![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 9, 2977-2989, September 2002


*School of Biochemistry and Genetics, University of Newcastle upon
Tyne, Newcastle NE2 4HH, United Kingdom;
Paterson
Institute for Cancer Research, Christie Hospital NHS Trust, Manchester
M20 4BX, United Kingdom; and §Biology Department, Boston
College, Chestnut Hill, Massachusetts 02467
| |
ABSTRACT |
|---|
|
|
|---|
In Schizosaccharomyces pombe, the Sty1
mitogen-activated protein kinase and the Atf1 transcription
factor control transcriptional induction in response to elevated salt
concentrations. Herein, we demonstrate that two repressors, Tup11 and
Tup12, and the Prr1 transcription factor also function in the response
to salt shock. We find that deletion of both tup genes
together results in hypersensitivity to elevated cation concentrations
(K+ and Ca2+) and we identify
cta3+, which encodes an intracellular
cation transporter, as a novel stress gene whose expression is
positively controlled by the Sty1 pathway and negatively regulated by
Tup repressors. The expression of
cta3+ is maintained at low levels by
the Tup repressors, and relief from repression requires the Sty1, Atf1,
and Prr1. Prr1 is also required for KCl-mediated induction of several
other Sty1-dependent genes such as
gpx1+ and
ctt1+. Surprisingly, the KCl-mediated
induction of cta3+ expression occurs
independently of Sty1 in a tup11
tup12
mutant and
so the Tup repressors link induction to the Sty1 pathway. We also
report that in contrast to a number of other Sty1- and Atf1-dependent
genes, the expression of cta3+ is
induced only by high salt concentrations. However, in the absence of
the Tup repressors this specificity is lost and a range of stresses
induces cta3+ expression.
| |
INTRODUCTION |
|---|
|
|
|---|
Exposure of cells to environmental stress triggers a rapid
increase in the transcription of genes whose products have protective functions (Toone and Jones, 1998
). Key to this response are
stress-activated protein kinase (SAPK) pathways that transmit the
signal from stress sensors to the transcription factors that regulate
gene expression. These pathways are evolutionarily conserved, and
homologs of the mammalian SAP kinases, p38/RK/CSBP (Marshall, 1994
),
are present in both Saccharomyces cerevisiae (Hog1)
(Brewster et al., 1993
) and Schizosaccharomyces
pombe (Sty1/Spc1) (Miller et al., 1995
; Shiozaki and
Russell, 1995
). The Hog1 pathway in S. cerevisiae is
activated essentially by hyperosmolarity (Brewster et al., 1993
), whereas the S. pombe Sty1 pathway, like mammalian
p38, is activated by a range of adverse conditions (Millar et
al., 1995
; Shiozaki and Russell, 1996
; Degols and Russell, 1997
;
Buck et al., 2001
).
Models of SAPK-dependent regulation of transcription have been almost
exclusively based upon the positive control of activators. However,
recent analysis of S. cerevisiae has demonstrated that the
Sko1 repressor regulates the expression of Hog1-dependent osmostress
genes, such as ENA1 and GRE2, via recruitment of
the Ssn6(Cyc8)-Tup1 global corepressor complex (Marquez et
al., 1998
; Proft and Serrano, 1999
; Garcia-Gimeno and Struhl,
2000
; Proft et al., 2001
). Ssn6-Tup1 mediates its function
via the organization of repressive chromatin structures (Cooper
et al., 1994
; Edmondson et al., 1996
; Watson
et al., 2000
; Bone and Roth, 2001
; Wu et al.,
2001
) and by inhibition of the basal transcription machinery (Redd
et al., 1997
; Papamichos-Chronakis et al., 2000
;
Zaman et al., 2001
). This global repressor controls the
expression of numerous genes through interaction with a variety of
site-specific DNA binding proteins (Smith and Johnson, 2000
). Relief
from this repression is achieved by control of the proteins that serve
to tether the complex to DNA; for example, Sko1 is phosphorylated by
Hog1 at three sites in its N-terminal region, disrupting the
interaction with Ssn6-Tup1 (Proft et al., 2001
). Therefore,
a component of the osmotic induction of some genes occurs via
derepression rather than by activation.
In fission yeast, Sty1 operates via the transcriptional activators
Atf1/Gad7 (Takeda et al., 1995
; Kanoh et al.,
1996
) and Pap1 (Toda et al., 1991
). Atf1 is phosphorylated
in a Sty1-dependent manner and loss of Atf1 results in hypersensitivity
to osmotic stress, high levels of calcium, and an inability to respond
to deteriorating nutritional conditions (Takeda et al.,
1995
; Kanoh et al., 1996
; Ohmiya et al., 1999b
).
In addition, Atf1 forms a heterodimeric complex with Pcr1, a related
ATF/CREB factor, which is also required for transcriptional induction
of some stress genes (Watanabe and Yamamoto, 1996
). Pap1 activates
transcription in response to oxidative stress, and its subcellular
localization is regulated in a Sty1-dependent manner (Toone et
al., 1998
). Recently, Prr1, a homolog of Skn7 in S. cerevisiae (Brown et al., 1993
), has also been
implicated in the transcriptional response to oxidative stress (Ohmiya
et al., 1999a
). Skn7 and Prr1 have heat-shock
factor-like DNA binding domains and also share homology with
bacterial "two-component" response regulators that are controlled by histidine-to-aspartate phosphorelay systems (Appleby et
al., 1996
).
Herein, we have addressed the roles of the Tup-like repressors Tup11
and Tup12 (Mukai et al., 1999
; Janoo et al.,
2001
) in the response to stress in S. pombe. We find that
deletion of both tup genes in combination results in
hypersensitivity to KCl and CaCl2, and we also
identify cta3+ as a novel stress gene that
is negatively regulated by Tup11-Tup12. The expression of
cta3+ is rapidly and specifically induced
in response to salt shock in a Sty1- and Atf1-dependent manner, but the
dependence on the Sty1 pathway for induction is lost in a
tup11
tup12
mutant. Furthermore, Tup11 and Tup12
proteins function as specificity factors by preventing induction of
cta3+ in response to inappropriate
stresses such as heat and oxidative stress. We also reveal a new role
for the "response regulator" protein Prr1 and demonstrate that it
is required for proper KCl-mediated transcriptional induction of
Sty1-dependent genes such as cta3+,
ctt1+, and
gpx1+.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains
Routine culture of S. pombe and general genetic
methods were performed as described in Moreno et al. (1991)
.
The strains used in this study are described in Table
1. The cta3+
gene was disrupted using a polymerase chain reaction (PCR)-based approach as described by Bahler et al. (1998)
.
Oligonucleotides 5' KO
(5'-TTTGATTTTACTTATATTTCTCCCCTTCTACTCATCCCGATATATTCTTACTTCCTTGATTCAATCTCAAATATTGTTCAGCTTAGCTACAAATCCCACT-3') and KO 3'
(5'-ATAAATCCTTTACGATTTGTCGGTTCTGTGAAAACGATACACTCACGCATATTCATATACATATTCATGGCAAGAAAACATCTGACATAAAACGCCTAGG-3') were used to amplify a 1.6-kb
ura4+-containing fragment from pRep42. The
amplified fragment was used to transform strain NT5 strain to
Ura+, creating strain SW95. Integration at the
correct locus was confirmed by PCR analysis.
|
Plasmids
The tup11+ coding sequence was
amplified by PCR from a cDNA library by using the following primers:
5'-GCACGGATCCCATGGCGTCAGTGGAGGATGC-3' and 5'-CTAGGGATCCAATTCAA-GGAGATGCAGGGTC-3'. The tup12+ coding
sequence was amplified using primers
5'-GCACGGATCCCATGATTACTGTCCGCCAATC-3' and
5'-CTGCTAGGCATATGGCGCTCATGAAACAAACCG-3'. Fragments were cleaved with
BamHI and cloned into the BamHI site of
derivatives of pRep41 and pRep42 vectors that allow the expression of
proteins as N-terminal HA or 6HisMyc fusions (Craven et al.,
1998
).
RNA Analysis
RNA samples were prepared from 0.25 to 0.5 × 109 cells. Pellets were washed in
H2O and resuspended in 200 µl of RNA buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 50 mM EDTA pH 8.0, and 0.25% SDS)
with 200 µl of phenol/chloroform. Cells were disrupted with 0.75 ml
of glass beads (0.5 mm; Biospec Products, Bartlesville, OK) in a
Ribolyser (Hybaid, Middlesex, United Kingdom). A further 0.75 ml of RNA
buffer was added followed by spinning in a microfuge for 10 min. The
aqueous layer was subjected to two further phenol/chloroform extractions before the RNA was precipitated with 0.1 volume of sodium
acetate, pH 5.2, and 0.6 volume of isopropanol. RNA pellets were washed
in 70% ethanol and resuspended in H2O. RNA
analysis was as described by White et al. (1986)
. Briefly, a
10-15-µg sample of total RNA was denatured with glyoxal, separated
on a 1.2% agarose gel prepared in 15 mM sodium phosphate, pH 6.5, and
transferred to a GeneScreen hybridization membrane (PerkinElmer Life
Sciences, Boston, MA). The his3+
probe has been described previously (Baum et al., 1997
).
Other gene-specific probes were produced by PCR amplification from
genomic DNA by using the appropriate primers. All probes were labeled with [
-32P]dCTP by using a Prime-a-Gene
labeling kit (Promega, Madison, WI). Transcript levels were quantified
relative to the loading control using a PhosphorImager BAS-1500 (Fuji
Photo Film, Tokyo, Japan).
-Galactosidase Assays
Assays were performed as described previously (Takeda et
al., 1995
).
Coprecipitations
Whole cell extracts were prepared as described by Whitehall
et al. (1999)
with some modification. Cultures were grown to
mid-log phase (OD595 = 0.25-0.5) in EMM medium.
Cells were harvested washed once and snap frozen. Pellets were washed
in 1 ml of lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5%
NP-40, 10 mM imidazole, 2 µg/ml pepstatin, 2 µg/ml leupeptin, 2 µg/ml aprotinin, and 100 µg/ml phenylmethylsulfonyl fluoride).
Cells were disrupted with 2 ml of glass beads by vortexing twice for
45 s with 1-min incubation on ice in between. Protein extracts
were recovered and centrifuged at 13,000 rpm for 10 min at 4°C.
Protein precipitations were performed by adding 25 µl of
nickel-agarose (50% slurry in lysis buffer) to 1 mg of whole protein
extract and incubating at 4°C for 1 h with gentle agitation.
Precipitates were recovered by centrifugation and washed four times
with lysis buffer containing 200 mM NaCl and 20 mM imidazole. Samples
were analyzed by SDS-PAGE and proteins were transferred to
nitrocellulose membrane and subjected to Western blotting by using
monoclonal hemagglutinin (HA) (12CA5) antibody (Babco, Berkeley, CA).
Electrophoretic Mobility Shift Assays (EMSAs)
Whole cell extracts were prepared as described above except that
cells were grown in YE5S medium and extracts were prepared in buffer
containing 25 mM HEPES pH 7.6, 0.1 mM EDTA, 150 mM KCl, 0.1% Triton
X-100, 25% glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride 2 µg/ml pepstatin, 2 µg/ml leupeptin, and 2 µg/ml
aprotinin. Radiolabeled DNA fragments were prepared using PCR
amplification as described in Zhu et al. (1994)
. The
oligonucleotides used for amplification of probe 1 were
5'-TAAAACACCGACATGTAGCC-3' and 5'-TTGAGAGAAACTAACCAAGG-3'. The
oligonucleotides for probe 2 were 5'-CTCTGTCATGGAAATCCACAC-3' and
5'-ATAAGCAGCAAAGCTTGCCTG-3'. Binding reactions were performed by adding
15 µg of whole cell extract to 20-µl reactions containing 25 mM
HEPES pH 7.6, 34 mM KCl, 5 mM MgCl2, and 2 µg
of poly[d(I-C)]. Reactions were incubated for 10 min at room
temperature before the addition of ~0.5 ng of radiolabeled probe DNA
followed by a further 20-min incubation. Samples were analyzed by
electrophoresis through 4% polyacrylamide gels run in 0.5×
Tris-borate-EDTA buffer. Antibody supershift was performed by adding
0.2 µg of monoclonal HA antibody (12CA5) (Babco) 10 min after the
addition of probe DNA.
| |
RESULTS |
|---|
|
|
|---|
To address the role of repressors in the transcriptional response
to stress in fission yeast we examined whether cells lacking the
tup genes tup11+ and
tup12+ exhibited any stress-related
phenotypes. We found that single and double tup mutant
strains exhibited an increased tolerance to cadmium but that the
tup11
tup12
mutant strain had decreased tolerance to
elevated levels of Ca2+ and
K+ ions. The degree of sensitivity to these salt
stresses was similar to that associated with loss of either the Atf1
transcription factor or the Sty1 MAP kinase that are known to control
the induction of genes in response to elevated cation concentrations
(Shiozaki and Russell, 1996
; Wilkinson et al., 1996
). The
tup11
tup12
double mutant strain was only slightly
less sensitive to KCl than the sty1-1 and atf1
strains and the tup11
tup12
strain was actually more
sensitive to CaCl2 than strain lacking Sty1
(Figure 1A). In contrast, the double
tup mutant strain had wild-type levels of tolerance to high
sorbitol concentrations, indicating that although they are
K+- and Ca2+-intolerant
they are not osmosensitive (our unpublished data).
|
The similarity in the sensitivities of tup11
tup12
and
atf1
strains to elevated
K+/Ca2+ ions was unexpected
because Tup11 and Tup12 have been previously demonstrated to be
repressors (Mukai et al., 1999
; Janoo et al., 2001
), whereas Atf1 is primarily a transcriptional activator. We
therefore investigated whether tup11
tup12
cells
shared any other phenotypes with atf1
cells. It has
recently been demonstrated that atf1
cells are sensitive
to an acute oxidative stress (Nguyen et al., 2000
; Quinn
et al., 2002
). When challenged with a high dose of
H2O2 (50 mM)
atf1
cells rapidly lose viability (Figure 1B). In
contrast, tup11
tup12
cells were only slightly more sensitive than wild-type cells in this assay. Furthermore, although atf1
cells conjugate poorly (Takeda et al.,
1995
), a tup11
tup12
strain conjugates in
nutrient-rich media (Janoo et al., 2001
). Hence,
tup11
tup12
cells and atf1
cells share
only a subset of phenotypes. Taken together, these findings are
consistent with Tup11 and Tup12 having overlapping functions and
indicate that Tup11 and Tup12 play roles in the cellular response to stress.
Tup11 and Tup12 Negatively Regulate Expression of Salt-Stress gene cta3+
Cells lacking atf1+ and both
tup genes have similar sensitivities to salt stress and so
we examined whether the expression of genes known to be induced by
exposure to salt stress, via Atf1, were also regulated by the Tup
repressors (Figure 2, A and B). We found
that expression of cta3+, which encodes a
cation-transporting P-type ATPase (Ghislain et al., 1990
;
Halachmi et al., 1992
; Benito et al., 2002
), was markedly influenced by loss of the Tup proteins; deletion of both tup genes together resulted in a large increase in the basal
level of expression (Figure 2, A and B). Loss of both Tup proteins also resulted in a large increase in expression after exposure to
CaCl2 (Figure 2, A and B) and KCl (Figures 5, 7,
and 8). Thus, Tup11 and Tup12 function in a partially redundant manner
to repress cta3+ expression and limit the
level of induction. As previously observed (Nishikawa et
al., 1999
), the induction of cta3+
expression is completely dependent upon both the Sty1 MAP kinase and
the Atf1 transcription factor, and thus
cta3+ displays a novel pattern of stress
regulation that is positively controlled by Sty1 and Atf1 but
negatively regulated by the Tup repressors. Indeed, deletion of the
tup genes either singly or in combination had only
minor effects on the expression levels of other Sty1-dependent
genes such as gpd1+,
ctt1+, and
gpx1+ in unstressed cells and in cells
subjected to a CaCl2 shock (Figure 2, A and B).
|
To confirm that increased level of cta3+
transcripts associated with deletion of tup genes was due to
an effect on transcription and not mRNA stability, we measured the
expression of an integrated cta3+
promoter
lacZ reporter (Nishikawa et al., 1999
).
It is highly unlikely that Tup repressors would specifically influence
the stability of lacZ transcripts. Consistent with the
Northern analysis, deletion of both the tup genes resulted
in 14-fold increase in expression of the lacZ reporter
relative to the wild-type control (Figure 2C). Furthermore, exposure of
cells to high KCl concentrations (0.6 M for 1 h) increased the
level of expression sevenfold in wild-type cells and threefold in the
cells lacking the Tup repressors (Figure 2C). These results suggest
that S. pombe Tup proteins exert their effects at the level
of transcription.
To determine whether the high level of
cta3+ expression observed in the
tup11
tup12
double mutant confers the increased
sensitivity of this strain to elevated K+ and
Ca2+ concentrations we examined the effect of
deleting the cta3+ gene in the presence or
absence of the tup genes. Loss of Cta3 function has
previously been reported to result in increased sensitivity to elevated
Ca2+ concentrations (Ghislain et al.,
1990
). In contrast, Nishikawa et al. (1999)
found that cta3
null cells did not exhibit any detectable change in resistance to
K+, Ca2+, or
Na+ ions. In agreement with the latter study our
cta3
mutant exhibited wild-type levels of resistance to
both Ca2+ and K+ (Figure
2D). Moreover, deletion of the cta3+ gene
in a tup11
tup12
strain did not rescue the
salt-sensitive phenotype associated with the loss of the tup
genes (Figure 2D), and plasmid-mediated overexpression of
cta3+ in wild-type cells did not result in
any increased sensitivity to KCl or CaCl2 (our
unpublished data). These results indicate that the salt sensitivity of
tup
cells is not simply due to the
elevated expression of the cta3+ gene.
To date, the fbp1+ gene encoding fructose
1,6-bisphosphatase is the only gene that has been identified as a
target gene for Tup11-Tup12-mediated repression (Mukai et
al., 1999
; Janoo et al., 2001
). The expression of
fbp1+ is also positively regulated by the
Sty1 pathway (Takeda et al., 1995
; Kanoh et al.,
1996
; Stettler et al., 1996
), but its expression is induced
by carbon limitation (Hoffman and Winston, 1991
) and not by other acute
stresses that activate Sty1, such as heat shock, oxidative stress, and
osmotic shock. Furthermore, the cAMP pathway negatively regulates the
expression of fbp1+, and mutations that
disrupt this pathway result in increased expression under repressing
(glucose-rich) conditions (Hoffman and Winston, 1991
). In contrast,
growing cells under carbon-limiting conditions did not induce the
expression of cta3+ nor were mRNA levels
influenced by a deletion of git2+ that
encodes adenylate cyclase (our unpublished data).
Formation of Protein Complexes on the cta3+ Promoter
Studies have indicated that Atf1 binds constitutively to a
CRE binding site in the gpd1+
promoter (Wilkinson et al., 1996
). In contrast, EMSAs of the fbp1+ promoter have demonstrated that Atf1
associates with a CRE-like element in UAS1 only under activating
(glucose-limiting) conditions (Neely and Hoffman, 2000
). We therefore
examined the ability of Aft1 to bind to the
cta3+ promoter. Inspection of the DNA
sequence revealed the presence of a number of potential CRE-like Atf1
binding sites located between
1111 and
1401 relative to the
initiation codon (Figure 3A). We
performed EMSAs by using whole cell extracts and a DNA fragment corresponding to the
1477 to
1297 region of the promoter. This region includes a near consensus CRE element and two CRE-like sequences
containing the highly conserved ACGT core sequence. A major
slow-migrating complex was formed on this probe (Figure 3B). This
binding activity was not changed by subjecting cells to stress (KCl 0.6 M for 15 min) before extract preparation. The complex was also present
in extracts derived from atf1
cells, indicating that it
does not require Atf1. Furthermore, the mobility of the complex was
unchanged when HA antibody was included in reactions containing HA
epitope-tagged Atf1 (our unpublished data). Next, we examined the
ability of complexes to form on a probe corresponding to the
1249 and
1058 region of the promoter that contains a single CRE element. In
this case, we also observed a binding activity that was
Atf1-independent (Figure 3C). However, we also detected a
slow-migrating complex that was absent in reactions lacking Atf1. Also,
the mobility of this complex was reduced by the addition of the HA
antibody to reactions containing HA epitope-tagged Atf1. This
Atf1-dependent complex was present in reactions using extracts derived
from unstressed and stressed cells, indicating that at least under
these experimental conditions Atf1 binds constitutively to this region
of the cta3+ promoter. We were unable to
properly assess the role of Tup proteins on DNA binding activity;
when tup
extracts were used a marked
reduction in the level of complex formation on both probes was
observed. However, this seemed to be due to difficulties in preparing
extracts from these cells rather than a specific effect because we
found that extracts lacking Tup proteins also showed a reduced ability
to form complexes on a DNA probe unrelated to the
cta3+ promoter (our unpublished data).
|
Tup11 and Tup12 Interact
Our data indicate that Tup11 is capable of repressing
cta3+ expression in the absence of Tup12
and vice versa. It is also known that S. cerevisiae Tup1
tetramerizes through its N-terminal domain (Varanasi et al.,
1996
; Jabet et al., 2000
) and based on homology it is very
likely that the S. pombe Tup proteins form homotetramers. However, it is possible that in addition to functioning in homomeric complexes Tup11 and Tup12 may also function in a heteromeric complex. Therefore, we investigated the ability of Tup11 and Tup12 to interact using a coprecipitation assay. Whole cell extracts were prepared from
wild-type cells that expressed 6His-tagged Tup11 (or Tup12) and
coexpressed HA-tagged Tup11 (or Tup12).
Ni2+-agarose was then used to precipitate
His-tagged Tup proteins, and the presence of HA-tagged Tup proteins was
examined by Western blotting (Figure 4).
In these experiments, Tup11 copurified with Tup12 and vice versa,
indicating that Tup11 and Tup12 physically interact. The specificity of
this interaction was demonstrated by the absence of HA-tagged Tup
proteins in control precipitates derived from cells extracts expressing
the empty 6His vector (Figure 4, lanes 7 and 8). Thus, Tup11 and Tup12
have the potential to regulate gene expression in the same protein
complex.
|
Tup Repressors Link Transcriptional Induction to the Sty1 Pathway
To test whether the high level of
cta3+ expression observed in the absence
of the Tup repressors was dependent upon the Sty1 MAP kinase
cta3+ mRNA levels were examined in a
strain that lacks both Sty1 and Tup function (sty1-1 tup11
tup12
). In this mutant the level of
cta3+ transcripts was similar to that
observed in tup11
tup12
cells, indicating that Sty1 is
not required for basal levels of expression (Figure
5, A and B). Surprisingly, exposure of
this strain to a KCl-mediated shock resulted in induction of
cta3+ expression, indicating that in the
absence of the Tup proteins the Sty1 MAP kinase is not required for the
stress-mediated induction of cta3+.
Consistent with these observations the expression of
cta3+ was also induced by salt shock (0.6 M KCl) in a sty1
tup11
tup12
strain (our
unpublished data). The expression of other genes such as
pyp2+ and
gpd1+ was not induced in the sty1-1
tup11
tup12
triple mutant, although deletion of the
tup genes did restore the basal level of expression in
sty1
cells (Figure 5A). The kinetics of
KCl-mediated induction of cta3+ were
similar in wild-type and tup11
tup12
cells, with mRNA levels peaking at 20 min but elevated mRNA levels persisted for a
greater length of time in cells lacking the Tup proteins (Figure 5, C
and D). In the sty1-1 tup11
tup12
triple mutant strain induction was delayed and peak mRNA levels were not observed until 30 min after the addition of KCl.
|
We next determined whether removal of Tup11 and Tup12 rescued any of
the other phenotypes associated with loss of Sty1. We examined the
ability of cells to grow on medium supplemented with cadmium. Deletion
of the tup genes in a sty1+
background increases resistance to cadmium (Figure 1A) but unexpectedly deletion of tup11+ and
tup12+ in a sty1-1 background
reduced cadmium tolerance (Figure 6A). Thus, the resistance of tup
cells to
cadmium depends on Sty1 function and in its absence they become
hypersensitive. The elongated cell morphology of sty1-1 cells that is indicative of a G2 cell cycle delay was slightly exacerbated by deletion of the tup genes (Figure 6B).
Furthermore, deletion of the tup genes in an
aft1
or a sty1-1 background resulted in a
small increase in sensitivity to KCl and the tup11
tup12
atf1
triple mutant strain was slightly less tolerant to
CaCl2 than the parental strains (Figure 6C).
|
We next addressed whether removal of Tup11-Tup12 repression rendered
the induction of cta3+ independent of
Atf1. Deletion of atf1+ in a
tup11
tup12
mutant strain resulted in a further
increase in cta3+ transcript levels in
unstressed cells, suggesting that nonactivated Atf1 may have a
repressive effect on transcription that is independent of Tup11 and
Tup12 (Figure 7, A and B). A similar
effect has been observed previously; the decrease in the basal level of
ctt1+ mRNA associated with loss of Sty1
function is suppressed by deletion of
atf1+ (Degols and Russell, 1997
). In the
atf1
tup11
tup12
background, cta3+ mRNA levels did not increase after
exposure to KCl (0.6 M), indicating that Atf1 is absolutely required
for induction of cta3+ in response to a
salt shock.
|
The bZIP transcription factor Pcr1 that can heterodimerize with Atf1
(Kanoh et al., 1996
) is also required for stress-mediated induction of cta3+ expression (Figure 7, C
and D). Examination of cta3+ mRNA levels
in a pcr1
tup11
tup12
strain revealed that Pcr1 is
not required for the high level of basal expression, and furthermore in
this strain expression of cta3+ was
partially induced in response to a salt shock. Thus, the Tup repressors
ensure that induction of cta3+ remains
dependent upon the Sty1 MAP kinase and to a lesser extent, the
activator Pcr1.
Prr1 Is Involved in Regulation of Gene Expression in Response to Elevated K+ Ions
Our analysis suggests that another factor may regulate
transcription of cta3+ independently of
Sty1. The Prr1 transcription factor is known to regulate oxidative
stress responsive genes (Ohmiya et al., 1999a
), but there is
no evidence that Sty1 regulates its activity directly. Therefore, we
analyzed mRNA levels in a prr1
strain and found that the
level of cta3+ transcripts after exposure
to KCl was significantly reduced in comparison with the wild-type
strain (Figure 8, A and B). Furthermore, the influence of Prr1 was not confined to the
cta3+ gene because KCl-mediated induction
of both ctt1+ and
gpx1+ expression was also significantly
reduced in the prr1
mutant strain. This was surprising
because Prr1 has previously been reported not to be involved in the
transcriptional response to high salt (Ohmiya et al., 1999a
)
and indeed KCl-mediated induction of some genes such as
gpd1+ occurs independently of Prr1 (Ohmiya
et al., 1999a
; Figure 8, A and B). To determine the role
that Prr1 plays in control of cta3+
expression, we measured cta3+ mRNA levels
in a tup11
tup12
prr1
triple mutant strain. In this
background the expression of cta3+ was
induced by exposure to high concentrations of KCl (0.6 M) (Figure 8, C
and D). However, the deletion of prr1+ in
a tup11
tup12
background resulted in a decrease in the
basal level of cta3+ mRNA (Figure 8, C and
D). Thus, Prr1 activity contributes to the high basal level of
expression that is associated with loss of the Tup repressors.
|
In vitro experiments have demonstrated that recombinant Prr1 binds to a
heat shock-like element in the ste11+
promoter (Ohmiya et al., 1999b
). Analysis of the
cta3+ promoter revealed the presence of
such an element (GGAAAATTC) located at
2068 relative to the
initiation codon. However, in assays using this region of the promoter
and whole cell extracts we were unable to detect a Prr1-dependent
binding activity (our unpublished data). Therefore, we cannot exclude
the possibility that the role of Prr1 in regulation of
cta3+ expression is indirect.
Tup11 and Tup12 Prevent Induction in Response to Inappropriate Stresses
Sty1, and thus in turn Atf1-Pcr1, is activated in response to a
number of environmental insults. Accordingly, the expression of Atf1-
and Pcr1-dependent genes such as ctt1+,
pyp2+, and
gpx1+ are induced in response to a variety
of stresses such as UV irradiation, heat shock, and hyperosmolarity and
an oxidative stress elicited by exposure to high concentrations of
H2O2 (Shiozaki and Russell, 1996
; Wilkinson et al., 1996
; Degols and Russell, 1997
;
Nguyen et al., 2000
; Quinn et al., 2002
).
However, some Atf1-Pcr1 target genes are induced only by a subset of
these stresses. For example, we found that
cta3+ expression was induced specifically
in response to salt shock but not by oxidative stress (6 mM
H2O2) or by heat shock (15 min at 42°C) (Figure 9, A and D). In
contrast, ctt1+ and
gpx1+ mRNA levels were both induced by
these treatments, indicating that Atf1 (and Pcr1) were active under
these conditions. This indicates that activation of the Sty1 pathway
per se is not sufficient to induce the expression of
cta3+ and mechanisms must exist to prevent
induction of gene expression in response to such "inappropriate
stresses." We wanted to examine the possibility that Tup11 and Tup12
play a role in this process. Therefore, we measured the levels of
cta3+ mRNA after exposing a tup11
tup12
strain to an oxidative stress (6 mM
H2O2) and a heat shock (15 min at 42°C). In contrast to the wild-type strain, the expression of
cta3+ was significantly induced by heat
stress and by exposure to high levels of
H2O2. In addition, the
level of cta3+ transcripts was induced by
hypotonic conditions in a tup11
tup12
strain but not
in a wild-type strain (our unpublished data). We also examined
cta3+ transcript levels in a sty1
tup11
tup12
triple mutant strain (Figure 9, B and D). This
revealed that the induction in expression in response to heat shock was
partly independent of the MAP kinase. In contrast, the induction of
cta3+ expression in response to oxidative
stress mediated by H2O2 was completely dependent upon Sty1, suggesting a difference in the mechanism of induction. Further analysis indicated that the response to
heat shock was independent of Prr1 (Figure 9, C and D) but dependent
upon Atf1 (our unpublished data). Taken together, these findings
indicate that the Tup repressors function as part of the mechanism that
ensures the specificity of stress-mediated transcriptional induction at
the cta3+ promoter.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we reveal roles for S. pombe Tup11 and
Tup12 in the cellular response to elevated K+ and
Ca2+ levels. We identify
cta3+ as a novel stress-induced gene whose
transcription is coregulated by the Sty1 MAP kinase pathway and the Tup
repressors. Our results indicate that the Tup repressors fulfill a
number of functions in the control of
cta3+ expression. First, they maintain low
levels of basal expression and limit the level of induction. Second,
they ensure that induction of expression is linked to the Sty1 pathway.
And third, they maintain the specificity of induction. We also reveal a
new role for the response regulator Prr1 and demonstrate that it
functions to regulate gene expression in response to elevated salt
concentrations. Prr1 is known to contribute to the regulation of
several genes whose expression is induced by oxidative stress via the
Pap1 transcription factor (Ohmiya et al., 1999a
), and so
Prr1 regulates gene expression in response to a number of stresses.
Tup11-Tup12 Interaction
Our data and that of others (Mukai et al., 1999
; Janoo
et al., 2001
) suggest that Tup11 and Tup12 can function in
homomeric complexes. In addition, we demonstrate that Tup11 and Tup12
have the potential to form a heteromeric complex. This is significant because full function requires both repressors; some derepression of a
fbp1::lacZ reporter is observed upon deletion of a
single tup gene (Janoo et al., 2001
).
Furthermore, single tup mutants have demonstrable phenotypes
such as increased resistance to cadmium. Thus, regulation of some genes
may depend upon both repressors and the formation of heteromeric Tup complexes.
Relief of Tup11-Tup12-mediated Repression
The Hog1 MAP kinase in S. cerevisiae plays a direct
role in relieving Ssn6-Tup1-mediated repression at osmostress genes;
Hog1 phosphorylates Sko1, reducing its affinity for the corepressor complex (Proft et al., 2001
). It is possible that the Sty1
MAP kinase may similarly antagonize the action of Tup11-Tup12; however, our results demonstrate that the Atf1, Pcr1, and Prr1 transcription factors are required for relief from Tup-mediated repression at the
cta3+ promoter. It is probable that the
S. pombe Tup proteins function, at least in part, through
the organization of repressive chromatin structures (Mukai et
al., 1999
), and therefore it is possible that Atf1-Pcr1 and Prr1
overcome this repression by recruiting positive-acting chromatin
remodeling complexes such as Swi-Snf or histone acetylase complexes
(HATs). In support of this, DNA binding by the Atf1-Pcr1 heterodimer is
known to alter local nucleosome positioning at the ade6-M26
hotspot and thereby promote meiotic recombination (Mizuno et
al., 1997
; Kon et al., 1998
). Moreover, genes such as
SUC2 in S. cerevisiae are regulated by the
interplay between Ssn6-Tup1 repression and Swi-Snf-mediated activation
(Gavin and Simpson, 1997
).
In S. cerevisiae, Hog1-dependent transcriptional
induction of HAL1 requires the Gcn4 activator that relieves
Tup1-Ssn6-mediated repression by competing with Sko1 for the occupancy
of a single CRE binding site (Pascual-Ahuir et al., 2001
).
This CRE element functions as a dual control element and integrates
both positive and negative regulatory signals. Furthermore, analysis of
the S. pombe fbp1+ promoter, which is
regulated by both Atf1-Pcr1 and Tup11-Tup12, has demonstrated the
presence of a control element (called UAS2) that contains a CRE-like
sequence and is bound by multiple activators and repressors (Neely and
Hoffman, 2000
). Interestingly, the Atf1-Pcr1 transcription factor does
not bind to UAS2 directly, but it does influence the protein complexes
that assemble on it (Neely and Hoffman 2000
). The
cta3+ promoter contains a number of
CRE-like elements at least one of which mediates Atf1 binding (Figure
3C). It will be interesting to determine the contributions of these
elements to activation and repression of
cta3+ transcription.
Tup Repressors Maintain Specificity of Induction
The advent of stressful conditions results in the rapid and
Sty1-dependent phosphorylation of Atf1 (Shiozaki and Russell, 1996
;
Wilkinson et al., 1996
). Although the precise role of Atf1 phosphorylation remains obscure, it is evident that transcriptional activation by Atf1 is dependent upon Sty1. However, deletion of the
tup genes allows transcriptional induction of
cta3+ to occur in
sty1
cells. Furthermore, in a
tup11
tup12
mutant induction of
cta3+ expression does not require Pcr1 or
Prr1. Thus, the Tup repressors function to "wire" induction to the
Sty1 pathway, insulating it from interfering signals. These results
also suggest that Atf1 activity can be "uncoupled" from Sty1 in
this specific case and that an additional mechanism for activating
transcription that requires Atf1 exists. The finding that Prr1 also
controls expression of cta3+ suggests that
it may function as part of this mechanism.
The Sty1 pathway in S. pombe is fundamentally different to
the Hog1 pathway in S. cerevisiae because it is triggered by
exposure to a wide range of adverse environmental conditions. As a
consequence, a large number of Sty1 target genes are up-regulated by
multiple stresses. The products of such genes may comprise a set of
"general stress response proteins" that are necessary because a
single environmental insult may result in multiple classes of
intracellular stress (Rep et al., 2001
).
Nonetheless, discrete stimuli also produce distinct transcriptional
outputs, because there are subsets of Sty1-dependent genes, such as
cta3+, that are induced only by specific
stresses. A major question to be addressed is the mechanism by which
Sty1 signaling is integrated into the regulation of such genes.
Expression of cta3+ is not induced by
oxidative stress, heat shock, carbon limitation, or sexual
differentiation (Figure 6; our unpublished data), and furthermore
cta3+ is only poorly induced by an osmotic
shock mediated by high sorbitol concentrations (Nishikawa et
al., 1999
). Thus, the transcriptional response is triggered
essentially by elevated intracellular cation concentrations rather than
by an osmotic effect (i.e., decrease in turgor pressure across the
plasma membrane). The cta3+ gene encodes a
putative intracellular P-type ATPase transporter that is involved in
cation extrusion or sequestration into intracellular compartments. Loss
of function leads to an accumulation of cytoplasmic Ca2+ levels (Ghislain et al., 1990
;
Halachmi et al., 1992
), although recent evidence suggests
that Cta3 is primarily a K+ ion pump (Benito
et al., 2002
). It is thus consistent that it is salt stress
that specifically that triggers its transcriptional induction. However,
removal of the constraints imposed by Tup repressors allows
cta3+ to be induced in response to other
stresses such as elevated temperature and oxidative stress. Thus, the
Tup repressors function as a part of a mechanism that adds specificity
to Sty1-dependent transcriptional induction.
Our results also indicate that activation of the Sty1 pathway alone is
insufficient to induce cta3+ expression
and implies that an elevated cation concentration triggers an
additional pathway that is required to circumvent repression (Figure
10). In this respect it may be
significant that Prr1 is involved in the regulation of
cta3+ expression because its structure
suggests that it may be one part the target of a histidine-aspartate
phosphorelay pathway. Recent work has identified several of these
pathways in fission yeast (Nguyen et al., 2000
; Buck
et al., 2001
), and current experiments are addressing its
contribution to the regulation of Prr1 in the response to stress.
|
| |
ACKNOWLEDGMENTS |
|---|
We thank Janet Quinn, Mark Toone, and Burk Braun for advice on the manuscript. We also thank Burk Braun, Hirofumi Aiba, and Jonathan Millar for providing strains. This work was supported by a National Institutes of Health grant GM-46226 (to C.S.H.), by a Medical Research Council Ph.D. research studentship (to P.M.), a Medical Research Council Career Establishment Grant (to B.A.M.), and by a Biotechnology and Biological Sciences Research Council project grant (13/P11981) (to S.K.W.).
| |
FOOTNOTES |
|---|
Present address: Sir William Dunn School of
Pathology, University of Oxford, South Parks Rd., Oxford OX1 3RE,
United Kingdom.
Corresponding author. E-mail address:
s.k.whitehall{at}ncl.ac.uk.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.01-12-0568. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.01-12-0568.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Gao, M. K. Davidson, and W. P. Wahls Distinct regions of ATF/CREB proteins Atf1 and Pcr1 control recombination hotspot ade6-M26 and the osmotic stress response Nucleic Acids Res., May 1, 2008; 36(9): 2838 - 2851. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. T. George, G. Brooks, and T. C. Humphrey Regulation of Cell Cycle and Stress Responses to Hydrostatic Pressure in Fission Yeast Mol. Biol. Cell, October 1, 2007; 18(10): 4168 - 4179. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fagerstrom-Billai, M. Durand-Dubief, K. Ekwall, and A. P. H. Wright Individual Subunits of the Ssn6-Tup11/12 Corepressor Are Selectively Required for Repression of Different Target Genes Mol. Cell. Biol., February 1, 2007; 27(3): 1069 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hirota, C. S. Hoffman, and K. Ohta Reciprocal Nuclear Shuttling of Two Antagonizing Zn Finger Proteins Modulates Tup Family Corepressor Function To Repress Chromatin Remodeling Eukaryot. Cell, December 1, 2006; 5(12): 1980 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Johnsson, Y. Xue-Franzen, M. Lundin, and A. P. H. Wright Stress-specific role of fission yeast gcn5 histone acetyltransferase in programming a subset of stress response genes. Eukaryot. Cell, August 1, 2006; 5(8): 1337 - 1346. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-y. Wang, K. Shimada, M. Morishita, and K. Shiozaki Response of Fission Yeast to Toxic Cations Involves Cooperative Action of the Stress-Activated Protein Kinase Spc1/Sty1 and the Hal4 Protein Kinase Mol. Cell. Biol., May 15, 2005; 25(10): 3945 - 3955. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Fagerstrom-Billai and A. P. H. Wright Functional Comparison of the Tup11 and Tup12 Transcriptional Corepressors in Fission Yeast Mol. Cell. Biol., January 15, 2005; 25(2): 716 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bulmer, A. Pic-Taylor, S. K. Whitehall, K. A. Martin, J. B. A. Millar, J. Quinn, and B. A. Morgan The Forkhead Transcription Factor Fkh2 Regulates the Cell Division Cycle of Schizosaccharomyces pombe Eukaryot. Cell, August 1, 2004; 3(4): 944 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stiefel, L. Wang, D. A. Kelly, R. T. K. Janoo, J. Seitz, S. K. Whitehall, and C. S. Hoffman Suppressors of an Adenylate Cyclase Deletion in the Fission Yeast Schizosaccharomyces pombe Eukaryot. Cell, June 1, 2004; 3(3): 610 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Znaidi, B. Pelletier, Y. Mukai, and S. Labbe The Schizosaccharomyces pombe Corepressor Tup11 Interacts with the Iron-responsive Transcription Factor Fep1 J. Biol. Chem., March 5, 2004; 279(10): 9462 - 9474. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hirota, T. Hasemi, T. Yamada, K.-i. Mizuno, C. S. Hoffman, T. Shibata, and K. Ohta Fission yeast global repressors regulate the specificity of chromatin alteration in response to distinct environmental stresses Nucleic Acids Res., February 3, 2004; 32(2): 855 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chen, W. M. Toone, J. Mata, R. Lyne, G. Burns, K. Kivinen, A. Brazma, N. Jones, and J. Bahler Global Transcriptional Responses of Fission Yeast to Environmental Stress Mol. Biol. Cell, January 1, 2003; 14(1): 214 - 229. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||