been reported that p65/relA interacts with the histone deacetylase repressors HDAC1 and HDAC2, which downregulate NFkappa B-dependent transcription (Ashburner et al., 2001). Because in c-Jun-expressing cells there is an attenuation of p65-dependent transcription, we examined if treatment of WT cells with the HDAC inhibitor, thricostatin A (TSA), had any effect on MEKK1-NFkappa B-dependent transcription. As described previously, cells treated with different concentrations of TSA show an increase in the basal transcription of NFkappa B (Figure 9a; Ashburner et al., 2001). Under similar conditions, transcriptional activation by MEKK1 was not significantly modified, indicating that HDAC activities are not involved in control of NFkappa B transcription by MEKK1. Previous works have indicated that p65 can inhibit c-jun-dependent transcription by competing for the coactivator protein p300 (Maggirwar et al., 2000). Because both c-Jun and NFkappa B interact with the same domain of p300 (Bannister et al., 1995; Gerristen et al., 1997), we designed experiments to investigate if expression of p300 modified the transcriptional activation of NFkappa B in WT cell that expressed MEKK1. The results indicate that expression of increasing amounts of p300 (20-150 ng) was not able to increase the transcriptional activity of NFkappa B (Figure 9b).


View larger version (11K):
[in this window]
[in a new window]
 
Figure 9.   (a) Inhibition of HDAC activity does not affect the p65-dependent reporter gene expression. WT fibroblasts were cotransfected with a 5X-Gal-luc reporter plasmid (0.25 µg) and expression vectors encoding GAL4-p65 TAD1 (0.25 µg) and MEKK1 (0.5 µg). Sixteen hours after transfection cells were treated with TSA. Luciferase activity was measured 8 h later as in Figure 7. (b) Expression of p300/CBP does not increase MEKK1-induced transcriptional activation of p65. WT fibroblasts were cotransfected with a 5X-Gal-luc reporter plasmid (0.25 µg) and expression vectors encoding GAL4-p65 TAD1 (0.25 µg), MEKK1 (0.5 µg), and CBP (0.5-2 µg), as indicated. Luciferase activity was determined as in Figure 7. Data shown in this figure represent the mean of a single experiment performed in triplicate ±SD and are representative of at least three experiments with similar results.

MIAP-3 Is Highly Expressed in c-jun-/- Cells

It is known that NFkappa B is able to promote transcription of different target genes that block apoptosis induced by different proapoptotic signals (Karin et al., 2002). These antiapoptotic genes include members of BCl2 family such as Bcl-xL and A1/Bfl-1 as well as cellular inhibitors (cIAPs) of apoptosis among others. We studied by RT-PCR the kinetics of expression upon cisplatin treatment of three genes: A1/Bfl-1, Bcl-xL, and the mouse homologue of XIAP, MIAP-3 (Figure 10). WT and c-jun-/- cells were treated with cisplatin and the RNA level estimated by using beta -actin as an internal control. Neither A1/Bfl-1 nor Bcl-xL showed different patterns of expression between both cell lines treated with cisplatin. Interestingly MIAP-3 mRNA was present in unstimulated c-jun-/- cells, whereas it was almost undetectable in WT cells. More interestingly although the levels of MIAP-3 mRNA were sustained after several hours of cisplatin treatment, WT cells showed a small and transient increase in MIAP-3 mRNA during the first hours of treatment.


View larger version (30K):
[in this window]
[in a new window]
 
Figure 10.   MIAP-3 mRNA is constitutively transcribed in c-jun-/- cells. WT and c-jun-/- cells were treated with 10 µg/ml cisplatin and harvested at the indicated times. Total RNA was extracted and cDNA was synthesized. The specific cDNA for MIAP3 and beta -actin were amplified by PCR.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

c-Jun plays an important role in different cellular responses such as mitogenesis or DNA damage agents that induced apoptosis. The mechanism involved in c-Jun-mediated mitogenesis is better understood, whereas recently evidence is emerging on the cell death mechanism. The regulation of c-Jun activation by agents that damage DNA takes place through activation on JNK that phosphorylates c-Jun and increases its transactivation potential (Xia et al., 1995; Chen et al., 1996b; Sánchez-Pérez et al., 1998). Activation of JNK occurs as a consequence of activation of MEKK1 and the downstream kinase MEKK4/SEK1, the final JNK activator (Sánchez-Pérez et al., 1998; Chen et al., 1996b).

On the other hand, several signaling pathways have been involved in activation of NFkappa B in response to different stimuli (Malinin et al., 1997; Lee et al., 1998). A component of the JNK pathway, MEKK1 mediates NFkappa B-dependent transcription, mainly after treatment with chemotherapeutic agents or TNF-alpha receptor activation (Minden et al., 1994; Dérijard et al., 1995; Lin et al., 1995; Meyer et al., 1996).

We here show that cisplatin, a commonly used chemotherapeutic agent activates both NFkappa B and c-Jun by a MEKK1-dependent cascade. Activation of the JNK/SAPK pathway has been extensively shown to mediate the induction of apoptosis upon several types of stress (Xia et al., 1995; Chen et al., 1996a; Sánchez-Pérez et al., 1998). By contrast, the role of NFkappa B in chemotherapy-induced apoptosis seems to be dependent on the cell system (Kasibhatla et al., 1998; Baldwin, 2001). Activation of NFkappa B by cisplatin requires MEKK1 activity for both transcriptional activation and nuclear translocation.

Induction of FasL-dependent apoptosis has been shown to take place after exposure to several chemotherapeutic agents, including cisplatin (Kasibhatla et al., 1998; Razzaque et al., 1999). Accordingly, in our cell system c-DDP also induced FasL expression. We here investigated the relative role of JNK and NFkappa B in the regulation of expression of the proapoptotic protein FasL. We have found that induction of transcription of FasL by cisplatin requires also the activity of MEKK1. Although MEKK1 activates both NFkappa B and JNK pathways, only activation of JNK pathway seems to be relevant for the induction of FasL transcription in this cell system. We have previously published that CL100 was able to modulate cisplatin-induced apoptosis, both in human and mouse cells mainly due to inhibition of JNK (Sánchez-Pérez et al., 2000). In agreement with these results, expression of CL100 also impairs activation of FasL transcription, further supporting a role of FasL in cisplatin-induced cell death in 293T cells. Accordingly, induction of apoptosis in renal epithelial cells has been shown to be partially dependent on the FasL activation of its receptor (Razzaque et al., 1999). However, activation of NFkappa B is not required for FasL transcription. On the contrary, evidence in the literature indicates that activity of the NFkappa B transcription factor is involved in protection to apoptosis induced by different agents (Burow et al., 2000; Chen et al., 2000; Cheng et al., 2000; Baldwin, 2001; Javelaud and Besaçon 2001; Karin et al., 2002).

Work from different laboratories has demonstrated the possibility of a cross-talk between the JNK and NFkappa B pathway (Maggirwar et al., 2000; Smaele et al., 2001; Tang et al., 2001). To address this point, we used mouse cells defective in either c-Jun and NFkappa B-dependent transcription or both. We have found that inhibition of NFkappa B modifies the response of the cells to cisplatin. The survival advantage of jun-/- cells, resulting from the inhibition of Jun-dependent transcription, relies on the activity of NFkappa B. Expression of the Ikappa Balpha -SR protein in c-jun-/- cells does not interfere with the activation of JNK; therefore, the sensitization of these cells to cisplatin is not due to the influence of NFkappa B on JNK activity as described for TNF-alpha . Two different authors have recently reported that activation of NFkappa B-dependent transcription by TNF-alpha inhibits JNK activation, therefore protecting cells from TNF-alpha -induced apoptosis (Smaele et al., 2001; Tang et al., 2001). Here we observe the contrary effect, because activation of c-jun-dependent transcription seems to negatively modulate the survival effect of NFkappa B expression. Therefore, if c-Jun is not expressed, cells are able to better tolerate cisplatin treatment. Indeed expression of MEKK1 in cells that lack c-jun induces NFkappa B-dependent transcription much more efficiently than in WT cells.

Activation of p38 has also been involved in regulation of NFkappa B signaling by cytokines such as TNF-alpha (Carter et al., 1999). In our cell system activation of p38 takes place with similar kinetics in cells that lack or express c-Jun. Moreover, modulation of MEKK6/p38 has little influence in NFkappa B-dependent transcription in contrast with the results reported in TNF-alpha -treated cells (Alpert et al., 1999). In this system, stimuli such as certain types of stress that produce a sustained activation of p38 are able to induce inhibition of NFkappa B activation by TNF-alpha . These results suggest that sustained activation of either JNK or p38 by different types of stress may contribute to apoptosis by inhibiting NFkappa B activated survival pathways.

NFkappa B-dependent transcription can be regulated at different levels (Schmitz et al., 2001). Lack of c-Jun expression seems to have different effects in translocation of active NFkappa B complexes and DNA binding to kappa B sequences. The amount of NFkappa B DNA-bound complexes detected in cells treated either with TNF-alpha or cisplatin is higher in WT cells and jun-/- cells constitutively expressing c-Jun. These results correlate with a lower efficiency in activation of NFkappa B-dependent transcription in jun-/- cells when treated with TNF-alpha . Indeed, the kinetics of Ikappa K activation by cisplatin is slower in c-Jun-deficient cells, indicating the importance of c-Jun for optimal induction of the Ikappa Ks. Alternatively, because Ikappa Balpha is a transcriptional target of NFkappa B, Ikappa Balpha increased expression could explain the differences observed in the gel retardation assays, between c-jun-/-, c-jun-/+, and WT cells.

Here we demonstrate that the increase in NF