INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Exposure of cells to environmental stress triggers a rapid increase in the transcription of genes whose products have protective functions (Toone and Jones, 1998). Key to this response are stress-activated protein kinase (SAPK) pathways that transmit the signal from stress sensors to the transcription factors that regulate gene expression. These pathways are evolutionarily conserved, and homologs of the mammalian SAP kinases, p38/RK/CSBP (Marshall, 1994), are present in both Saccharomyces cerevisiae (Hog1) (Brewster et al., 1993) and Schizosaccharomyces pombe (Sty1/Spc1) (Miller et al., 1995; Shiozaki and Russell, 1995). The Hog1 pathway in S. cerevisiae is activated essentially by hyperosmolarity (Brewster et al., 1993), whereas the S. pombe Sty1 pathway, like mammalian p38, is activated by a range of adverse conditions (Millar et al., 1995; Shiozaki and Russell, 1996; Degols and Russell, 1997; Buck et al., 2001).

Models of SAPK-dependent regulation of transcription have been almost exclusively based upon the positive control of activators. However, recent analysis of S. cerevisiae has demonstrated that the Sko1 repressor regulates the expression of Hog1-dependent osmostress genes, such as ENA1 and GRE2, via recruitment of the Ssn6(Cyc8)-Tup1 global corepressor complex (Marquez et al., 1998; Proft and Serrano, 1999; Garcia-Gimeno and Struhl, 2000; Proft et al., 2001). Ssn6-Tup1 mediates its function via the organization of repressive chromatin structures (Cooper et al., 1994; Edmondson et al., 1996; Watson et al., 2000; Bone and Roth, 2001; Wu et al., 2001) and by inhibition of the basal transcription machinery (Redd et al., 1997; Papamichos-Chronakis et al., 2000; Zaman et al., 2001). This global repressor controls the expression of numerous genes through interaction with a variety of site-specific DNA binding proteins (Smith and Johnson, 2000). Relief from this repression is achieved by control of the proteins that serve to tether the complex to DNA; for example, Sko1 is phosphorylated by Hog1 at three sites in its N-terminal region, disrupting the interaction with Ssn6-Tup1 (Proft et al., 2001). Therefore, a component of the osmotic induction of some genes occurs via derepression rather than by activation.

In fission yeast, Sty1 operates via the transcriptional activators Atf1/Gad7 (Takeda et al., 1995; Kanoh et al., 1996) and Pap1 (Toda et al., 1991). Atf1 is phosphorylated in a Sty1-dependent manner and loss of Atf1 results in hypersensitivity to osmotic stress, high levels of calcium, and an inability to respond to deteriorating nutritional conditions (Takeda et al., 1995; Kanoh et al., 1996; Ohmiya et al., 1999b). In addition, Atf1 forms a heterodimeric complex with Pcr1, a related ATF/CREB factor, which is also required for transcriptional induction of some stress genes (Watanabe and Yamamoto, 1996). Pap1 activates transcription in response to oxidative stress, and its subcellular localization is regulated in a Sty1-dependent manner (Toone et al., 1998). Recently, Prr1, a homolog of Skn7 in S. cerevisiae (Brown et al., 1993), has also been implicated in the transcriptional response to oxidative stress (Ohmiya et al., 1999a). Skn7 and Prr1 have heat-shock factor-like DNA binding domains and also share homology with bacterial "two-component" response regulators that are controlled by histidine-to-aspartate phosphorelay systems (Appleby et al., 1996).

Herein, we have addressed the roles of the Tup-like repressors Tup11 and Tup12 (Mukai et al., 1999; Janoo et al., 2001) in the response to stress in S. pombe. We find that deletion of both tup genes in combination results in hypersensitivity to KCl and CaCl₂, and we also identify cta3⁺ as a novel stress gene that is negatively regulated by Tup11-Tup12. The expression of cta3⁺ is rapidly and specifically induced in response to salt shock in a Sty1- and Atf1-dependent manner, but the dependence on the Sty1 pathway for induction is lost in a tup11 tup12 mutant. Furthermore, Tup11 and Tup12 proteins function as specificity factors by preventing induction of cta3⁺ in response to inappropriate stresses such as heat and oxidative stress. We also reveal a new role for the "response regulator" protein Prr1 and demonstrate that it is required for proper KCl-mediated transcriptional induction of Sty1-dependent genes such as cta3⁺, ctt1⁺, and gpx1⁺.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Strains

Routine culture of S. pombe and general genetic methods were performed as described in Moreno et al. (1991). The strains used in this study are described in Table 1. The cta3⁺ gene was disrupted using a polymerase chain reaction (PCR)-based approach as described by Bahler et al. (1998). Oligonucleotides 5' KO (5'-TTTGATTTTACTTATATTTCTCCCCTTCTACTCATCCCGATATATTCTTACTTCCTTGATTCAATCTCAAATATTGTTCAGCTTAGCTACAAATCCCACT-3') and KO 3' (5'-ATAAATCCTTTACGATTTGTCGGTTCTGTGAAAACGATACACTCACGCATATTCATATACATATTCATGGCAAGAAAACATCTGACATAAAACGCCTAGG-3') were used to amplify a 1.6-kb ura4⁺-containing fragment from pRep42. The amplified fragment was used to transform strain NT5 strain to Ura⁺, creating strain SW95. Integration at the correct locus was confirmed by PCR analysis.

Plasmids

The tup11⁺ coding sequence was amplified by PCR from a cDNA library by using the following primers: 5'-GCACGGATCCCATGGCGTCAGTGGAGGATGC-3' and 5'-CTAGGGATCCAATTCAA-GGAGATGCAGGGTC-3'. The tup12⁺ coding sequence was amplified using primers 5'-GCACGGATCCCATGATTACTGTCCGCCAATC-3' and 5'-CTGCTAGGCATATGGCGCTCATGAAACAAACCG-3'. Fragments were cleaved with BamHI and cloned into the BamHI site of derivatives of pRep41 and pRep42 vectors that allow the expression of proteins as N-terminal HA or 6HisMyc fusions (Craven et al., 1998).

RNA Analysis

RNA samples were prepared from 0.25 to 0.5 × 10⁹ cells. Pellets were washed in H₂O and resuspended in 200 µl of RNA buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 50 mM EDTA pH 8.0, and 0.25% SDS) with 200 µl of phenol/chloroform. Cells were disrupted with 0.75 ml of glass beads (0.5 mm; Biospec Products, Bartlesville, OK) in a Ribolyser (Hybaid, Middlesex, United Kingdom). A further 0.75 ml of RNA buffer was added followed by spinning in a microfuge for 10 min. The aqueous layer was subjected to two further phenol/chloroform extractions before the RNA was precipitated with 0.1 volume of sodium acetate, pH 5.2, and 0.6 volume of isopropanol. RNA pellets were washed in 70% ethanol and resuspended in H₂O. RNA analysis was as described by White et al. (1986). Briefly, a 10-15-µg sample of total RNA was denatured with glyoxal, separated on a 1.2% agarose gel prepared in 15 mM sodium phosphate, pH 6.5, and transferred to a GeneScreen hybridization membrane (PerkinElmer Life Sciences, Boston, MA). The his3⁺ probe has been described previously (Baum et al., 1997). Other gene-specific probes were produced by PCR amplification from genomic DNA by using the appropriate primers. All probes were labeled with [-³²P]dCTP by using a Prime-a-Gene labeling kit (Promega, Madison, WI). Transcript levels were quantified relative to the loading control using a PhosphorImager BAS-1500 (Fuji Photo Film, Tokyo, Japan).

-Galactosidase Assays

Assays were performed as described previously (Takeda et al., 1995).

Coprecipitations

Whole cell extracts were prepared as described by Whitehall et al. (1999) with some modification. Cultures were grown to mid-log phase (OD₅₉₅ = 0.25-0.5) in EMM medium. Cells were harvested washed once and snap frozen. Pellets were washed in 1 ml of lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% NP-40, 10 mM imidazole, 2 µg/ml pepstatin, 2 µg/ml leupeptin, 2 µg/ml aprotinin, and 100 µg/ml phenylmethylsulfonyl fluoride). Cells were disrupted with 2 ml of glass beads by vortexing twice for 45 s with 1-min incubation on ice in between. Protein extracts were recovered and centrifuged at 13,000 rpm for 10 min at 4°C. Protein precipitations were performed by adding 25 µl of nickel-agarose (50% slurry in lysis buffer) to 1 mg of whole protein extract and incubating at 4°C for 1 h with gentle agitation. Precipitates were recovered by centrifugation and washed four times with lysis buffer containing 200 mM NaCl and 20 mM imidazole. Samples were analyzed by SDS-PAGE and proteins were transferred to nitrocellulose membrane and subjected to Western blotting by using monoclonal hemagglutinin (HA) (12CA5) antibody (Babco, Berkeley, CA).

Electrophoretic Mobility Shift Assays (EMSAs)

Whole cell extracts were prepared as described above except that cells were grown in YE5S medium and extracts were prepared in buffer containing 25 mM HEPES pH 7.6, 0.1 mM EDTA, 150 mM KCl, 0.1% Triton X-100, 25% glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride 2 µg/ml pepstatin, 2 µg/ml leupeptin, and 2 µg/ml aprotinin. Radiolabeled DNA fragments were prepared using PCR amplification as described in Zhu et al. (1994). The oligonucleotides used for amplification of probe 1 were 5'-TAAAACACCGACATGTAGCC-3' and 5'-TTGAGAGAAACTAACCAAGG-3'. The oligonucleotides for probe 2 were 5'-CTCTGTCATGGAAATCCACAC-3' and 5'-ATAAGCAGCAAAGCTTGCCTG-3'. Binding reactions were performed by adding 15 µg of whole cell extract to 20-µl reactions containing 25 mM HEPES pH 7.6, 34 mM KCl, 5 mM MgCl₂, and 2 µg of poly[d(I-C)]. Reactions were incubated for 10 min at room temperature before the addition of ~0.5 ng of radiolabeled probe DNA followed by a further 20-min incubation. Samples were analyzed by electrophoresis through 4% polyacrylamide gels run in 0.5× Tris-borate-EDTA buffer. Antibody supershift was performed by adding 0.2 µg of monoclonal HA antibody (12CA5) (Babco) 10 min after the addition of probe DNA.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

To address the role of repressors in the transcriptional response to stress in fission yeast we examined whether cells lacking the tup genes tup11⁺ and tup12⁺ exhibited any stress-related phenotypes. We found that single and double tup mutant strains exhibited an increased tolerance to cadmium but that the tup11 tup12 mutant strain had decreased tolerance to elevated levels of Ca²⁺ and K⁺ ions. The degree of sensitivity to these salt stresses was similar to that associated with loss of either the Atf1 transcription factor or the Sty1 MAP kinase that are known to control the induction of genes in response to elevated cation concentrations (Shiozaki and Russell, 1996; Wilkinson et al., 1996). The tup11 tup12 double mutant strain was only slightly less sensitive to KCl than the sty1-1 and atf1 strains and the tup11 tup12 strain was actually more sensitive to CaCl₂ than strain lacking Sty1 (Figure 1A). In contrast, the double tup mutant strain had wild-type levels of tolerance to high sorbitol concentrations, indicating that although they are K⁺- and Ca²⁺-intolerant they are not osmosensitive (our unpublished data).

View larger version (26K): [in this window] [in a new window]   Figure 1.   Stress-related phenotypes of cells lacking Tup repressors. (A) Exponentially growing cultures (~0.4 × 107 cells/ml) were diluted serially, spotted onto YE5S agar, and incubated for 2-3 d at 30°C or spotted onto YE5S agar supplemented with CaCl2, KCl, or CdSO4 at the indicated concentration and incubated for 3-4 d at 30°C. (B) Exponentially growing cultures of wild type (w.t.) (NT4), atf1 (NT147), and tup11 tup12 (SW76) strains were treated with H2O2 (to a final concentration of 50 mM), and viable cell numbers were determined by plating onto YE5S agar.

The similarity in the sensitivities of tup11 tup12 and atf1 strains to elevated K⁺/Ca²⁺ ions was unexpected because Tup11 and Tup12 have been previously demonstrated to be repressors (Mukai et al., 1999; Janoo et al., 2001), whereas Atf1 is primarily a transcriptional activator. We therefore investigated whether tup11 tup12 cells shared any other phenotypes with atf1 cells. It has recently been demonstrated that atf1 cells are sensitive to an acute oxidative stress (Nguyen et al., 2000; Quinn et al., 2002). When challenged with a high dose of H₂O₂ (50 mM) atf1 cells rapidly lose viability (Figure 1B). In contrast, tup11 tup12 cells were only slightly more sensitive than wild-type cells in this assay. Furthermore, although atf1 cells conjugate poorly (Takeda et al., 1995), a tup11 tup12 strain conjugates in nutrient-rich media (Janoo et al., 2001). Hence, tup11 tup12 cells and atf1 cells share only a subset of phenotypes. Taken together, these findings are consistent with Tup11 and Tup12 having overlapping functions and indicate that Tup11 and Tup12 play roles in the cellular response to stress.

Tup11 and Tup12 Negatively Regulate Expression of Salt-Stress gene cta3⁺

Cells lacking atf1⁺ and both tup genes have similar sensitivities to salt stress and so we examined whether the expression of genes known to be induced by exposure to salt stress, via Atf1, were also regulated by the Tup repressors (Figure 2, A and B). We found that expression of cta3⁺, which encodes a cation-transporting P-type ATPase (Ghislain et al., 1990; Halachmi et al., 1992; Benito et al., 2002), was markedly influenced by loss of the Tup proteins; deletion of both tup genes together resulted in a large increase in the basal level of expression (Figure 2, A and B). Loss of both Tup proteins also resulted in a large increase in expression after exposure to CaCl₂ (Figure 2, A and B) and KCl (Figures 5, 7, and 8). Thus, Tup11 and Tup12 function in a partially redundant manner to repress cta3⁺ expression and limit the level of induction. As previously observed (Nishikawa et al., 1999), the induction of cta3⁺ expression is completely dependent upon both the Sty1 MAP kinase and the Atf1 transcription factor, and thus cta3⁺ displays a novel pattern of stress regulation that is positively controlled by Sty1 and Atf1 but negatively regulated by the Tup repressors. Indeed, deletion of the tup genes either singly or in combination had only minor effects on the expression levels of other Sty1-dependent genes such as gpd1⁺, ctt1⁺, and gpx1⁺ in unstressed cells and in cells subjected to a CaCl₂ shock (Figure 2, A and B).

View larger version (39K): [in this window] [in a new window]   Figure 2.   Tup11 and Tup12 repress the transcription of the salt stress gene cta3+. (A) Strains used are indicated above the lane and were wild type (w.t.) (NT4), tup12 (BSP03), tup11 (SW53), tup11 tup12 (SW76), atf1 (78 T147), and sty1-1 (JM1144). Log phase cultures growing at 30°C in YE5S (lanes 1, 4, 7, 10, 13, and 16) were incubated with CaCl2 (to final concentration of 0.3 M) for 15 min (lanes 2, 5, 8, 11, 14, and 17) and 30 min (lanes 3, 6, 9, 12, 15, and 18). Total RNA was extracted, separated by electrophoresis, and Northern blots were analyzed with the indicated probes. The level of his3+ mRNA was used as a loading control. (B) Quantification of cta3+ mRNA levels in A. (C) Influence of Tup proteins on the activity of a cta3-lacZ reporter. -Galactosidase assays were performed on extracts derived from exponentially growing cells (open bars) and cells treated with KCl to 0.6 M for 60 min (black bars). The strains used were wild type (w.t.) (HAI003) and tup11 tup12 (SW107). Data is the mean of three independent cultures. (D) Deletion of cta3+ does not rescue the salt sensitivity of tup11 tup12 cells. Exponentially growing cultures (~0.4 × 107 cells/ml) were diluted serially, spotted onto YE5S agar and incubated for 2-3 d at 30°C or spotted onto YE5S agar supplemented with CaCl2 or KCl (at the indicated concentration) and incubated for 3-4 d at 30°C. Strains used were wild type (w.t.) (NT4), tup11 tup12 (SW76), cta3 (SW95), and cta3 tup11 tup12 (SW93).

To confirm that increased level of cta3⁺ transcripts associated with deletion of tup genes was due to an effect on transcription and not mRNA stability, we measured the expression of an integrated cta3⁺ promoterlacZ reporter (Nishikawa et al., 1999). It is highly unlikely that Tup repressors would specifically influence the stability of lacZ transcripts. Consistent with the Northern analysis, deletion of both the tup genes resulted in 14-fold increase in expression of the lacZ reporter relative to the wild-type control (Figure 2C). Furthermore, exposure of cells to high KCl concentrations (0.6 M for 1 h) increased the level of expression sevenfold in wild-type cells and threefold in the cells lacking the Tup repressors (Figure 2C). These results suggest that S. pombe Tup proteins exert their effects at the level of transcription.

To determine whether the high level of cta3⁺ expression observed in the tup11 tup12 double mutant confers the increased sensitivity of this strain to elevated K⁺ and Ca²⁺ concentrations we examined the effect of deleting the cta3⁺ gene in the presence or absence of the tup genes. Loss of Cta3 function has previously been reported to result in increased sensitivity to elevated Ca²⁺ concentrations (Ghislain et al., 1990). In contrast, Nishikawa et al. (1999) found that cta3 null cells did not exhibit any detectable change in resistance to K⁺, Ca²⁺, or Na⁺ ions. In agreement with the latter study our cta3 mutant exhibited wild-type levels of resistance to both Ca²⁺ and K⁺ (Figure 2D). Moreover, deletion of the cta3⁺ gene in a tup11 tup12 strain did not rescue the salt-sensitive phenotype associated with the loss of the tup genes (Figure 2D), and plasmid-mediated overexpression of cta3⁺ in wild-type cells did not result in any increased sensitivity to KCl or CaCl₂ (our unpublished data). These results indicate that the salt sensitivity of tup cells is not simply due to the elevated expression of the cta3⁺ gene.

To date, the fbp1⁺ gene encoding fructose 1,6-bisphosphatase is the only gene that has been identified as a target gene for Tup11-Tup12-mediated repression (Mukai et al., 1999; Janoo et al., 2001). The expression of fbp1⁺ is also positively regulated by the Sty1 pathway (Takeda et al., 1995; Kanoh et al., 1996; Stettler et al., 1996), but its expression is induced by carbon limitation (Hoffman and Winston, 1991) and not by other acute stresses that activate Sty1, such as heat shock, oxidative stress, and osmotic shock. Furthermore, the cAMP pathway negatively regulates the expression of fbp1⁺, and mutations that disrupt this pathway result in increased expression under repressing (glucose-rich) conditions (Hoffman and Winston, 1991). In contrast, growing cells under carbon-limiting conditions did not induce the expression of cta3⁺ nor were mRNA levels influenced by a deletion of git2⁺ that encodes adenylate cyclase (our unpublished data).

Formation of Protein Complexes on the cta3⁺ Promoter

Studies have indicated that Atf1 binds constitutively to a CRE binding site in the gpd1⁺ promoter (Wilkinson et al., 1996). In contrast, EMSAs of the fbp1⁺ promoter have demonstrated that Atf1 associates with a CRE-like element in UAS1 only under activating (glucose-limiting) conditions (Neely and Hoffman, 2000). We therefore examined the ability of Aft1 to bind to the cta3⁺ promoter. Inspection of the DNA sequence revealed the presence of a number of potential CRE-like Atf1 binding sites located between 1111 and 1401 relative to the initiation codon (Figure 3A). We performed EMSAs by using whole cell extracts and a DNA fragment corresponding to the 1477 to 1297 region of the promoter. This region includes a near consensus CRE element and two CRE-like sequences containing the highly conserved ACGT core sequence. A major slow-migrating complex was formed on this probe (Figure 3B). This binding activity was not changed by subjecting cells to stress (KCl 0.6 M for 15 min) before extract preparation. The complex was also present in extracts derived from atf1 cells, indicating that it does not require Atf1. Furthermore, the mobility of the complex was unchanged when HA antibody was included in reactions containing HA epitope-tagged Atf1 (our unpublished data). Next, we examined the ability of complexes to form on a probe corresponding to the 1249 and 1058 region of the promoter that contains a single CRE element. In this case, we also observed a binding activity that was Atf1-independent (Figure 3C). However, we also detected a slow-migrating complex that was absent in reactions lacking Atf1. Also, the mobility of this complex was reduced by the addition of the HA antibody to reactions containing HA epitope-tagged Atf1. This Atf1-dependent complex was present in reactions using extracts derived from unstressed and stressed cells, indicating that at least under these experimental conditions Atf1 binds constitutively to this region of the cta3⁺ promoter. We were unable to properly assess the role of Tup proteins on DNA binding activity; when tup extracts were used a marked reduction in the level of complex formation on both probes was observed. However, this seemed to be due to difficulties in preparing extracts from these cells rather than a specific effect because we found that extracts lacking Tup proteins also showed a reduced ability to form complexes on a DNA probe unrelated to the cta3⁺ promoter (our unpublished data).

View larger version (48K): [in this window] [in a new window]   Figure 3.   Complexes formed on the cta3+ promoter. (A) Schematic of the CRE-like elements in the cta3+ promoter and the probes used for EMSAs. Consensus or near consensus CRE elements are shaded black, and the CRE-like sequences containing an ACGT core are shaded gray. Their locations are given relative to the initiation codon. (B) EMSAs were performed with probe 1 by using whole cell extracts derived from exponentially growing atf1HA (KS14709), w.t. (NT4), or atf1 (NT147) cells as indicated above the lanes. The extract used in lane 3 was derived from atf1HA6H cells treated with KCl (0.6 M for 15 min) immediately before extract preparation. Lane 1 is a probe alone control. (C) EMSAs were performed with probe 2 by using extracts derived from exponentially growing cells (lanes 2, 4, and 5) or cells treated with KCl (0.6 M for 15 min) immediately before extract preparation (lane 3). The identity of the extract is indicated above the lane. The reaction in lane 4 contained 0.2 µg of HA antibody. Lane 1 is a probe alone control. Arrows mark the positions of the Atf1-dependent shifted (S) and supershifted (SS) complexes.

Tup11 and Tup12 Interact

Our data indicate that Tup11 is capable of repressing cta3⁺ expression in the absence of Tup12 and vice versa. It is also known that S. cerevisiae Tup1 tetramerizes through its N-terminal domain (Varanasi et al., 1996; Jabet et al., 2000) and based on homology it is very likely that the S. pombe Tup proteins form homotetramers. However, it is possible that in addition to functioning in homomeric complexes Tup11 and Tup12 may also function in a heteromeric complex. Therefore, we investigated the ability of Tup11 and Tup12 to interact using a coprecipitation assay. Whole cell extracts were prepared from wild-type cells that expressed 6His-tagged Tup11 (or Tup12) and coexpressed HA-tagged Tup11 (or Tup12). Ni²⁺-agarose was then used to precipitate His-tagged Tup proteins, and the presence of HA-tagged Tup proteins was examined by Western blotting (Figure 4). In these experiments, Tup11 copurified with Tup12 and vice versa, indicating that Tup11 and Tup12 physically interact. The specificity of this interaction was demonstrated by the absence of HA-tagged Tup proteins in control precipitates derived from cells extracts expressing the empty 6His vector (Figure 4, lanes 7 and 8). Thus, Tup11 and Tup12 have the potential to regulate gene expression in the same protein complex.

View larger version (31K): [in this window] [in a new window]   Figure 4.   Tup11 and Tup12 coprecipitate. Whole cell extracts were prepared from wild-type cells containing plasmids expressing epitope-tagged Tup proteins: pRep42-HisMycTup12 (lanes 1-3), pRep42-HisMycTup11 (lanes 4-6), pRep42-HisMyc empty vector (lanes 7 and 8), pRep41-HATup12 (lanes 1, 4, and 7), and pRep41-HATup11 (lanes 2, 5, and 8). Extracts were precipitated with Ni2+-agarose analyzed on 8% SDS polyacrylamide gels and subjected to Western blotting by using HA monoclonal antibody.

Tup Repressors Link Transcriptional Induction to the Sty1 Pathway

To test whether the high level of cta3⁺ expression observed in the absence of the Tup repressors was dependent upon the Sty1 MAP kinase cta3⁺ mRNA levels were examined in a strain that lacks both Sty1 and Tup function (sty1-1 tup11 tup12). In this mutant the level of cta3⁺ transcripts was similar to that observed in tup11 tup12 cells, indicating that Sty1 is not required for basal levels of expression (Figure 5, A and B). Surprisingly, exposure of this strain to a KCl-mediated shock resulted in induction of cta3⁺ expression, indicating that in the absence of the Tup proteins the Sty1 MAP kinase is not required for the stress-mediated induction of cta3⁺. Consistent with these observations the expression of cta3⁺ was also induced by salt shock (0.6 M KCl) in a sty1 tup11 tup12 strain (our unpublished data). The expression of other genes such as pyp2⁺ and gpd1⁺ was not induced in the sty1-1 tup11 tup12 triple mutant, although deletion of the tup genes did restore the basal level of expression in sty1 cells (Figure 5A). The kinetics of KCl-mediated induction of cta3⁺ were similar in wild-type and tup11 tup12 cells, with mRNA levels peaking at 20 min but elevated mRNA levels persisted for a greater length of time in cells lacking the Tup proteins (Figure 5, C and D). In the sty1-1 tup11 tup12 triple mutant strain induction was delayed and peak mRNA levels were not observed until 30 min after the addition of KCl.

View larger version (31K): [in this window] [in a new window]   Figure 5.   Deletion of tup11+ and tup12+ allows Sty1-independent transcriptional induction of cta3+. (A) Strains used are indicated above the lanes and were wild type (w.t.) (NT4), sty1-1 (JM1144), sty1-1 tup12 (SW88), sty1-1 tup11 (SW89), tup11 tup12 (SW76), and sty1-1 tup11 tup12 (SW90). Log phase cultures growing at 30°C in YE5S (lanes 1, 3, 5, 7, 9, and 11) were incubated with KCl (to a final concentration of 0.6 M) for 15 min (lanes 2, 4, 6, 8, 10, and 12). Total RNA was extracted, separated by electrophoresis, and analyzed by Northern blotting with the indicated probes. The level of his3+ mRNA was used as a loading control. (B) Quantification of the cta3+ mRNA levels in A. (C) Kinetics of the induction of cta3+ mRNA in response to KCl shock. Log phase cultures growing at 30°C in YE5S (lanes 1, 7, and 13) were incubated with KCl (to a final concentration of 0.6 M) for 10 min (lanes 2, 8, and 14), 20 min (lanes 3, 9, and 15), 30 min (lanes 4, 10, and 16), 40 min (lanes 5, 11, and 17), or 50 min (lanes 6, 12 and 18). The strains used were wild type (w.t.) (NT4), tup11 tup12 (SW76), and sty1-1 tup11 tup12 (SW90). Total RNA was extracted, separated by electrophoresis, and analyzed by Northern blotting with the indicated probes. (D) Quantification of the cta3+ mRNA levels in C.

We next determined whether removal of Tup11 and Tup12 rescued any of the other phenotypes associated with loss of Sty1. We examined the ability of cells to grow on medium supplemented with cadmium. Deletion of the tup genes in a sty1⁺ background increases resistance to cadmium (Figure 1A) but unexpectedly deletion of tup11⁺ and tup12⁺ in a sty1-1 background reduced cadmium tolerance (Figure 6A). Thus, the resistance of tup cells to cadmium depends on Sty1 function and in its absence they become hypersensitive. The elongated cell morphology of sty1-1 cells that is indicative of a G2 cell cycle delay was slightly exacerbated by deletion of the tup genes (Figure 6B). Furthermore, deletion of the tup genes in an aft1 or a sty1-1 background resulted in a small increase in sensitivity to KCl and the tup11 tup12 atf1 triple mutant strain was slightly less tolerant to CaCl₂ than the parental strains (Figure 6C).

View larger version (90K): [in this window] [in a new window]   Figure 6.   Genetic interactions. (A) Deletion of the tup genes does not rescue phenotypes associated with the sty1-1 mutation. The indicated strains were subcultured onto YE5S agar (control) or subcultured onto YE5S agar supplemented with CdSO4 (to the indicated concentration) and incubated at 30°C for 3-4 d. (B) Comparison of the morphology of wild type (w.t.) (NT4), sty1-1 (JM1144), tup11 tup12 (SW76), and sty1-1 tup11 tup12 (SW90) cells. (C) Exponentially growing cultures were diluted serially, spotted onto YE5S agar or YE5S agar supplemented with CaCl2 or KCl (at the indicated concentration), and incubated for 2 d at 30°C. The strains used were wild type (w.t.) (NT4), tup11 tup12 (SW76), sty1-1 (JM1144), sty1-1 tup11 tup12 (SW90) atf1 (NT147), and atf1 tup11 tup12 (SW92).

We next addressed whether removal of Tup11-Tup12 repression rendered the induction of cta3⁺ independent of Atf1. Deletion of atf1⁺ in a tup11 tup12 mutant strain resulted in a further increase in cta3⁺ transcript levels in unstressed cells, suggesting that nonactivated Atf1 may have a repressive effect on transcription that is independent of Tup11 and Tup12 (Figure 7, A and B). A similar effect has been observed previously; the decrease in the basal level of ctt1⁺ mRNA associated with loss of Sty1 function is suppressed by deletion of atf1⁺ (Degols and Russell, 1997). In the atf1 tup11 tup12 background, cta3⁺ mRNA levels did not increase after exposure to KCl (0.6 M), indicating that Atf1 is absolutely required for induction of cta3⁺ in response to a salt shock.

View larger version (54K): [in this window] [in a new window]   Figure 7.   Transcription induction of cta3+ in cells lacking Tup11 and Tup12 is Atf1 dependent. (A) Strains used are indicated above the lanes and were wild type (w.t.) (NT4), atf1 (NT147), tup11 tup12 (SW76), and atf1 tup11 tup12 (SW92). Log phase cultures growing at 30°C in YE5S (lanes 1, 3, 5, and 7) were incubated with KCl (to a final concentration of 0.6 M) for 15 min (lanes 2, 4, 6, and 8). Total RNA was extracted, separated by electrophoresis and subjected to Northern analysis with the indicated probes. The level of cdc2+ mRNA was used as a loading control. (B) Quantification of cta3+ mRNA levels in A. (C) As for A, except strains used were wild type (w.t.) (NT4), pcr1 (JX25), tup11 tup12 (SW76), and pcr1 tup11 tup12 (RJP59). (D) Quantification of cta3+ mRNA levels in C.

The bZIP transcription factor Pcr1 that can heterodimerize with Atf1 (Kanoh et al., 1996) is also required for stress-mediated induction of cta3⁺ expression (Figure 7, C and D). Examination of cta3⁺ mRNA levels in a pcr1 tup11 tup12 strain revealed that Pcr1 is not required for the high level of basal expression, and furthermore in this strain expression of cta3⁺ was partially induced in response to a salt shock. Thus, the Tup repressors ensure that induction of cta3⁺ remains dependent upon the Sty1 MAP kinase and to a lesser extent, the activator Pcr1.

Prr1 Is Involved in Regulation of Gene Expression in Response to Elevated K⁺ Ions

Our analysis suggests that another factor may regulate transcription of cta3⁺ independently of Sty1. The Prr1 transcription factor is known to regulate oxidative stress responsive genes (Ohmiya et al., 1999a), but there is no evidence that Sty1 regulates its activity directly. Therefore, we analyzed mRNA levels in a prr1 strain and found that the level of cta3⁺ transcripts after exposure to KCl was significantly reduced in comparison with the wild-type strain (Figure 8, A and B). Furthermore, the influence of Prr1 was not confined to the cta3⁺ gene because KCl-mediated induction of both ctt1⁺ and gpx1⁺ expression was also significantly reduced in the prr1 mutant strain. This was surprising because Prr1 has previously been reported not to be involved in the transcriptional response to high salt (Ohmiya et al., 1999a) and indeed KCl-mediated induction of some genes such as gpd1⁺ occurs independently of Prr1 (Ohmiya et al., 1999a; Figure 8, A and B). To determine the role that Prr1 plays in control of cta3⁺ expression, we measured cta3⁺ mRNA levels in a tup11 tup12 prr1 triple mutant strain. In this background the expression of cta3⁺ was induced by exposure to high concentrations of KCl (0.6 M) (Figure 8, C and D). However, the deletion of prr1⁺ in a tup11 tup12 background resulted in a decrease in the basal level of cta3⁺ mRNA (Figure 8, C and D). Thus, Prr1 activity contributes to the high basal level of expression that is associated with loss of the Tup repressors.

View larger version (48K): [in this window] [in a new window]   Figure 8.   Prr1 is involved in the regulation of gene expression in response to high salt. (A) Strains used are indicated above the lanes and were wild type (w.t.) (NT4) and prr1 (SW97). Log phase cultures growing at 30°C in YE5S (lanes 1 and 3) were incubated with KCl (to a final concentration of 0.6 M) for 15 min (lanes 2 and 4). Total RNA was prepared and subjected to Northern analysis with the indicated probes. The level of his3+ mRNA was used as a loading control. (B) Quantification of the mRNA levels in A. (C) Strains used are indicated above the lanes and were tup11 tup12 (SW76) and prr1 tup11 tup12 (SW96), and the treatment was as described in A. (D) Quantification of the mRNA levels in C.

In vitro experiments have demonstrated that recombinant Prr1 binds to a heat shock-like element in the ste11⁺ promoter (Ohmiya et al., 1999b). Analysis of the cta3⁺ promoter revealed the presence of such an element (GGAAAATTC) located at 2068 relative to the initiation codon. However, in assays using this region of the promoter and whole cell extracts we were unable to detect a Prr1-dependent binding activity (our unpublished data). Therefore, we cannot exclude the possibility that the role of Prr1 in regulation of cta3⁺ expression is indirect.

Tup11 and Tup12 Prevent Induction in Response to Inappropriate Stresses

Sty1, and thus in turn Atf1-Pcr1, is activated in response to a number of environmental insults. Accordingly, the expression of Atf1- and Pcr1-dependent genes such as ctt1⁺, pyp2⁺, and gpx1⁺ are induced in response to a variety of stresses such as UV irradiation, heat shock, and hyperosmolarity and an oxidative stress elicited by exposure to high concentrations of H₂O₂ (Shiozaki and Russell, 1996; Wilkinson et al., 1996; Degols and Russell, 1997; Nguyen et al., 2000; Quinn et al., 2002). However, some Atf1-Pcr1 target genes are induced only by a subset of these stresses. For example, we found that cta3⁺ expression was induced specifically in response to salt shock but not by oxidative stress (6 mM H₂O₂) or by heat shock (15 min at 42°C) (Figure 9, A and D). In contrast, ctt1⁺ and gpx1⁺ mRNA levels were both induced by these treatments, indicating that Atf1 (and Pcr1) were active under these conditions. This indicates that activation of the Sty1 pathway per se is not sufficient to induce the expression of cta3⁺ and mechanisms must exist to prevent induction of gene expression in response to such "inappropriate stresses." We wanted to examine the possibility that Tup11 and Tup12 play a role in this process. Therefore, we measured the levels of cta3⁺ mRNA after exposing a tup11 tup12 strain to an oxidative stress (6 mM H₂O₂) and a heat shock (15 min at 42°C). In contrast to the wild-type strain, the expression of cta3⁺ was significantly induced by heat stress and by exposure to high levels of H₂O₂. In addition, the level of cta3⁺ transcripts was induced by hypotonic conditions in a tup11 tup12 strain but not in a wild-type strain (our unpublished data). We also examined cta3⁺ transcript levels in a sty1 tup11 tup12 triple mutant strain (Figure 9, B and D). This revealed that the induction in expression in response to heat shock was partly independent of the MAP kinase. In contrast, the induction of cta3⁺ expression in response to oxidative stress mediated by H₂O₂ was completely dependent upon Sty1, suggesting a difference in the mechanism of induction. Further analysis indicated that the response to heat shock was independent of Prr1 (Figure 9, C and D) but dependent upon Atf1 (our unpublished data). Taken together, these findings indicate that the Tup repressors function as part of the mechanism that ensures the specificity of stress-mediated transcriptional induction at the cta3⁺ promoter.

View larger version (42K): [in this window] [in a new window]   Figure 9.   Tup11 and Tup12 prevent induction in response to inappropriate stresses. (A) Strains used were wild type (w.t.) (NT4) and tup11 tup12 (SW76). Mid log cultures growing at 30°C in YE5S (lanes 1 and 4) were incubated with H2O2 (final concentration 6 mM) for 15 min (lanes 2 and 5) or shifted to 42°C for 15 min (lanes 3 and 6). Total RNA was prepared and subjected to Northern analysis with the indicated probes. The level of cdc2+ mRNA was used as a loading control. (B) Strain used was sty1 tup11 tup12 (SW91) and the treatments were as described in A. (C) Strain used was prr1 tup11 tup12 (SW91) and the treatments were as described in A. (D) Quantification of the cta3+ mRNA levels in A, B, and C. The strains are indicated above the graphs and the treatments are indicated below.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

In this study, we reveal roles for S. pombe Tup11 and Tup12 in the cellular response to elevated K⁺ and Ca²⁺ levels. We identify cta3⁺ as a novel stress-induced gene whose transcription is coregulated by the Sty1 MAP kinase pathway and the Tup repressors. Our results indicate that the Tup repressors fulfill a number of functions in the control of cta3⁺ expression. First, they maintain low levels of basal expression and limit the level of induction. Second, they ensure that induction of expression is linked to the Sty1 pathway. And third, they maintain the specificity of induction. We also reveal a new role for the response regulator Prr1 and demonstrate that it functions to regulate gene expression in response to elevated salt concentrations. Prr1 is known to contribute to the regulation of several genes whose expression is induced by oxidative stress via the Pap1 transcription factor (Ohmiya et al., 1999a), and so Prr1 regulates gene expression in response to a number of stresses.

Tup11-Tup12 Interaction

Our data and that of others (Mukai et al., 1999; Janoo et al., 2001) suggest that Tup11 and Tup12 can function in homomeric complexes. In addition, we demonstrate that Tup11 and Tup12 have the potential to form a heteromeric complex. This is significant because full function requires both repressors; some derepression of a fbp1::lacZ reporter is observed upon deletion of a single tup gene (Janoo et al., 2001). Furthermore, single tup mutants have demonstrable phenotypes such as increased resistance to cadmium. Thus, regulation of some genes may depend upon both repressors and the formation of heteromeric Tup complexes.

Relief of Tup11-Tup12-mediated Repression

The Hog1 MAP kinase in S. cerevisiae plays a direct role in relieving Ssn6-Tup1-mediated repression at osmostress genes; Hog1 phosphorylates Sko1, reducing its affinity for the corepressor complex (Proft et al., 2001). It is possible that the Sty1 MAP kinase may similarly antagonize the action of Tup11-Tup12; however, our results demonstrate that the Atf1, Pcr1, and Prr1 transcription factors are required for relief from Tup-mediated repression at the cta3⁺ promoter. It is probable that the S. pombe Tup proteins function, at least in part, through the organization of repressive chromatin structures (Mukai et al., 1999), and therefore it is possible that Atf1-Pcr1 and Prr1 overcome this repression by recruiting positive-acting chromatin remodeling complexes such as Swi-Snf or histone acetylase complexes (HATs). In support of this, DNA binding by the Atf1-Pcr1 heterodimer is known to alter local nucleosome positioning at the ade6-M26 hotspot and thereby promote meiotic recombination (Mizuno et al., 1997; Kon et al., 1998). Moreover, genes such as SUC2 in S. cerevisiae are regulated by the interplay between Ssn6-Tup1 repression and Swi-Snf-mediated activation (Gavin and Simpson, 1997).

In S. cerevisiae, Hog1-dependent transcriptional induction of HAL1 requires the Gcn4 activator that relieves Tup1-Ssn6-mediated repression by competing with Sko1 for the occupancy of a single CRE binding site (Pascual-Ahuir et al., 2001). This CRE element functions as a dual control element and integrates both positive and negative regulatory signals. Furthermore, analysis of the S. pombe fbp1⁺ promoter, which is regulated by both Atf1-Pcr1 and Tup11-Tup12, has demonstrated the presence of a control element (called UAS2) that contains a CRE-like sequence and is bound by multiple activators and repressors (Neely and Hoffman, 2000). Interestingly, the Atf1-Pcr1 transcription factor does not bind to UAS2 directly, but it does influence the protein complexes that assemble on it (Neely and Hoffman 2000). The cta3⁺ promoter contains a number of CRE-like elements at least one of which mediates Atf1 binding (Figure 3C). It will be interesting to determine the contributions of these elements to activation and repression of cta3⁺ transcription.

Tup Repressors Maintain Specificity of Induction

The advent of stressful conditions results in the rapid and Sty1-dependent phosphorylation of Atf1 (Shiozaki and Russell, 1996; Wilkinson et al., 1996). Although the precise role of Atf1 phosphorylation remains obscure, it is evident that transcriptional activation by Atf1 is dependent upon Sty1. However, deletion of the tup genes allows transcriptional induction of cta3⁺ to occur in sty1 cells. Furthermore, in a tup11 tup12 mutant induction of cta3⁺ expression does not require Pcr1 or Prr1. Thus, the Tup repressors function to "wire" induction to the Sty1 pathway, insulating it from interfering signals. These results also suggest that Atf1 activity can be "uncoupled" from Sty1 in this specific case and that an additional mechanism for activating transcription that requires Atf1 exists. The finding that Prr1 also controls expression of cta3⁺ suggests that it may function as part of this mechanism.

The Sty1 pathway in S. pombe is fundamentally different to the Hog1 pathway in S. cerevisiae because it is triggered by exposure to a wide range of adverse environmental conditions. As a consequence, a large number of Sty1 target genes are up-regulated by multiple stresses. The products of such genes may comprise a set of "general stress response proteins" that are necessary because a single environmental insult may result in multiple classes of intracellular stress (Rep et al., 2001). Nonetheless, discrete stimuli also produce distinct transcriptional outputs, because there are subsets of Sty1-dependent genes, such as cta3⁺, that are induced only by specific stresses. A major question to be addressed is the mechanism by which Sty1 signaling is integrated into the regulation of such genes. Expression of cta3⁺ is not induced by oxidative stress, heat shock, carbon limitation, or sexual differentiation (Figure 6; our unpublished data), and furthermore cta3⁺ is only poorly induced by an osmotic shock mediated by high sorbitol concentrations (Nishikawa et al., 1999). Thus, the transcriptional response is triggered essentially by elevated intracellular cation concentrations rather than by an osmotic effect (i.e., decrease in turgor pressure across the plasma membrane). The cta3⁺ gene encodes a putative intracellular P-type ATPase transporter that is involved in cation extrusion or sequestration into intracellular compartments. Loss of function leads to an accumulation of cytoplasmic Ca²⁺ levels (Ghislain et al., 1990; Halachmi et al., 1992), although recent evidence suggests that Cta3 is primarily a K⁺ ion pump (Benito et al., 2002). It is thus consistent that it is salt stress that specifically that triggers its transcriptional induction. However, removal of the constraints imposed by Tup repressors allows cta3⁺ to be induced in response to other stresses such as elevated temperature and oxidative stress. Thus, the Tup repressors function as a part of a mechanism that adds specificity to Sty1-dependent transcriptional induction.

Our results also indicate that activation of the Sty1 pathway alone is insufficient to induce cta3⁺ expression and implies that an elevated cation concentration triggers an additional pathway that is required to circumvent repression (Figure 10). In this respect it may be significant that Prr1 is involved in the regulation of cta3⁺ expression because its structure suggests that it may be one part the target of a histidine-aspartate phosphorelay pathway. Recent work has identified several of these pathways in fission yeast (Nguyen et al., 2000; Buck et al., 2001), and current experiments are addressing its contribution to the regulation of Prr1 in the response to stress.

View larger version (34K): [in this window] [in a new window]   Figure 10.   Model for the regulation of cta3+ expression. Under nonstress conditions, cta3+ expression is repressed by Tup11 and/or Tup12 that are tethered to the promoter through interaction with a site-specific DNA binding protein "X." Activation of the Sty1 pathway alone is insufficient to induce expression, and the Tup repressors prevent activation by Atf1-Pcr1 and Prr1. Elevated Ca2+ or K+ concentrations trigger the activity of other pathways (indicated by dashed lines) that interfere with Tup repression and/or facilitate activation via the response regulator Prr1 and Atf1-Pcr1. In cells lacking the Tup repressors, specificity is lost and expression is induced in response to a range of stresses.