![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 8, 2933-2945, August 2002
B Activity and Cell Viability
Instituto de Investigaciones Biomédicas Consejo Superior de Investigaciones Cientificas-Universidad Autónoma de Madrid, 28029 Madrid, Spain
Submitted January 15, 2002; Revised April 29, 2002; Accepted May 31, 2002| |
ABSTRACT |
|---|
|
|
|---|
Chemotherapeutic agents such as cisplatin induce persistent
activation of N-terminal c-Jun Kinase, which in turn mediates induction
of apoptosis. By using a common MAPK Kinase, MEKK1, cisplatin also
activates the survival transcription factor NF
B. We have found a
cross-talk between c-Jun expression and NF
B transcriptional activation in response to cisplatin. Fibroblast derived from c-jun knock out mice are more resistant to cisplatin-induced cell death, and
this survival advantage is mediated by upregulation of NF
B-dependent transcription and expression of MIAP3. This process can be reverted by
ectopic expression of c-Jun in c-jun
/
fibroblasts, which decreases p65 transcriptional activity back to
normal levels. Negative regulation of NF
B-dependent transcription by
c-jun contributes to cisplatin-induced cell death, which suggests that
inhibition of NF
B may potentiate the antineoplastic effect of
conventional chemotherapeutic agents.
| |
INTRODUCTION |
|---|
|
|
|---|
Induction of apoptosis is the primary mechanism of
tumor cell killing by radiation and chemotherapeutic agents. Abundant
literature has implicated different caspases as the executionery
elements at the onset stage of the apoptotic process (Enari et
al., 1998
). However, the initial events responsible for the
later phases of cell death are poorly understood.
Different types of stress such as treatment with DNA-damaging agents
used in cancer therapy induce the activation of protein kinase cascades
that include the c-jun-N-terminal kinases (JNKs) and the p38 MAP
kinase. Each MAP kinase subfamily is activated by a specific upstream
MAP kinase kinase (MKKs), which phosphorylates both threonine and
tyrosine residues within a conserved T-X-Y motif (Hibi et
al., 1993
; Dérijard et al., 1994
; Kyriakis
et al., 1994
). These residues are dephosphorylated by
dual-specific protein phosphatases, resulting in the inactivation of
MAP kinases (Keyse, 2000
). Activation of MAP kinase family members
leads to phosphorylation of numerous cellular effectors, including
protein kinases such as MAPKAPK1, MAPKAP-K2/3, Mnk1/2, and
transcription factors such as c-jun, ATF-2, MEF2c, and CHOP, which are
responsible for the fate of the cell (Alpert et al., 1999
).
cis-Diaminedichloroplatinum (c-DDP, cisplatin) is
a DNA-reactive agent commonly used in chemotherapy protocols in the
treatment of several kinds of human cancers. Lesions of
c-DDP on DNA include intrastrand 1,2-d(GpG),
1,2-d(ApG), 1,3-d(GpNpG), and interstrand cross-link
(Fichtinger-Shepman et al., 1985
). Like many
anticancer agents, c-DDP induces a sustained activation of
JNK and p38 (Sánchez-Pérez et al., 2000
).
Activation of JNK takes place via the MEKK1/SEK1 cascade and is
directly related to cell death (Sánchez-Pérez and
Perona, 1999
). Dephosphorylation and inactivation of JNK by the
dual-specific phosphatases CL100 and hVH5 result in protection against
cisplatin-induced apoptosis (Sánchez-Pérez et
al., 2000
). Furthermore, both phosphatases are able to inhibit
transcriptional activation of c-Jun, the main physiological substrate
of JNK (Kyriakis et al., 1994
).
We have previously shown that c-Jun is necessary for the induction of
apoptosis in response to cisplatin. A cell line derived from a
c-jun knock out mouse is more resistant than normal cells to
cisplatin-induced cell death (Sánchez-Pérez and Perona,
1999
). This effect is specific to c-Jun because transfection of
c-jun into the c-jun
/
cell line,
restores its endogenous activity, which results in a phenotype similar
to that of parental cells. The role of c-Jun in apoptosis has been
described in other cell lines, such as PC12 cells, which undergo
apoptosis after NGF withdrawal in a c-jun-dependent mechanism (Ham
et al., 1995
). In agreement with these results, constitutive
expression of c-Jun in NIH3T3 cells induces apoptosis upon serum
deprivation (Ham et al., 1995
; Bossy-Wetzel et
al., 1997
).
Little is known about molecules involved in the induction of apoptosis
whose expression is regulated by the c-Jun transcription factor. Fas
Ligand appears to participate in DNA-damage-induced apoptosis,
and its expression seems to depend partially on activation of the JNK
pathway (Kasibhatla et al., 1998
)
NF
B comprises a family of inducible transcription factors that act
as regulators of the host immune and inflammatory response (Collart
et al., 1990
; Libermann and Baltimore, 1990
; Zhang et al., 1990
). They also have been involved in protecting cells from apoptosis induced by chemotherapeutic agents (Wang et al.,
1999
; Baldwin, 2001
) or cytokine treatment (Baldwin, 2001
). NF
B is a
heterodimer composed of p50 and p65/RelA subunits. In unstimulated cells, NF
B is found mainly in the cytoplasm associated with a family
of inhibitory molecules known as I
Bs (Finco and Baldwin, 1995
;
Matthews and Hay, 1995
; Yin et al., 1998
). The activation mechanism of NF
B involves the phosphorylation of I
Bs in two critical serine residues (Ser32 and
Ser36) via the I
B kinase (IKK) signalosome
complex (Brown et al., 1995
; Traenckner et al.,
1995
; Whiteside et al., 1995
; DiDonato et al.,
1996
; O'Connell et al., 1998
). Two different kinases that phosphorylate IKKs have been described: NF
B-induced kinase (NIK; Malinin et al., 1997
) and MEKK1 (Lee et al.,
1998
). Once I
Bs are phosphorylated, they are targeted for
ubiquitination and subsequent degradation by the 26S proteosome. Free
p50/p65 heterodimers translocate to the nucleus, where they activate
transcription of NF
B responsive genes (Baldwin, 1996
; Ghosh et
al., 1998
). However, there is increasing evidence that an
alternative mechanism of NF
B activation that involves
phosphorylation of the p65/RelA transactivation subunit takes place
(Schmitz et al., 2001
). A number of kinases have been shown
to phosphorylate p65 NF
B, including the catalytic subunit of protein
kinase A (PKAc), whose activity leads to association of p65/RelA with
the CREB-binding protein/p300 (CBP/p300) transcriptional activator
(Zhong et al., 1998
). In addition, AKT/PKB a potent regulator of cell survival, can stimulate the transactivation domain of
p65/RelA in a manner that is dependent on IkB kinase and the p38 MAPK
activities (Baldwin, 1996
; Madrid et al., 2001
).
Here we show that treatment of cells with cisplatin induces cell death
by modulating both survival and proapoptotic pathways. We have found
that activation of MEKK1 by cisplatin upregulates cell death by
inducing AP-1-mediated FasL transcription. In parallel, cisplatin also
activates NF
B through MEKK1, and this activation is modulated by
c-Jun, the main substrate of the JNK pathway. In the absence of c-Jun
expression, cells are more resistant to cisplatin, and this correlates
with an increase in MEKK1-NF
B-dependent transcription. Accordingly,
when NF
B activation was impaired in jun
/
fibroblasts by expression of the I
B
SR (a degradation resistant form of I
B
), resistance to cisplatin was reverted to levels similar to that of wild-type cells. The regulation of NF
B-dependent transcription occurs by the interference of c-jun with p65
transcriptional activation. These findings suggest that
chemotherapeutic agents such as cisplatin upregulate proapoptotic
pathways, through c-jun-dependent FasL transcription and simultaneous
downregulation of survival pathways that are dependent on NF
B transcription.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture, Antibodies, and Reagents
Human embryonic kidney fibroblast cells (293T) were maintained
in DMEM supplemented with 10% fetal bovine serum. NIH3T3 cells derived
from c-jun knock out mice were cultured in the same medium but
supplemented with 5% fetal bovine serum. c-jun
/
and WT
cells were obtained from Erwin Wagner (Hilberg et al., 1993
; Schreiber et al., 1995
). Jun
/+ cells
have been previously described (Sánchez-Pérez and Perona, 1999
). Phosphorylated forms of JNK were detected with antiphospho JNK
(Promega, Madison, WI) antibody. Anti-Fas ligand,
anti-I
B
(C-21), antiphospho.-I
B
(B9) and anti-IKK
(77-280) were from Santa Cruz Biotechnology (Santa Cruz, CA).
Cisplatin, etoposide, cycloheximide, and thricostatin were purchased
from Sigma (St. Louis, MO), and TNF-
was purchased from Upstate
Biotechnology (Lake Placid, NY).
Plasmids
(
453/+80) HIVLUC contains the NF
B sites of the HIV
promoter, and
NF
B HIVLUC contains a three-base pair substitution
in each of the NF
B binding sites (Devary et al., 1993
).
The following plasmids have been already described: GAL4c-Jun (1-223),
pCDNAIII derived-MEKK1, pMEKK1 (K-R; Perona et al., 1997
),
pMEKK6 and p38
(Tamura et al., 2000
),
RC-CMV-IkB
-Ala32/Ala36 (IkB
-SR; Whiteside et al.,
1995
), pSG5CL100 (Sánchez-Pérez et al., 2000
),
and 1xSIE-CAT (Aznar et al., 2001
). PCDNAI-c-jun and
RCCMV-p65 were obtained from Rodrigo Bravo (Montaner et al.,
1998
). P-Gal4-p65TAD1 was obtained from Lienhard Schmitz
(Schmitz et al., 1995
). PCMV-CBP was obtained from
Harel-Bellan (Polesskaya et al., 2001
). Fas ligand
luciferase reporter constructs encoding for a 0.9-kb fragment of the
FasL promoter were provided by Douglas Green (Kasibhatla et
al., 1998
), and p-GST-IkB
was obtained from Mark Hannink
(Sachdev and Hannink, 1998
).
Transfection and Analysis of Gene Expression
For transient transfection assays, 293T cells were transfected
by the calcium phosphate method as described previously
(Sánchez-Pérez and Perona, 1999
). The total amount of DNA
was kept constant at 5 µg per plate with the corresponding empty
vector. When indicated, the cells were stimulated for different times
and harvested 24 h after transfection. Protein extracts were
prepared by lysis with the commercially available reporter lysis buffer
(Promega). The total amount of protein was determined with a commercial
kit based on the Bradford method (Bio-Rad, Richmond, CA). NIH cells were transfected with Lipofectamine (GIBCO/BRL, Rockville, MD) in
six-well plates with 2 × 105 cells per
well. For transient transfection assays, the total amount of DNA
transfected was brought up to 4 µg per well by addition of empty
vector DNA.
For stable transfection, cells were transfected with 3.5 µg of
pI
B
-SR expression plasmid and 0.5 µg of p-PUR plasmid
(Clontech, Palo Alto, CA). Twenty-four hours after transfection, cells
were selected for puromycin resistance. Luciferase assays were
performed according to manufacturer's instruction (Promega), and
-galactosidase (
-gal) assays were done as previously described
(Perona et al., 1997
). Transfection efficiencies were
corrected by cotransfection of p-CMV
-gal and by measuring
-gal
activity. Each assay was performed in triplicate, in a single
experiment, and repeated in three different experiments with similar
results. Chloranphenicol acetyltransferase (CAT) activity was assayed
by using a xylene-based method, as described (Aznar et al.,
2001
).
Cell Extracts and Immunoblotting
Whole-cell lysates and nuclear extracts were prepared as
described previously (Perona et al., 1997
;
Sánchez-Pérez et al., 1998
). Western blotting
was carried out by standard methods (Sánchez-Pérez et
al., 1998
).
EMSA
Nuclear extracts (2 µg of protein) from c-DDP (20 µg/ml) or TNF-
(10 ng/ml) treated cells were incubated with a
32P-labeled probe containing the NF
B binding
site (Perona et al., 1997
). Samples treated with
c-DDP or TNF-
were incubated for supershift assays with
preimmune serum, or antibodies specific for either p50 or p65. Extracts
were incubated 15min with the corresponding antibody before probe
binding. The protein-DNA complexes were analyzed by EMSA as previously
described (Perona et al., 1997
).
RNA Extraction and Reverse Transcriptase (RT)-PCR
Total RNA was isolated from cells using Trizol reagent (Life
Technologies, Rockville, MD) following the manufacturer's
instructions. For RT-PCR single-strand cDNA was synthesized from total
RNA using a primer oligo(dT)12-18 and the
Superscript reverse transcriptase (Clontech). Each cDNA was amplified
by PCR using Taq DNA polymerase. The sequences of the
primers were MIAP3-F (5'AGTGGGGCACCACATGTTAT-3') and MIAP3-R
(5'CGGAAACAGTGCTGTTAGCA-3') and mouse
-actin-F
(5'GGTATGGAATCCTGTGGCATCCATGAAA3') and
-actin-R
(5'GTGTAAAACGCAG-CTCAGTAACAGTCCG 3'). The conditions for
reactions were as follows: 1× (95°C, 1 min), 25× (95°C,
30 s; 55°C 1 min; 72°C, 30 s) and 1× (72°C, 3 min) and for
-actin 1× (95°C, 1 min), 25× (95°C, 30 s; 60°C, 1 min;
72°C, 30 s) and 1× (72°C, 3 min). The products were analyzed on a
1% agarose gel and stained with ethidium bromide.
Inmunoprecipitation and Kinase Assays
Cells treated with c-DDP (20 µg/ml) were lysed in
buffer A containing 100 mM NaCl, 50 mM Tris (pH 8.0), 1 mM sodium
orthovanadate, 1 mM NaF, 0.5 mM B-glycerophosphate, and protease
inhibitors. Two hundred micrograms of protein of each cell lysate were
incubated with anti-IKK
antibody during 4 h, and 20 µl of
protein A-agarose beads were added for 1 h. The
inmunoprecipitation complex was extensively washed, and the kinase
reaction mixture (10 µCi [32P]ATP, 2 mM
MgCl2, 1 mM DTT in buffer A) was added to the
agarose beads. All incubations were performed at 4°C. GST-I
B
fusion protein containing amino acids 1-54 was incubated at 30°C for 25 min. The reaction mixtures were then subjected to SDS-PAGE and autoradiography.
Cell Viability Assay
The cell viability was determined using a crystal violet
staining method as previously described (Sánchez-Pérez
et al., 1998
).
| |
RESULTS |
|---|
|
|
|---|
Cisplatin Treatment Increases NF
B Activity
We have previously shown that persistent activation of JNK is
involved in cisplatin-induced apoptosis (Sánchez-Pérez
et al., 1998
). In addition, cisplatin has been reported to
induce activation of NF
B (Sodhi and Singh, 1998
), a transcription
factor involved in antiapoptotic processes. Thus, we have investigated the relationship between both pathways in cisplatin-induced cell death.
293T cells were treated with 20 µg/ml cisplatin, nuclear extracts
were obtained, and NF
B binding activity was assayed by EMSA. A
consensus
B binding sequence and specific antibodies to investigate
the composition of the complexes were used for this purpose. We
observed that cisplatin induces an increase in NF
B binding activity,
with slow kinetics displaying maximal DNA-binding between 3 and 6 h after treatment and decreasing after 9 h (Figure 1). Both p50 and p65/RelA proteins were
found in the retarded bands as demonstrated by inhibition in binding of
the complexes to DNA by p50 and RelA specific antisera (Figure 1).
Similar results were obtained with Pam212 or NIH3T3 cells.
|
As we have reported before, cisplatin also induces activation of
JNK via MEKK1/SEK1, with a delayed kinetics (Sánchez-Pérez and Perona, 1999
) very similar to that observed for activation of
NF
B complexes. Because MEKK1 also activates NF
B (Lee et
al., 1998
), we verified if activation of both NF
B and JNK upon
cisplatin treatment share a common MEKK1-dependent pathway. 293T cells
were transfected with the HIV luciferase (HIVLUC) reporter, and
NF
B-dependent transcription was measured (Devary et al.,
1993
). Cisplatin treatment led to an increase in NF
B-dependent
transcription. As well, transfection of an MEKK1 expression plasmid was
able by itself to induce activation of NF
B, and a further increase
in activity was observed upon treatment with cisplatin of
MEKK1-expressing cells. Accordingly, transfection of a dominant
negative form of MEKK1 (MEKK1/KR) prevented activation of NF
B,
further indicating the role of this kinase in cisplatin-induced
activation of the transcription factor. This activity was
B
dependent, because no activation was observed when a HIVLUC reporter
containing three-base pair substitutions in each NF
B binding site
was used (Figure 2a). DNA-binding of NF
B upon cisplatin treatment was also dependent on MEKK1 activity, because ectopic expression of MEKK1 in 293T cells was able to induce
translocation of
B binding complexes and expression of MEKK1 (KR)
partially blocks the translocation (Figure 2b) in response to
cisplatin. The translocation of active complexes (p50/p65) was also
inhibited by expression of a plasmid repressor of I
B
containing
mutations in the two serines 32/36, phosphorylated by the I
K
complexes (I
B
-SR).
|
Cisplatin Induces FasL Expression through Activation of the SAPK Pathway
Recent studies have shown that the apoptotic response to
chemotherapeutic agents in some cell types may proceed through the expression of FasL (Faris et al., 1998
; Kasibhatla et
al., 1998
). To verify if FasL expression was induced by cisplatin,
we treated 293T cells with cisplatin at various times and studied its
expression by Western blot (Figure 3a).
Expression of FasL was detected 9 h after treatment with
cisplatin, at a time when both JNK and NF
B activities were present
(Figure 1; Sánchez-Pérez et al., 1998
).
Regulation of FasL expression by some chemotherapeutic agents occurs at
the transcriptional level and might involve the activation of NF
B
and the SAPK pathway (Kasibhatla et al., 1998
). Therefore,
we next investigated whether cisplatin was able to modulate the FasL
transcription. 293T cells were transiently transfected with a plasmid
containing the FasL promoter joined to the luciferase gene as a
reporter, and cells were treated for different times with cisplatin.
The results shown in Figure 3b indicate that cisplatin induces
activation of the FasL promoter almost up to fourfold, in a similar
magnitude to the positive control etoposide (Kasibhatla et
al., 1998
). Because cisplatin seems to activate both SAPK/JNK and
the NF
B pathway through activation of MEKK1, we tested the involvement of this kinase in the activation of FasL promoter by
cisplatin. 293T cells were contransfected with the FasL promoter reporter and either the MEKK1 or MEKK1(KR) expression vectors. The
results shown in Figure 3c indicate that expression of MEKK1 increases
both the basal and cisplatin-induced activity of this promoter. MEKK1
is required for activation of the FasL promoter in response to
cisplatin because expression of the MEKK1(KR) construct abolishes
transcription of the FasL promoter by this drug. The promoter construct
used in our assays contains both the AP-1 and NF
B binding sites that
control FasL transcription (Kasibhatla et al., 1998
). Thus
the relative contribution of these two transcription factors in FasL
transcription was verified by specifically inhibiting both pathways.
293T cells were cotransfected with the I
B
-SR and MEKK1 expression
vectors together with the FasL promoter construct. Transcriptional
activation of FasL promoter was not dependent on the NF
B pathway
(Figure 3d, top panel). As a functional control of IkB
-SR
inhibition, MEKK1-dependent transcription of HIV-luc is inhibited under
similar conditions (Figure 3d, bottom panel). However, inhibition of
JNK by transient expression of the CL100 dual phosphatase
(Sánchez-Pérez et al., 2000
) abolishes
MEKK1-dependent activation of the FasL promoter (Figure 3e). Altogether
these results indicate that although cisplatin and MEKK1 activate both NF
B and JNK pathways, only JNK plays a positive role in the
transcription of the FasL promoter, and therefore, this could represent
a proapoptotic mechanism of the JNK pathway in response to cisplatin.
|
Inhibition of the NF
B Pathway Reverts Cisplatin Resistance of
Cells
We have previously demonstrated that fibroblasts derived from
jun
/
embryos show a higher
ID50 for cisplatin than parental NIH3T3 cells
(Sánchez-Pérez and Perona, 1999
). Moreover, when
c-jun expression is restored in
c-jun
/
cells, the resultant cell line
c-jun
/+ is more sensitive to cisplatin
(Sánchez-Pérez and Perona, 1999
). As well, inhibition of
JNK activation by expression of the CL100 dual phosphatase specifically
inhibits cisplatin-induced apoptosis (Sánchez-Pérez
et al., 2000
). Work from other laboratories has identified
NF
B-regulated genes as mediators of cell survival to proapoptotic
stimuli (Baldwin, 2001
; Barkett and Gilmore, 1999
) Thus, we
investigated the physiological role of NF
B activation in the
behavior of the parental WT cells and jun
/
cells upon cisplatin
treatment. Stable cell lines were generated by transfecting I
B
-SR
into WT and c-jun
/
cells (WT/I
B
and c-jun
/
/IkB
, which
were tested for sensitivity to cisplatin. As a functional control of
the dominant negative activity of I
B
-SR, these cells were treated
with TNF-
and HIVLUC reported activity was assayed. As shown in
Figure 4a, both cell lines showed
impaired NF
B activation upon TNF-
treatment when compared with
the parental cell lines.
|
It should be noted that c-jun
/
cells showed a
fivefold increase in basal NF
B activity with respect to WT cells
(Figure 4a). We then used all four cell lines to test the viability
after cisplatin treatment. As expected,
c-jun
/
cells are more resistant to
cisplatin-induced cell death (Sánchez-Pérez and Perona,
1999
) than the parental WT cells. On the other hand c-jun
/
/I
B
showed a similar increase in
sensitivity to cisplatin and became similar to that of the parental WT
cells. Moreover, expression of I
B
-SR in the WT cells did
not result in noticeable changes in viability toward cisplatin. The
prolonged kinetics for JNK activation after cisplatin treatment is
important for the induction of apoptosis (Sánchez-Pérez
et al., 1998
). However, we have observed that the
differences observed in cisplatin sensitivity between
c-jun
/
and
c-jun
/
/I
B
cells are not due to
differences in the kinetics of JNK activation by cisplatin (Figure 4c).
Thus, altogether these results suggest that the lower sensitivity to
cisplatin observed in c-jun
/
cells is NF
B dependent.
Activation of c-Jun by the MEKK1/JNK Pathway Downregulates NF
B
Transcription
Exposure of 293T cells to cisplatin activates MEKK1, and this
pathway contributes, on one hand to c-Jun transcriptional activation and on the other to NF
B activation. Because
c-jun
/
cells are less susceptible to
cisplatin-induced cell death in a NF
B-dependent manner, we have
studied the contribution of MEKK1 to NF
B activation in these cells.
Cells of the three genotypes (c-jun+/+,
c-jun
/
, and c-jun
/+)
as well as the I
B-
-expressing cells (WT/IkB
and
jun
/
/I
B
) were cotransfected with the
MEKK1 expression vector and the HIVLUC reporter plasmid (Figure
5a). Expression of MEKK1 is able to
induce activation of the HIVLUC reporter in all cell lines with the
exception of the IkB
degradation resistant-expressing cells.
Interestingly, c-jun
/
cell line displays a
drastic increase in NF
B activity with respect to WT cells, even if
the basal NF
B activity in these cells is already higher than that of
the WT cells (fivefold). This effect is specific of c-Jun, because
c-jun
/+ cells showed an induction similar to
that of WT cells. The differences observed are not due to changes in
transfection efficiencies, because all luciferase values were
normalized to that of an internal
-gal control. As well, these
differences between WT and c-jun
/
cells are
specific for NF
B, because transcription dependent of STAT-3 (Figure
5b) and SRF was almost equal in both cell lines. Furthermore, the
differences in NF
B activity are not due to changes in the levels of
p65 or p50 because no variations in the expression of both
transcription factors in cells treated with cisplatin were observed.
Altogether, the results suggest that transcriptional activation of
c-Jun triggered by MEKK1 in WT cells negatively regulates NF
B
activation.
|
To further prove if the inhibitory effect of c-jun over NF
B on MEKK1
expression is specific, we transfected a MEKK1/JNK or MEKK6/p38
combination of expression vectors in the different cell lines. As
observed in Figure 6a, expression of
increasing amounts of JNK1 in WT cells was able to repress NF
B
activation by MEKK1 in a dose-dependent manner. However, whereas
coexpression of MEKK1 and a high dose of the JNK expression plasmid in
c-jun
/
cells have a mild effect on NF
B
transcription, the constitutively c-jun-expressing cells,
c-jun
/+, behave like the control WT cells.
Furthermore, activation of p38 in cell lines of the three genotypes in
response to cisplatin does not show any difference in the kinetics of
activation, indicating that p38 is not responsible for the high levels
of NF
B activation observed in c-jun
/
cells
transfected with MEKK1. Accordingly expression of MEKK6 alone in WT
cells induces only a minor increase in NF
B activation (Figure 6b),
and no inhibition was observed with increasing doses of the p38
expression vector in contrast with the results obtained with MEKK1/JNK.
|
Increased NF
B Activation in c-jun
/
Cells Is
Mediated by Transcriptional Activation of p65/RelA Subunit
NF
B is regulated in part by a cellular process that involves
phosphorylation and degradation of its inhibitory subunit IkB
that
allows active NF
B complexes to translocate to the nucleus and
activate transcription (Schmitz et al., 2001
). Thus, we have studied whether cisplatin stimulation of
c-jun
/
cells results in nuclear translocation
of NF
B complexes more efficiently than in cells expressing c-jun,
accounting for the high NF
B activity observed. To this purpose, WT,
c-jun
/
, and c-jun
/+
cells were treated with cisplatin in a time range of 0-6 h, and nuclear extracts were isolated to perform EMSA with a radiolabeled
B
element. As shown in Figure 7, all three
cell lines display an increase in NF
B DNA-binding activity between 3 and 6 h of cisplatin treatment. Interestingly, nuclear extracts
from c-jun
/
cells failed to show a
significant increase in NF
B binding activity that would account for
the differences observed in NF
B-dependent transcription (Figure 5a).
On the contrary, cells constitutively expressing c-jun show a faster
and stronger induction in
B binding than WT cells. Furthermore, all
three cell lines respond to TNF-
in a similar manner and show a
similar pattern of NF
B binding (Figure 7). Moreover, although
jun
/
cells show an attenuated translocation
of NF
B complexes, both c-jun
/+ and WT cells
show the same profile of NF
B activation. These results suggest that
although expression of c-Jun is required for optimal induction of
NF
B translocation and binding to DNA after activation with cisplatin
or TNF-
, a second mechanism of NF
B modulation takes place that
accounts for the high NF
B activity present in the
jun
/
cells.
|
Even though we could not detect important differences in nuclear
translocation of NF
B active complexes between WT and c-jun
/
cells, we measured the kinetics of IkB
degradation upon cisplatin exposure. As shown in Figure 8a, the
half-life of I
B
in c-jun
/
cells after
treatment with cisplatin is longer than 6 h in contrast with WT
cells. We therefore analyzed the rate of I
B
turnover in both cell
lines. Exponentially growing WT or c-jun
/
cells were treated with the protein synthesis inhibitor cyclohexymide for periods of 30 min, 1, 3, and 6 h (Figure 8a), and the same experiment was carried out after stimulation with cisplatin.
Cytoplasmic extracts were then isolated and subjected to
immunoblot analysis of I
B
expression. In WT and
c-jun
/
cells, the half-life of the IkB
protein upon cisplatin treatment is similar (3-6 h), and after
incubation with cyclohexymide decreases to <3 h in WT cells and is
slightly lower in jun
/
cells. These results
suggest that the levels of I
B
in c-jun
/
cells are maintained by new protein synthesis, and this could be
responsible for the results obtained in the gel retardation assays
described in Figure 7, because c-jun
/
cells
have lower levels of NF
B complexes than WT cells treated.
|
We have also analyzed IKK activation upon cisplatin treatment in both
cell lines either by directly measuring IKK activity or by determining
the phosphorylation state of I
B
(Figure 8b). We could not observe
important differences that would justify the increased basal or
MEKK1-induced NF
B transcriptional activity in
c-jun
/
cells. These results are in agreement
with work from other laboratories that indicated that MEKK1 is not a
physiological IKK kinase (Xia et al., 2000
; Yujiri et
al., 2000
).
There are different cellular stimuli that can activate NF
B
transcription by a mechanism independent of its nuclear translocation (Schmitz et al., 2001
). These alternative mechanisms involve
stimulation of the transactivation domain of both the basal and induced
levels of the p65 subunit of NF
B. Therefore, we studied if the
differences observed were dependent on the transcriptional activation
of p65. To address this question, we used a plasmid encoding the
Gal4-p65 fusion protein, where the sequences encoding the DNA binding
domain of Gal4 have been joined with sequences encoding the TAD1 of p65 (Schmitz et al., 1995
). This construction once transfected
with the Gal4-Luc reporter allowed us to determine if cellular signals triggered by MEKK1 regulate gene expression by specifically targeting TAD 1 of the p65/relA protein. WT, c-jun
/
,
and c-jun
/+ cells were cotransfected with
4x-Gal4-Luc reporter and the Gal4-p65 expression construct and when
indicated with an expression vector of MEKK1. As shown in Figure 8c,
basal activation of the p65 TAD 1 was very similar in cell lines with
the three genotypes. However, in c-jun
/
cells
transfected with MEKK1, the activation of p65 TAD1 was almost 50-fold
higher than in the other two cell lines. These results indicate that
MEKK1 stimulates NF
B transcriptional activity in
c-jun
/
cells mainly by increasing p65
transactivation potential. Therefore, because the increase in
NF
B-dependent transcription measured by HIVLUC reporter activity and
p65 activation in c-jun
/
cells are very
similar in magnitude, c-Jun might act as an attenuating factor at some
point in the pathway in c-Jun-expressing cells. Accordingly, the high
transcriptional activation observed in c-jun
/
cells is reverted back to normal levels when c-jun is
transiently expressed. The inhibitory effect of c-Jun on p65
transcriptional activation is not reciprocal. We analyzed the effect of
p65 on transactivation of c-Jun with a hybrid Gal4-c-jun protein that contains the Gal4 DNA binding domain fused to the transcriptional activation domain of c-Jun. As shown in Figure 8d, transactivation of
the Gal-4-dependent reporter plasmid is induced by expression of
Gal4-c-jun and MEKK1, but expression of p65 is not able to inhibit
c-Jun transcriptional activation. Altogether these results are
compatible with two hypotheses: either MEKK1 activates a signaling pathway that inhibits p65 transcriptional activation or alternatively c-Jun by itself interferes with p65 transcriptional efficiency.
Coregulatory activator or repressor proteins have been shown to be
required for the regulation of gene expression by various transcription
factors. We have explored the possible involvement of some of the
coregulatory proteins in the regulation of NF
B activity by c-Jun.
Recently, it has been reported that p65/relA interacts with the histone
deacetylase repressors HDAC1 and HDAC2, which downregulate
NF
B-dependent transcription (Ashburner et al., 2001
).
Because in c-Jun-expressing cells there is an attenuation of
p65-dependent transcription, we examined if treatment of WT cells with
the HDAC inhibitor, thricostatin A (TSA), had any effect on
MEKK1-NF
B-dependent transcription. As described previously, cells
treated with different concentrations of TSA show an increase in the
basal transcription of NF
B (Figure 9a;
Ashburner et al., 2001
). Under similar conditions,
transcriptional activation by MEKK1 was not significantly modified,
indicating that HDAC activities are not involved in control of NF
B
transcription by MEKK1. Previous works have indicated that p65 can
inhibit c-jun-dependent transcription by competing for the coactivator
protein p300 (Maggirwar et al., 2000
). Because both c-Jun
and NF
B interact with the same domain of p300 (Bannister et
al., 1995
; Gerristen et al., 1997
), we designed experiments to investigate if expression of p300 modified the transcriptional activation of NF
B in WT cell that expressed MEKK1. The results indicate that expression of increasing amounts of p300
(20-150 ng) was not able to increase the transcriptional activity of
NF
B (Figure 9b).
|
MIAP-3 Is Highly Expressed in c-jun
/
Cells
It is known that NF
B is able to promote transcription of
different target genes that block apoptosis induced by different proapoptotic signals (Karin et al., 2002
). These
antiapoptotic genes include members of BCl2 family such as
Bcl-xL and A1/Bfl-1 as well as cellular
inhibitors (cIAPs) of apoptosis among others. We studied by RT-PCR the
kinetics of expression upon cisplatin treatment of three genes:
A1/Bfl-1, Bcl-xL, and the mouse homologue of
XIAP, MIAP-3 (Figure 10). WT and
c-jun
/
cells were treated with cisplatin and
the RNA level estimated by using
-actin as an internal control.
Neither A1/Bfl-1 nor Bcl-xL showed different
patterns of expression between both cell lines treated with cisplatin.
Interestingly MIAP-3 mRNA was present in unstimulated
c-jun
/
cells, whereas it was almost
undetectable in WT cells. More interestingly although the levels of
MIAP-3 mRNA were sustained after several hours of cisplatin treatment,
WT cells showed a small and transient increase in MIAP-3 mRNA during
the first hours of treatment.
|
| |
DISCUSSION |
|---|
|
|
|---|
c-Jun plays an important role in different cellular responses such
as mitogenesis or DNA damage agents that induced apoptosis. The
mechanism involved in c-Jun-mediated mitogenesis is better understood,
whereas recently evidence is emerging on the cell death mechanism. The
regulation of c-Jun activation by agents that damage DNA takes place
through activation on JNK that phosphorylates c-Jun and increases its
transactivation potential (Xia et al., 1995
; Chen et
al., 1996b
; Sánchez-Pérez et al., 1998
).
Activation of JNK occurs as a consequence of activation of MEKK1 and
the downstream kinase MEKK4/SEK1, the final JNK activator
(Sánchez-Pérez et al., 1998
; Chen et
al., 1996b
).
On the other hand, several signaling pathways have been involved in
activation of NF
B in response to different stimuli (Malinin et
al., 1997
; Lee et al., 1998
). A component of the JNK
pathway, MEKK1 mediates NF
B-dependent transcription, mainly after
treatment with chemotherapeutic agents or TNF-
receptor activation
(Minden et al., 1994
; Dérijard et al.,
1995
; Lin et al., 1995
; Meyer et al., 1996
).
We here show that cisplatin, a commonly used chemotherapeutic agent
activates both NF
B and c-Jun by a MEKK1-dependent cascade. Activation of the JNK/SAPK pathway has been extensively shown to
mediate the induction of apoptosis upon several types of stress (Xia
et al., 1995
; Chen et al., 1996a
;
Sánchez-Pérez et al., 1998
). By contrast, the
role of NF
B in chemotherapy-induced apoptosis seems to be dependent
on the cell system (Kasibhatla et al., 1998
; Baldwin, 2001
).
Activation of NF
B by cisplatin requires MEKK1 activity for both
transcriptional activation and nuclear translocation.
Induction of FasL-dependent apoptosis has been shown to take place
after exposure to several chemotherapeutic agents, including cisplatin
(Kasibhatla et al., 1998
; Razzaque et al., 1999
).
Accordingly, in our cell system c-DDP also induced FasL
expression. We here investigated the relative role of JNK and NF
B in
the regulation of expression of the proapoptotic protein FasL. We have
found that induction of transcription of FasL by cisplatin requires also the activity of MEKK1. Although MEKK1 activates both NF
B and
JNK pathways, only activation of JNK pathway seems to be relevant for
the induction of FasL transcription in this cell system. We have
previously published that CL100 was able to modulate cisplatin-induced apoptosis, both in human and mouse cells mainly due to inhibition of
JNK (Sánchez-Pérez et al., 2000
). In agreement
with these results, expression of CL100 also impairs activation of FasL
transcription, further supporting a role of FasL in cisplatin-induced
cell death in 293T cells. Accordingly, induction of apoptosis in renal
epithelial cells has been shown to be partially dependent on the FasL
activation of its receptor (Razzaque et al., 1999
). However,
activation of NF
B is not required for FasL transcription. On the
contrary, evidence in the literature indicates that activity of the
NF
B transcription factor is involved in protection to apoptosis
induced by different agents (Burow et al., 2000
; Chen
et al., 2000
; Cheng et al., 2000
; Baldwin, 2001
;
Javelaud and Besaçon 2001
; Karin et al., 2002
).
Work from different laboratories has demonstrated the possibility of a
cross-talk between the JNK and NF
B pathway (Maggirwar et
al., 2000
; Smaele et al., 2001
; Tang et al.,
2001
). To address this point, we used mouse cells defective in either
c-Jun and NF
B-dependent transcription or both. We have found that
inhibition of NF
B modifies the response of the cells to cisplatin.
The survival advantage of jun
/
cells,
resulting from the inhibition of Jun-dependent transcription, relies on
the activity of NF
B. Expression of the I
B
-SR protein in
c-jun
/
cells does not interfere with the
activation of JNK; therefore, the sensitization of these cells to
cisplatin is not due to the influence of NF
B on JNK activity as
described for TNF-
. Two different authors have recently reported
that activation of NF
B-dependent transcription by TNF-
inhibits
JNK activation, therefore protecting cells from TNF-
-induced
apoptosis (Smaele et al., 2001
; Tang et al.,
2001
). Here we observe the contrary effect, because activation of
c-jun-dependent transcription seems to negatively modulate the
survival effect of NF
B expression. Therefore, if c-Jun is not
expressed, cells are able to better tolerate cisplatin treatment. Indeed expression of MEKK1 in cells that lack c-jun induces
NF
B-dependent transcription much more efficiently than in WT cells.
Activation of p38 has also been involved in regulation of NF
B
signaling by cytokines such as TNF-
(Carter et al.,
1999
). In our cell system activation of p38 takes place with similar kinetics in cells that lack or express c-Jun. Moreover, modulation of
MEKK6/p38 has little influence in NF
B-dependent transcription in
contrast with the results reported in TNF-
-treated cells (Alpert et al., 1999
). In this system, stimuli such as certain types
of stress that produce a sustained activation of p38 are able to induce
inhibition of NF
B activation by TNF-
. These results suggest that
sustained activation of either JNK or p38 by different types of stress
may contribute to apoptosis by inhibiting NF
B activated survival pathways.
NF
B-dependent transcription can be regulated at different levels
(Schmitz et al., 2001
). Lack of c-Jun expression seems to have different effects in translocation of active NF
B complexes and
DNA binding to
B sequences. The amount of NF
B DNA-bound complexes
detected in cells treated either with TNF-
or cisplatin is higher in
WT cells and jun
/
cells constitutively
expressing c-Jun. These results correlate with a lower efficiency in
activation of NF
B-dependent transcription in
jun
/
cells when treated with TNF-
. Indeed,
the kinetics of I
K activation by cisplatin is slower in
c-Jun-deficient cells, indicating the importance of c-Jun for optimal
induction of the I
Ks. Alternatively, because I
B
is a
transcriptional target of NF
B, I
B
increased expression could
explain the differences observed in the gel retardation assays, between
c-jun
/
, c-jun
/+, and WT cells.
Here we demonstrate that the increase in NF
B-dependent
transcription, observed in jun
/
cells is due
to stimulation of p65 transcriptional activation. Both transient and
stable expression of the c-Jun protein in
c-jun
/
cells inhibits transcriptional
activation of the TAD of p65. p65 and c-Jun do not physically interact
(Maggirwar et al., 2000
), indicating that the repressive
effect observed of c-Jun on p65 TAD is not direct. In agreement with
this, we have observed that the effect is not reciprocal, because
expression of p65 is not able to inhibit c-Jun transcriptional
activation induced by expression of MEKK1.
P65/RelA interacts with the histone deacetylase corepressors HDAC1 and
HDAC2, inhibiting the transactivation function of NF
B in both basal
and stimulated scenarios (Ashburner et al., 2001
). Although
treatment of cells with TSA results in an increase of the basal
activity of NF
B, MEKK1-induced expression is not modified, suggesting that the mechanism of inhibition of NF
B by c-Jun is not
due to activation of histone deacetylase activities, at least HDAC1 or HDAC2.
MEKK1 has been described to stimulate p300-mediated transcription
(See, et al., 2001
). On the other hand, in PC12
cells, NF
B seems to inhibit c-Jun-dependent transcription by
competition for limited amounts of the coactivator protein p300
(Maggirwar et al., 2000
). We have not found in our system
any variation in p65 transcriptional activation in WT cells transfected
with MEKK1 and increased amounts of p300 expression vector. Therefore,
the inhibition that c-jun imposes over p65-dependent transcription might be due to competition with other coactivators or by association with repressors other than HDAC1 and 2.
The results presented here indicate that chemotherapeutic agents such
as cisplatin are able to induce cell death by modulating concomitantly
different signal transduction pathways. Sustained activation of JNK1
and activation of c-Jun upregulates transcription of proapoptotic genes
such as FasL (Kasibhatla et al., 1998
). On the other hand,
c-Jun negatively regulates survival signals triggered by NF
B, such
as XIAP, and in the absence of c-Jun, cells survive more to cisplatin
(Figure 11). When c-jun is not present
in the cells, the activation of the NF
B pathway upregulates expression of MIAP3, protecting cells from apoptosis induced by cisplatin. Works from other laboratories have shown that cisplatin inhibits XIAP expression in cisplatin-sensitive cells (Li et
al., 2001
; Matsumiya et al., 2001
) but not in
cisplatin-resistant cells. These observations are consistent with the
results that we present. The persistent expression of MIAP-3 in
c-jun
/
cells is in agreement with the lower
sensitivity of these cells to cisplatin. Thus, both the basal and
cisplatin-induced activation of NF
B-dependent transcription could
account for the sustained MIAP3 expression and high survival of
c-jun
/
cells exposed to cisplatin. c-Jun represses the expression
of genes whose transcription is controlled by p53 (Shaulian et
al., 2000
) after treatment with UV light. This work pointed out
the important role of c-jun in controlling cell cycle reentry after UV
damage, by repressing p21WAF transcription.
c-jun
/
cells are also resistant to apoptosis
induced by UV light. It would be interesting to determine if a similar
cross-talk between NF
B and JNK pathway in controlling survival in UV
irradiated cells as occurs in cisplatin-treated cells
|
The results presented here may have important implications in cancer
therapy protocols that include cisplatin. Different oncogenes involved
in the generation of human cancers activate signaling pathways that
upregulate NF
B-dependent transcription. Examples of these are
activated mutations of ras genes (Madrid et al., 2000
),
amplification of Her-2/neu (Zhou et al., 2000
), or
overexpression of EGFr (Hu et al., 1992
). All three
oncogenes induce survival signals by upregulation of the PI3K and
AKT/PKB pathways that leads to an increase of NF
B-dependent
transcription. These pathways may compensate for the c-Jun-dependent
inhibition of p65-induced transcription when tumors are treated with
cisplatin. On the other hand cells derived from several types of
carcinomas contain high levels of cIAPs, as a means to escape from
drug-induced apoptosis. Furthermore, cell lines derived from ovarian
and oral squamous cell carcinoma that constitutively express XIAP are
sensitive to cisplatin-induced apoptosis, only when XIAP expression is
downregulated. Thus, this implies that resistance to cisplatin involves
two complementary pathways that promote (i.e., NF
B) or repress
(i.e., c-Jun) XIAP expression. Consequently inhibition of NF
B
signaling may represent a good strategy to induce sensitivity to
cisplatin in these tumors.
| |
ACKNOWLEDGMENTS |
|---|
We thank L. Sastre for critical reading of the manuscript and useful comments and Ana Aranda for useful suggestions. I.S.-P. and S.A. are fellows from Comunidad Autónoma de Madrid and Fondo de Investigación Sanitaria, respectively. This study was supported by grants from Fondo de Investigación Sanitaria 00/0862 and 01/1094, and grants 2FD1997-1569 and SAF2001-2042.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: RPerona{at}iib.uam.es.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-01-0022. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-01-0022.
| |
REFERENCES |
|---|
|
|
|---|
-mediated p38 MAP kinase activation inhibit tumor necrosis factor-induced IkB phosphorylation and NF-kB activation.
J. Biol. Chem.
274, 22176-22183
-radiation.
J. Biol. Chem.
271, 31929-31936This article has been cited by other articles:
![]() |
N. Kravchenko-Balasha, S. Mizrachy-Schwartz, S. Klein, and A. Levitzki Shift from Apoptotic to Necrotic Cell Death during Human Papillomavirus-induced Transformation of Keratinocytes J. Biol. Chem., April 24, 2009; 284(17): 11717 - 11727. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Peklak-Scott, P. K. Smitherman, A. J. Townsend, and C. S. Morrow Role of glutathione S-transferase P1-1 in the cellular detoxification of cisplatin Mol. Cancer Ther., October 1, 2008; 7(10): 3247 - 3255. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Polk, M. E. Ellis, J. V. Kushleika, P. L. Simmonds, and J. S. Woods RhoA regulation of NF-{kappa}B activation is mediated by COX-2-dependent feedback inhibition of IKK in kidney epithelial cells Am J Physiol Cell Physiol, September 1, 2007; 293(3): C1160 - C1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sadagopan, N. Sharma-Walia, M. V. Veettil, H. Raghu, R. Sivakumar, V. Bottero, and B. Chandran Kaposi's Sarcoma-Associated Herpesvirus Induces Sustained NF-{kappa}B Activation during De Novo Infection of Primary Human Dermal Microvascular Endothelial Cells That Is Essential for Viral Gene Expression J. Virol., April 15, 2007; 81(8): 3949 - 3968. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Izzo, A. M. Correa, T.-T. Wu, U. Malhotra, C. K.S. Chao, R. Luthra, J. Ensor, A. Dekovich, Z. Liao, W. N. Hittelman, et al. Pretherapy nuclear factor-{kappa}B status, chemoradiation resistance, and metastatic progression in esophageal carcinoma. Mol. Cancer Ther., November 1, 2006; 5(11): 2844 - 2850. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Alvarez, J. I. F. Bass, J. R. Geffner, P. X. F. Calotti, M. Costas, O. A. Coso, R. Gamberale, M. E. Vermeulen, G. Salamone, D. Martinez, et al. Neutrophil Signaling Pathways Activated by Bacterial DNA Stimulation J. Immunol., September 15, 2006; 177(6): 4037 - 4046. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Cowland, T. Muta, and N. Borregaard IL-1beta-Specific Up-Regulation of Neutrophil Gelatinase-Associated Lipocalin Is Controlled by I{kappa}B-{zeta} J. Immunol., May 1, 2006; 176(9): 5559 - 5566. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Izzo, U. Malhotra, T.-T. Wu, J. Ensor, R. Luthra, J. H. Lee, S. G. Swisher, Z. Liao, K.S. C. Chao, W. N. Hittelman, et al. Association of Activated Transcription Factor Nuclear Factor {kappa}B With Chemoradiation Resistance and Poor Outcome in Esophageal Carcinoma J. Clin. Oncol., February 10, 2006; 24(5): 748 - 754. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Page, X. Wang, L. M. Sordillo, and S. E. Johnson MEKK1 Signaling through p38 Leads to Transcriptional Inactivation of E47 and Repression of Skeletal Myogenesis J. Biol. Chem., July 23, 2004; 279(30): 30966 - 30972. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||