![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 13, Issue 9, 3064-3077, September 2002
and
*Department of Biochemistry and Molecular Genetics, University of
Virginia Medical Center, Charlottesville, Virginia 22908; and
Department of Experimental Therapeutics, University of
Texas, MD Anderson Center, Houston, Texas 77908
| |
ABSTRACT |
|---|
|
|
|---|
Aurora B regulates chromosome segregation and cytokinesis and is the first protein to be implicated as a regulator of bipolar attachment of spindle microtubules to kinetochores. Evidence from several systems suggests that Aurora B is physically associated with inner centromere protein (INCENP) in mitosis and has genetic interactions with Survivin. It is unclear whether the Aurora B and INCENP interaction is cell cycle regulated and if Survivin physically interacts in this complex. In this study, we cloned the Xenopus Survivin gene, examined its association with Aurora B and INCENP, and determined the effect of its binding on Aurora B kinase activity. We demonstrate that in the Xenopus early embryo, all of the detectable Survivin is in a complex with both Aurora B and INCENP throughout the cell cycle. Survivin and Aurora B bind different domains on INCENP. Aurora B activity is stimulated >10-fold in mitotic extracts; this activation is phosphatase sensitive, and the binding of Survivin is required for full Aurora B activity. We also find the hydrodynamic properties of the Aurora B/Survivin/INCENP complex are cell cycle regulated. Our data indicate that Aurora B kinase activity is regulated by both Survivin binding and cell cycle-dependent phosphorylation.
| |
INTRODUCTION |
|---|
|
|
|---|
Defects in chromosome segregation can generate
aneuploidy, a condition that is found in almost all human tumors and is
a major cause of miscarriages and birth defects. The complex process of chromosome segregation must be highly regulated to ensure fidelity and
to prevent aneuploidy. Many of the mitotic events are regulated by the
kinetochore, a proteinaceous structure assembled on
centromeric DNA that coordinates at least three mitotic functions (for
review, see Rieder and Salmon, 1998
). First, the
kinetochore is the chromosomal site of microtubule
attachment and movement. Second, the kinetochore is the
major site of cohesion between sister chromatids. This cohesion must be
maintained through metaphase and its dissolution is the critical event
that triggers anaphase. Third, kinetochores that are not
attached to microtubules send signals to the cell cycle machinery to
prevent this dissolution of cohesion, a process referred to as the
spindle assembly checkpoint. This checkpoint ensures that all
chromatids are attached before the onset of anaphase. How the
kinetochore coordinates these various functions is a
critical unanswered question.
A group of mitotic regulators that includes Aurora B kinase and the
inner centromere protein (INCENP) has been given the name chromosomal
passengers (Adams et al., 2001a
). The passenger proteins are
defined by a dynamic pattern of localization (Mackay and Earnshaw, 1993
). In G2 and prophase, the passenger proteins have a general chromosomal localization. During prometaphase and metaphase, they move
from chromosomes to inner centromeres. When chromosomes move to the
poles during anaphase, passenger proteins remain at the spindle midzone
where they eventually become part of the midbody (Cooke et
al., 1987
; Bischoff et al., 1998
; Schumacher et
al., 1998b
; Adams et al., 2001a
).
The phenotypes of the chromosomal passenger proteins suggest that they
are critical regulators of various steps of chromosome segregation.
RNAi experiments in Caenorhabditis elegans embryos and
Drosophila cell lines suggest that cells lacking Aurora or INCENP have similar mitotic defects. First, the passenger proteins are
necessary for the proper segregation of DNA. During anaphase, the
chromosome masses do not properly segregate, leaving a chromatin bridge
between the major DNA masses (Schumacher et al., 1998a
; Adams et al., 2000
, 2001b
; Kaitna et al., 2000
;
Giet and Glover, 2001
). Second, cytokinetic furrows begin but fail to
fully progress in cells lacking either Aurora or INCENP (Mackay
et al., 1998
; Schumacher et al., 1998b
; Kaitna
et al., 2000
; Adams et al., 2001b
; Oegema
et al., 2001
). This suggests a second role for Aurora and INCENP in cytokinesis. Third, studies from budding yeast suggest that
Aurora is involved in bipolar attachment of microtubules to
kinetochores. The Aurora homolog Ipl1 is required during
chromosome segregation, as cells without Ipl1 activity have massive
nondisjunction and often segregate both sisters' chromosomes to the
same pole. Ipl1 is required for kinetochores to release
spindle microtubules both in vitro and in vivo (Biggins et
al., 1999
; Biggins and Murray, 2001
; Tanaka et al.,
2002
). Current models propose that Ipl1 ensures that each chromosome
obtains bipolar attachment of microtubules by coordinating the release
of kinetochores attached from a single pole, thereby
allowing kinetochores to rebind microtubules until proper
bipolar attachment is achieved. This model predicts that Aurora B
kinase activity is inactivated by bipolar attachment, but we presently
know little about how Aurora B activity is regulated.
Some overlapping phenotypes are seen in embryos lacking the
Survivin/Bir1 protein (Survivin). Survivin is required in both budding
and fission yeast for proper chromosome segregation (Yoon and Carbon,
1999
; Li et al., 2000
; Morishita et al., 2001
).
RNAi experiments in C. elegans have shown that embryos
lacking Survivin display abnormal chromosome condensation, disrupted
mitotic spindles, and were ultimately unable to complete cytokinesis,
resulting in multinucleate embryos (Fraser, 1999
; Speliotes et
al., 2000
). Survivin-null mouse embryos displayed polyploidy,
abnormal mitotic spindles, and failed cytokinesis (Uren et
al., 2000
). The similarities in phenotypes suggest that Aurora,
INCENP, and Survivin could function together.
INCENP and Survivin have both been shown to genetically interact with
Aurora B kinases. Chan and colleagues (Kim et al., 1999
) first identified mutants of the budding yeast INCENP homolog (Sli15) that are synthetically lethal with temperature-sensitive mutants of the
Aurora homolog Ipl1. Moreover, they showed that sli15 cells had phenotypes identical to those of ipl1 yeast. As
discussed earlier, similar phenotypes are also seen in fission yeast,
C. elegans, and Drosophila cells lacking either
Survivin, Aurora, or INCENP (for review, see Adams et al.,
2001a
). Aurora B kinase is not localized to the
kinetochores in fission yeast or C. elegans embryos lacking Survivin (Speliotes et al., 2000
; Morishita
et al., 2001
). Similarly, in C. elegans embryos
and Drosophila cells, loss of INCENP by RNAi also leads to
the mislocalization of Aurora B kinase (Adams et al., 2001c
;
Giet and Glover, 2001
; Oegema et al., 2001
).
Biochemical evidence has shown that Aurora B physically interacts with
INCENP. Sli15p and Ipl1p form a complex in budding yeast (Kim et
al., 1999
), and a complex containing both INCENP and Aurora B
kinase has been purified from Xenopus laevis
mitotic extracts (Adams et al., 2000
). There is no
conclusive biochemical evidence that Aurora kinases or INCENP are
physically associated with Survivin, although a recent report has shown
that human Survivin can interact with either Xenopus INCENP
(xINCENP) or Aurora B kinase in both two-hybrid and in vitro pull-down
assays (Wheatley et al., 2001a
). Therefore, some essential
questions are whether Aurora, INCENP, and Survivin physically interact
in vivo, whether complex formation is cell cycle regulated,
and how each subunit interacts in the complex. Moreover, it is critical
to identify the molecular function(s) of each protein in the complex.
To understand the interrelationship of the passenger proteins and to further understand how Aurora B kinase is regulated, we have cloned the Xenopus Survivin (xSurvivin) gene. xSurvivin is shown to exist in a complex with both xINCENP and Xenopus Aurora B kinase (xAurora B) in S-phase (interphase) and mitotic Xenopus extracts. Moreover, immunodepletion of xAurora B kinase can completely remove xSurvivin and xINCENP from Xenopus extracts, suggesting that all of the xSurvivin and xINCENP is physically associated with xAurora B kinase. We show that the N terminus of xAurora B kinase interacts with the conserved C terminus of xINCENP, whereas xSurvivin interacts with the N terminus of xINCENP. Furthermore, xAurora B activity is stimulated at least 10-fold in mitotic extracts, and this stimulation is shown to be phosphatase sensitive. Adding recombinant xSurvivin protein to xAurora B immunoprecipitations (IPs) stimulates the mitotic kinase activity an additional 10-fold, suggesting that xSurvivin binding to Aurora B plays a regulatory role similar to cyclin binding of CDKs. Therefore, our data suggests that xAurora B kinase is regulated by both complex formation and phosphorylation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials
All chemicals were purchased from Sigma (St. Louis, MO) unless stated otherwise. All DNA restriction enzymes were purchased from New England Biolabs (Beverly, MA). Adult wild-type Xenopus laevis were purchased from Nasco (Fort Atkinson, WI).
Xenopus Interphase and Mitotic Extracts
Interphase extracts were prepared as previously described
(Stukenberg et al., 1997
). Interphase extracts were
driven into mitosis by the addition of 66 nM nondegradable glutathione
S-transferase (GST)-cyclin B for 20 min at room temperature.
Fusion Constructs and Protein Purification
Based on the sequence of xAurora B (Adams et al.,
2001b
), primers 1292098 (5'-GCGGATCCATGGAGTACAAAGAGAATCTCAACCC)
and 1292100 (5'-CGGCGGCCGCTTTTGATTGGGTGGACTGGTAGAC) were used to
amplify xAurora B from a Xenopus stage 11.5-14 cDNA
library. This polymerase chain reaction (PCR) fragment was subcloned
into the NcoI-NotI sites of pET 28 (Novagen,
Madison, WI) to create pET 28-xAurB that expresses C-terminal
6His-tagged xAurora B. xAurora B was also amplified using primers
1292098 and 1292099 (5'-GGCTCGAGAAGCTTCATTTTGATTGGGTGGACTGG). The
resulting PCR fragment was subcloned into the
NcoI-HindIII sites of pET 41 (Novagen) to yield
pET 41-xAurB that expresses N-terminal GST-tagged xAurora B. The gene
was sequenced by the University of Virginia Biomolecular Research
Facility (Charlottesville, VA), and its sequence was deposited into
GenBank (accession no. AY115554). Our isolated gene has only two amino
acid changes from the published gene. As both of these changes are also
found on each of the GenBank deposited expressed sequence tags (ESTs), they are unlikely to be mutations caused by the PCR isolation. Primers
1292099 and 1984819 (5'-GCCCATGGAATTCCCATTGGGGAAGGGG) were used to
amplify the xAurora B kinase domain. The resulting PCR fragment was
subcloned into the NcoI-HindIII sites of pFastBac and was subsequently subcloned into the
NcoI-HindIII sites of pET 41B to create pET
41-xAurB (99-384) that expresses N-terminal GST-tagged xAurora B
kinase domain.
To clone xSurvivin, a BLAST search of the EST database was conducted to find a Xenopus EST with high homology to human and mouse Survivin. xSurvivin was then amplified from a Xenopus stage 11.5-14 cDNA library using primers 1242204 (5'-CTGGCCGGCCCCATATGTATTCTGCCAAGAACAGG) and 1242206 (5'-CGCTCGGGTGGTCGAGATCTATGGAGCACTG). This PCR fragment was subcloned into the NdeI-XhoI sites of pET 41 (Novagen) to yield pET 41-xSurvivin that expresses C-terminal 6His-tagged xSurvivin. xSurvivin was also amplified using primers 1242204 and 1242205 (5'-CCGGCGCGCCTCAGTGGTCAAGATCTATGGAGCAA). The resulting PCR fragment was subcloned into the NdeI-Asc1 sites of pGEXcsFA (a generous gift from Ethan Lee, Harvard Medical School, Boston, MA) to yield pGEXcsFA-xSurvivin that expresses N-terminal GST-tagged xSurvivin. xSurvivin sequence was deposited into GenBank (accession no. AY115553). The modeled crystal structure coordinates were generated by SWISS-MODEL (http://www.expasy.org/swissmod/SWISS-MODEL.html). The figures were constructed with RasMol.
A XhoI site was engineered into the N terminus of our
pCS2+xINCENP (Stukenberg et al., 1997
)
clone using PCR with the oligonucleotides (5'-CCGCGCTCGAGAACGATGCAGA-GTGCCGTGCCC) and
(5'CCGGCGGGGCCCTCTAGAGGATCCTCGTATTTGAGGCCATAACC). The resulting product
was cloned into the XhoI-Xba sites of Super GFP-Wee1 (Heald
et al., 1993
) to form a GFP-xINCENP fusion protein. A
HindIII to ApaI fragment containing GFP and the N
terminus of xINCENP was cloned back into
pCS2+xINCENP, and the remaining PCR product was
confirmed by sequence to generate
pCS2+GFP-xINCENP. The XhoI to
XbaI fragment was cloned into pET 28B in the XhoI
and Bpu1103 sites, and finally a NheI to PstI
fragment of pET 28B-xINCENP was removed to generate pET 28-xINCENP
(677-874) that expresses N-terminal 6His-tagged xINCENP (677-874).
All proteins were expressed in the Escherichia coli strain
BL21 (DE3 pLysS; Novagen). 6His-tagged proteins were purified on Ni2+-NTA agarose (Qiagen, Valencia, CA) as
instructed by the manufacturer. GST-tagged proteins were purified on
glutathione agarose (Smith and Johnson, 1988
).
Antibody Production, IP, and Immunoblotting
All polyclonal antibodies were made by Covance Research Products
(Denver, PA). To make anti-xAurora B antibodies, rabbits 315 and
316 were immunized with purified C-terminal 6His-tagged xAurora B. To
make anti-xSurvivin antibodies, rabbits 342 and 343 were immunized with
purified C-terminal 6His-tagged xSurvivin. Anti-xINCENP antibodies were
produced in rabbits 354 and 355 immunized with N-terminal 6His-tagged
xINCENP (677-874) encoding the C-terminal fragment of xINCENP. All
antibodies were affinity purified on the corresponding immunizing
protein coupled to a cyanogen bromide-activated Sepharose column
(Amersham Biosciences, Piscataway, NJ) as described (Harlow and Lane,
1988
). After affinity purification, the antibodies were dialyzed into
XB no Ca2+ (10 mM HEPES, pH 7.7, 1 mM
MgCl2, 100 mM KCl, and 50 mM sucrose), aliquoted,
and stored at
80°C. Immunoblotting was performed on Immobilon-P (Millipore, Bedford, MA) and was detected using horseradish peroxidase-conjugated-anti-rabbit secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) by chemiluminescence (ECL;
Amersham Biosciences).
To immunoprecipitate complexes from Xenopus extracts, 20 µg of preimmune sera (Pre-I) 1 µg of affinity-purified anti-xAurora B, anti-xSurvivin, or anti-xINCENP antibodies were bound to 50 µl of protein A Sepharose beads (Amersham Biosciences) in phosphate-buffered saline (PBS) for 1 h at room temperature. The beads were washed five times in XB no Ca2+, and one-half was added to 40 µl of interphase extract and the other one-half was added to 40 µl of interphase extract driven into mitosis by the addition of GST-cyclin B. Beads were incubated with extracts for 1 h at 4°C and were subsequently washed five times in XB no Ca2+ containing an additional 200 mM NaCl and 0.1% Brij 35.
The concentration of xAurora B, xSurvivin, and xINCENP in Xenopus extracts was determined by quantitatively comparing interphase extracts with recombinant GST-xSurvivin, GST-xAurora B, and 6His-xINCENP (677-874) levels on immunoblots. For quantification, the amount of INCENP in Xenopus extracts was compared with titrations of 6His-xINCENP (677-874) transferred to Immobilon by slot blots rather than by SDS-PAGE followed by transfer. To quantify immunoblots, films were scanned with densitometer hardware (Molecular Dynamics, Sunnyvale, CA) into ImageQuant 5.0. Data were then exported into Microsoft Excel and graphed for analysis.
Cell Culture and Immunofluorescence
XTC cells were obtained from Dr. Douglas DeSimone (University of Virginia, Charlottesville, VA) and were grown at room temperature in 70% L-15 media supplemented with 10% fetal bovine serum and 1 mM sodium pyruvate. XTC cells were grown on coverslips and fixed with 4% paraformaldehyde in PHEM buffer (60 mM PIPES, pH 6.9, 25 mM HEPES, 10 mM EGTA, and 4 mM MgCl2) containing 0.75% Triton-X-100. Coverslips were subsequently washed in PBS containing 0.1% Tween 20 (PBS-T). Fixed cells were blocked in 20% heat-inactivated goat serum (Invitrogen, Carlsbad, CA) and were then incubated for 1 h at room temperature with monoclonal anti-tubulin antibody at 1:500 and either affinity-purified anti-xAurora B (1 µg/ml) or anti-xINCENP (1 µg/ml) antibodies diluted in PBS-T. Coverslips were then washed three times with PBS-T and then incubated with fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin G at 1:1000 and Cy3-conjugated anti-rabbit immunoglobulin G (Jackson ImmunoResearch Laboratories) at 1:1000, washed three times in PBS-T, stained with 1 µg/ml Hoechst No. 33342 for 30 s, and mounted with Vectashield (Vector Laboratories, Burlingame, CA).
Images were collected at ×100 using an E600 Eclipse microscope (Nikon, Tokyo, Japan) equipped with a CH350 cooled charged-coupled device camera (Photometrics, Tucson, AZ). Images were acquired and analyzed using version 4.5 Meta View software.
Gel Filtration Chromatography and Sucrose Gradient Sedimentation
For gel filtration analysis, 100 µl of interphase extract was
diluted 1:5 in XB no Ca2+. In parallel,
microcystin (5 µM) was added to 100 µl of mitotic extracts and the
mitotic extract was diluted 1:5 in 80 mM
-glycerophosphate, 20 mM
EGTA, 10 mM MgCl2, and 5 mM NaF. Clarified
interphase and mitotic extracts were prepared by ultracentrifugation at
40,000 rpm for 1 h at 4°C in an S120-AT2 rotor (Sorvall, Kendro
Laboratory Products, Newtown, CT). The extracts were then
concentrated in a Microcon (Millipore) and were subsequently loaded
onto a Superose 6 column (Amersham Biosciences). Thirty-two fractions
of 500 µl were collected and trichloroacetic acid precipitated as
described (Bensadoun and Weinstein, 1976
). Alternating fractions were
loaded onto 8 and 15% SDS-PAGE gels and immunoblotted for
xINCENP, xAurora B, and xSurvivin.
Similarly clarified extracts were loaded onto 5-30% sucrose gradients and centrifuged at 30,000 rpm for 30 h at 4°C in a SW-40 rotor. Sixteen fractions were collected, trichloroacetic acid precipitated, and equal volumes of sample were separated on 8 and 15% gels for immunoblot analysis. Molecular weight markers were run in a parallel gradient.
Mapping of Passenger Protein-Binding Domains
To identify binding domains among the passenger proteins, the indicated truncated or wild-type proteins were translated in vitro in the presence of [35S]methionine using the TNT Coupled Reticulocyte Lysate System (Promega, Madison, WI). These proteins were allowed to integrate into endogenous complexes by mixing 10 µl of the in vitro translation reaction with 20 µl of Xenopus extract for 30 min, and then the endogenous protein was immunoprecipitated. Labeled proteins were detected by phosphorimager analysis of dried SDS-PAGE gels. Proteins were scored as interacting if the amount of labeled protein immunoprecipitated was fivefold higher than the amount precipitated by Pre-I; typically >80% of a labeled protein was precipitated in these experiments. The deletion set of xINCENP was a generous gift of Susannah Rankin and Marc Kirschner (Harvard Medical School).
Kinase Assays
For each kinase assay, xAurora B kinase was immunoprecipitated
from 50 µl of Xenopus extract on ~10 µl of protein A
Sepharose beads (Amersham Biosciences). The beads were washed four
times in XB no Ca2+ containing an additional 300 mM NaCl and 0.1% Triton-X-100, followed by an additional wash in
kinase buffer (20 mM Tris, pH 7.5, 1 mM MgCl2, 25 mM KCl, 1 mM dithiothreitol, and 40 µg/ml bovine serum albumin).
Beads were aliquoted into tubes containing the indicated recombinant
protein in 25 µl of kinase buffer supplemented with 100 µM
[32P]ATP (2 µCi; Perkin Elmer-Cetus Life
Sciences, Norwalk, CT) and 1 µg of myelin basic protein (MBP;
Invitrogen). Reactions were incubated in a Mixer 5432 (Eppendorf;
Brinkmann Instruments, Westbury, NY) at room temperature, and after 10 min, the reactions were stopped by the addition of sample buffer.
One-half of the reaction was loaded onto a gel that was Coomassie
stained, dried on 3MM paper (Whatman, Clifton, NJ), and analyzed for
32PO4 incorporation with
phosphorimager hardware (Molecular Dynamics) and ImageQuant 5.0 software. The other one-half of the reaction was loaded onto a second
gel and the amount of xAurora kinase was quantified by
immunoblot. In kinase reactions involving lambda phosphatase, beads were washed into lambda phosphatase buffer, treated
at room temperature for 30 min with either 200 U of lambda phosphatase
or buffer, subsequently washed four times in kinase buffer, and assayed
for kinase activity.
| |
RESULTS |
|---|
|
|
|---|
Cloning the Xenopus Survivin Gene
To biochemically dissect the regulation of passenger proteins, we
used embryonic extracts of the frog Xenopus laevis. These extracts are excellent tools for studying mitotic regulators for three
reasons. First, cell cycle regulators are stockpiled in Xenopus eggs and are more abundant than in somatic cells.
Second, the cell cycle state of these extracts can be easily controlled and, third, the extracts can recapitulate mitotic events in vitro. We
have previously cloned the xINCENP gene and demonstrated that the
protein is specifically phosphorylated in mitosis (Stukenberg et
al., 1997
). A gene encoding the xAurora B protein was recently identified (Adams et al., 2000
), and a highly related gene
was isolated from a Xenopus stage 11.5-14 plasmid cDNA
library by PCR. The xSurvivin cDNA was cloned by identifying a
Xenopus EST with high homology to human and mouse Survivin.
The Survivin cDNA was then isolated from a Xenopus stage
11.5-14 cDNA library by PCR.
The Xenopus Survivin cDNA encodes a protein that is 46%
identical to human Survivin (Figure 1A).
The predominant motif on the Survivin protein is an inhibitor of
apoptosis domain, a motif that has been shown in a related baculoviral
protein to inhibit Caspase-3 activity (for review, see Reed and
Bischoff, 2000
; Verhagen et al., 2001
), although the
Survivin family does not inhibit Caspase-3 (Yoon and Carbon, 1999
; Li
et al., 2000
; Uren et al., 2000
). The xSurvivin
protein has the recognizable motifs of Survivin including the inhibitor
of apoptosis repeat and a Cdc2 kinase phosphorylation site. Two
independent groups have recently published the crystal structure of
human Survivin (Chantalat et al., 2000
; Verdecia et
al., 2000
). The Xenopus sequence was modeled into these
crystal structures by the program SWISS-MODEL. The program predicts
that the backbone structures of the Xenopus and the human
proteins are highly similar (Figure 1, B and C). A prominent motif that is not included on the model is a C-terminal extended
helix (Figure
1, B and C). This is not included because this region is divergent in
the primary sequence (Figure 1A); however, a SOPM secondary structure
of this region predicted a long C-terminal
helix. Therefore, there
is structural similarity between the Survivin homologs throughout the
protein. Noel and colleagues (Verdecia et al., 2000
)
identified two potential interaction regions (an acidic patch and a
basic patch) on the surface of human Survivin. To determine if these
regions are conserved in xSurvivin, we compared the charged amino acid
residues of the xSurvivin model (Figure 1D) with the placement of
charged residues in the solved crystal structure of human Survivin
(Figure 1E). The placement of surface charge on xSurvivin is predicted
to be almost identical to human Survivin.
|
Characterization of Antibodies
After affinity purification, anti-xAurora B and anti-xINCENP
antibodies are specific as they predominantly recognize a band of 41 and 130 kDa, respectively, in a Xenopus interphase extract and a Xenopus tissue culture cell line (XTC) lysate (Figure
2, B-C). Anti-xSurvivin antibody
recognizes a predominant band at 18 kDa (Figure 2A). Even after
affinity purification, the anti-xSurvivin antibody recognizes six
additional bands; therefore, it was not used for immunofluorescence.
The antibodies are highly sensitive as they all recognize <1 ng of
recombinant protein (unpublished data, M. Bolton, P.T.
Stukenberg). By comparing immunoblot signals of
Xenopus interphase extracts with known amounts of
recombinant protein, we estimate that the concentration of xAurora B
protein in these extracts is 500 nM, the concentration of xSurvivin is ~250 nM, and the concentration of xINCENP is 100 nM (unpublished data, M. Bolton, P.T. Stukenberg).
|
XTC cells stained with the anti-xAurora B antibody (Figure 2, D-O) and anti-xINCENP antibody (Figure 2, P-AA) display typical passenger protein immunolocalization. The concentration of both proteins is low in interphase (Figure 2, D, J, P, and V), but by prophase, the antibodies recognize both chromatin and kinetochores (Figure 2, E, K, Q, and W). Both proteins move to kinetochores at prometaphase-metaphase (Figure 2, F-G, L-M, R-S, and X-Y), and finally to bundles of overlapping microtubules in anaphase (Figure 2, H, N, T, and Z) where they remain throughout cytokinesis until they are discarded with the midbody (Figure 2, I, O, U, and AA). These data suggest that the roles of passenger proteins are conserved in Xenopus and demonstrate that the anti-xAurora B and anti-xINCENP antibodies are highly specific.
xAurora B, xINCENP, and xSurvivin Are Physically Associated In Vivo
To determine the native molecular weight of the passenger
proteins, Xenopus interphase and mitotic extracts were size
separated by both Superose 6 gel filtration chromatography and 5-30%
sucrose gradients, and the location of each of the proteins was
detected by immunoblot. In interphase egg extracts, xAurora
B, xINCENP, and xSurvivin comigrate in a broad peak from 900 to 600 kDa, whereas all three proteins migrate in a sharp peak at 900 kDa in
mitotic extracts (Figure 3A). A slower
migrating form of xSurvivin is often seen in SDS-PAGE gels. Detection
of this form depends on phosphatase inhibitors and its appearance is
not cell cycle dependent (unpublished data, M. Bolton, W. Lan, and P.T.
Stuken-berg). xAurora B, xINCENP, and xSurvivin also
comigrate in a sucrose gradient, sedimenting at 9.5S in interphase and
at 4.5S in mitosis (Figure 3B). A number of control proteins, including
Eg2, the Xenopus Aurora A homolog, migrated similarly in
interphase and mitosis, demonstrating that the differences in migration
of the passenger protein complex were caused by cell cycle changes and
not due to differences in the manipulations of the sucrose gradients
(Figure 3B). Because of the contributions of shape, neither gel
filtration nor sedimentation can accurately predict native molecular
weight. Gel filtration measures the Stokes radius, which is determined by the overall length of the molecule, whereas sucrose gradients measure sedimentation, which is retarded by a long thin shape. Therefore, highly elongated molecules such as myosin migrate faster than spherical proteins of similar molecular weight in gel filtration, whereas they sediment more slowly than spheres in sucrose gradients (Siegel and Monty, 1966
). Siegel and Monty (1966)
have derived equations using the hydrodynamic characteristics of molecules to
overcome the contributions of shape and more accurately measure molecular weight. Such calculations suggest that the mitotic complex is
one-half the size (~250 kDa) of the interphase complex (~490 kDa).
Moreover, in both complexes, the overall length is comparable because
they migrate similarly by gel filtration. The predicted axial ratio is
>20, indicating a size and shape reminiscent of fibrinogen, but not as
elongated as myosin. INCENP has a long coiled-coil domain, which is a
motif that often contributes to such elongated shapes in proteins.
Thus, the passenger proteins complex has a highly elongated shape in
both interphase and mitosis, and the mass of the complex doubles in
interphase.
|
To directly test if the passenger proteins are in the same complex in
vivo, we immunoprecipitated each of the passenger proteins from
Xenopus extracts and immunoblotted the
precipitates to determine if other passenger proteins were bound. After
IP with xAurora B antibodies, both xINCENP and xSurvivin are also
precipitated (Figure 4A). Because
equivalent amounts of these three passenger proteins are detected in
both interphase and mitotic extracts, it does not appear that their
association is cell cycle regulated in the early embryo. Pre-I controls
do not precipitate any of the passenger proteins. Moreover, neither
xINCENP nor xSurvivin is immunoprecipitated by the xAurora B antibodies
if recombinant xAurora B protein is added to the extract before the IP,
demonstrating that the interaction is specific to xAurora B antibodies
(unpublished data, M. Bolton and P.T. Stukenberg). In xINCENP
IPs, both xSurvivin and xAurora B (Figure 4A) are detected by
immunoblot. Finally, in xSurvivin IPs, both xAurora B and
xINCENP are detected (Figure 4A). Therefore, in Xenopus
embryos during both interphase and mitosis, there is a physical
interaction between xSurvivin, xINCENP, and xAurora B kinase.
|
Because the three proteins comigrate on a gel filtration column and sucrose gradient (Figure 3), it is possible that the majority of each passenger protein exists in this complex. This hypothesis was directly tested by immunodepleting xAurora B complex from a Xenopus low-speed extracts and immunoblotting the depleted extracts for xINCENP and xSurvivin. When 95% of the xAurora B is removed from extracts, xINCENP and xSurvivin are depleted to similar levels (Figure 4B). This experiment demonstrates that in the Xenopus embryo, most, if not all, of xINCENP and xSurvivin is physically associated with xAurora B kinase.
Mapping the Chromosomal Passenger Complex Interactions
INCENP Is a Scaffold Protein with xSurvivin Binding Its N
Terminus and xAurora B Binding Its C Terminus. An assay was
developed to identify the domains on xINCENP that interact with xAurora
B and xSurvivin (Figure 5A).
35S-labeled full-length xINCENP protein was translated in
vitro and incubated in a Xenopus extract. This protein
incorporates into the endogenous complex because it can be
immunoprecipitated with our anti-xAurora B antibody (Figure 5B) and
anti-xSurvivin antibody (unpublished data, M. Bolton, W. Lan,
and P.T. Stukenberg). These interactions are specific, as they are not
detected after IP with Pre-I controls (Figure 5B). The interaction
between xAurora B and in vitro translated xINCENP is quite robust as
the xINCENP is quantitatively immunoprecipitated from the extract
(unpublished data, M. Bolton and P.T. Stukenberg), and, like the
endogenous complex, the interaction is detected in both interphase and
mitotic extracts (Figure 5, B and C). We determined whether xAurora B interacted with a series of deletion and truncated xINCENP proteins using this assay (Figure 5C). xAurora B interacts with all of the
constructs that contain the C terminus of xINCENP except for the
construct xINCENP
(119-242). We do not understand why the xINCENP
(119-242) construct does not interact with Aurora B, but it is
likely that either the C terminus is misfolded or a regulatory region
is missing. The simplest interpretation of the data is that there is an
xAurora B interaction domain in the C-terminal 200 amino acids of
xINCENP that is both necessary and sufficient for xAurora B binding.
This region contains the IN-box that was previously shown to be an
xAurora B binding domain in C. elegans and mouse (Kaitna
et al., 2000
). More recently, it was shown that yeast
Aurora (Ipl1p) binds directly to the C terminus of the INCENP homolog
Sli15 (Kang et al., 2001
).
|
Using this assay, we also mapped the xSurvivin interaction domain to
the N-terminal 119 amino acids of xINCENP (Figure 5C). The three
constructs that contained the first 119 amino acids of INCENP could be
immunoprecipitated by xSurvivin antibodies, whereas the two constructs
that lacked this region do not. Again, we see no cell cycle differences
in the xINCENP/xSurvivin interaction. The N terminus of chicken INCENP
has been implicated in centromere targeting as well as chromosome and
midzone binding (Mackay et al., 1993
; Mackay et
al., 1998
). We are currently testing if these biochemical
activities are mediated by xSurvivin.
xSurvivin Binding to the Complex Is NaCl Sensitive. The salt sensitivity of the interaction between the endogenous xSurvivin and xAurora B complex was examined. xAurora B IPs were washed with buffers containing 0.1% Triton-X 100 and varying NaCl concentrations and were subjected to quantitative Western blot (Figure 5D). The endogenous complex of xAurora B and xINCENP is stable in high salt. However, the interaction between xAurora B and xSurvivin is salt sensitive. There is twofold more xAurora B kinase in Xenopus extracts than xSurvivin, but after washing with only 100 mM NaCl, the ratio of the two proteins is 6:1. This ratio increases to 10:1 after a 300 mM NaCl wash, and no xSurvivin is detected after washing the complex with 1 M NaCl (Figure 5D). These data indicate that the interaction between xINCENP and xAurora B does not require xSurvivin because xAurora B and xINCENP remain tightly associated after removal of xSurvivin.
Reciprocal IPs were performed by in vitro translating xAurora B, incubating the translation mix with Xenopus interphase extracts to allow labeled xAurora B to incorporate into the endogenous complex, and immunoprecipitating with either anti-xSurvivin or anti-xINCENP antibodies. The resulting IPs were washed with buffers containing 0.1% Triton-X 100 and varying NaCl concentrations. The amount of xAurora B bound was quantified by phosphorimager and plotted (Figure 5E). As seen in Figure 5D, the xAurora-xINCENP interaction is highly stable; however, the xAurora-xSurvivin interaction is NaCl sensitive. These data confirm two conclusions made from Figure 5D: the Survivin interaction is salt sensitive, suggesting that it is not tightly associated with the complex; and the interaction between xINCENP and xAurora B does not require xSurvivin.
The N Terminus and Kinase Domain of xAurora B Both Interact with INCENP and the N Terminus May Weakly Bind xSurvivin. The first 98 amino acids of xAurora B define an N-terminal region of unknown function and the rest of the protein is mostly kinase domain. We demonstrate that the N terminus of xAurora B is required for the highly stable interaction with xINCENP (Figure 5E). A construct encoding the C-terminal amino acids 99-384 of xAurora B was radioactively translated in vitro and was mixed with interphase Xenopus extracts. Unlike full-length xAurora B, which efficiently immunoprecipitates with xINCENP, the xAurora B kinase domain construct is not quantitatively precipitated. Whereas 70% of the full-length xAurora B coimmunoprecipitates with xINCENP, only 30% of the xAurora kinase domain coimmunoprecipitates. After washes with increasing concentrations of NaCl, the amount of xAurora kinase domain bound to xINCENP falls from 30 to 5%. The weak, salt-sensitive interaction between xAurora B kinase domain and xINCENP suggests that the N terminus of xAurora B provides the majority of the binding to xINCENP, whereas the kinase domain only weakly interacts.
It has been reported that xAurora B kinase interacts with
both xINCENP and human Survivin in both two-hybrid and in vitro pull-down assays (Wheatley et al., 2001a
). Therefore, it is
surprising that we have identified xINCENP constructs that robustly
bind either xSurvivin or xAurora B, suggesting that xAurora and
xSurvivin do not interact directly but rather bind opposite ends of
xINCENP. If this were true, we would expect that anti-xSurvivin
antibodies would pull down xAurora B kinase domain through its
interaction with xINCENP (Figure 5E). However, we find that xSurvivin
antibodies were not able to precipitate any xAurora B kinase domain,
even though at low NaCl concentrations, there was some interaction between the kinase domain and xINCENP. The simplest interpretation of
this data is that there may be a weak direct interaction between the N
terminus of xAurora B and xSurvivin that stabilizes the complex.
xSurvivin Protein Can Stimulate Mitotic xAurora B Kinase Activity
Because xSurvivin could be washed off xAurora B kinase IPs, the
dependence of xAurora B kinase activity on complex formation was
examined. xAurora B kinase was immunoprecipitated from interphase and
mitotic extracts, washed with a buffer containing 300 mM NaCl so that
the ratio of xAurora B to xSurvivin was 10:1, and the kinase activity
was measured by the incorporation of
32PO4 from
[32P]ATP onto a MBP substrate (Figure
6A). Kinase activity is readily detected
when the IP is performed with Aurora B antibodies, but not if Pre-I is
used. In correlation with previous studies, we find that this activity
is cell cycle regulated, as at least 10-fold greater activity is
detected if the xAurora B is precipitated from mitotic extracts as
compared with interphase extracts (Bischoff et al., 1998
).
The kinase stimulation is due to an increase in specific activity of
the enzyme as similar amounts of protein are detected in the IP by
Coomassie stain of the gel (Figure 6, A and C) or xAurora B
immunoblot (Figure 6B).
|
We find that adding 10 ng of recombinant GST-Survivin stimulates the mitotic kinase activity ~eightfold, but has limited affect on xAurora B isolated from interphase extracts (Figure 6A). This stimulation of xAurora B kinase activity was titrated in Figure 6B and was saturated at 10 ng of recombinant GST-Survivin. As a negative control, we added 10 ng of GST-cyclin B, which did not stimulate kinase activity (unpublished data, S. Powers, P.T. Stukenberg). We estimate that there is ~20-30 ng of xAurora B in these IPs (Figure 5D), suggesting that xSurvivin is stoichiometrically required for xAurora B kinase activity.
xAurora B Kinase Activity Is also Regulated by Phosphorylation
The kinase activity of Aurora A is regulated by phosphorylation
(Walter et al., 2000
). To determine if Aurora B kinases are also regulated by phosphorylation, xAurora B IPs from interphase and
mitotic extracts were washed with low-salt buffer, which allows most of
the endogenous xSurvivin to remain bound. This reaction was split, and
one-half of the reaction was treated with lambda phosphatase,
subsequently washed to remove the phosphatase, and assayed for kinase
activity (Figure 6C). The mitotically stimulated xAurora B kinase
activity is sensitive to treatment with lambda phosphatase,
demonstrating that cell cycle-specific phosphorylation regulates the
specific activity of xAurora B (Figure 6C; Murnion et al.,
2001
).
The simplest interpretation of the phosphatase sensitivity of Aurora B kinase activity is that, as in many other kinases, the phosphorylation state directly regulates kinase activity. However, dephosphorylation may also disturb the xSurvivin interaction. To distinguish between these two possibilities, we phosphatase treated an IP of xAurora B and assayed for both kinase activity and for the relative amount of the three subunits by immunoblot (Figure 6D). Phosphatase treatment eliminated both the kinase activity and greatly increased the gel mobility of xINCENP, demonstrating that the phosphatase treatment had worked efficiently. However, the concentration of each subunit in the complex did not change. Therefore, maximum kinase activity of xAurora B requires both interaction with xSurvivin and the mitotic phosphorylation state of the complex.
| |
DISCUSSION |
|---|
|
|
|---|
During both interphase and mitosis, xAurora B kinase is in a complex with the majority of xINCENP and xSurvivin protein in the Xenopus embryo. The complex is cell cycle regulated as the kinase is activated >10-fold in mitosis, and hydrodynamic characterization suggests that there is a dramatic change in size that corresponds to changes in the cell cycle. We have determined two independent steps for mitotic xAurora B kinase activation: stoichiometric xSurvivin binding and a phosphorylation requirement. Therefore, like the CDK1 mitotic kinase, xAurora B activation can be regulated by both its phosphorylation state and the binding of a regulatory subunit.
Our demonstration that xSurvivin, xINCENP, and xAurora B kinase are in
a complex can simply explain the molecular details underpinning a
number of in vivo observations. First, in C. elegans double-stranded RNA-mediated interference (RNAi) of the INCENP homolog
can mislocalize the Aurora B kinase and loss of either protein causes
both chromosome segregation and cytokinetic defects (Kaitna et
al., 2000
; Oegema et al., 2001
). Second, after RNAi of
the Survivin homolog in C. elegans, the Aurora B homolog is mislocalized and embryos lacking either protein have similar phenotypes (Speliotes et al., 2000
). Our data suggest that these
phenotypes could either be caused by mislocalization of the proteins
when the complex is not properly formed or by inactive Aurora B kinase in the absence of the Survivin protein. The N terminus of human INCENP
(1-405) has dominant-negative activity and can inhibit the final
stages of cytokinesis when it is overexpressed in tissue culture cells
(Mackay and Earnshaw, 1993
; Mackay et al., 1998
). Our
mapping of xSurvivin binding to the N terminus of INCENP and xAurora B
binding to the C terminus suggests that overexpression of INCENP
(1-405) would sequester Survivin away from Aurora B and inhibit its
kinase activity.
A Complex of Chromosomal Passenger Proteins in the Xenopus Early Embryo
An in vivo passenger protein complex of xSurvivin, xINCENP,
and xAurora B kinase has been identified in Xenopus early
embryos. Our mapping data are consistent with a scaffold protein role
for xINCENP, which binds xSurvivin on its N terminus and xAurora B on
its C terminus (Figure 7A). The N
terminus of INCENP has been implicated in centromere targeting in
metaphase and midzone localization in anaphase (Mackay and Earnshaw,
1993
; Mackay et al., 1998
). Our localization of the Survivin
interaction to this region suggests that these targeting events could
be mediated through the Survivin protein. The C terminus of INCENP
contains the IN-box, which appears to be a highly conserved Aurora B
interaction motif as it also interacts with Aurora B homologs in
C. elegans, mouse, and budding yeast (Kaitna et
al., 2000
; Kang et al., 2001
). We have shown that both
the kinase domain of xAurora B and the N terminus provide interactions
with the C terminus of xINCENP. We have also shown that the N terminus
of Aurora B stabilizes xSurvivin binding in high-salt conditions. The
simplest interpretation of this finding is that the major interaction
between xSurvivin and xAurora is mediated through xINCENP, although
there is a weak direct interaction between xSurvivin and the N terminus
of xAurora B (Figure 7B).
|
It has been reported that Survivin and Aurora B interact directly in a
two-hybrid assay and that in an in vitro pull-down assay, the complex
is stable in treatments as harsh as 3 M NaCl (Wheatley et
al., 2001a
). Perhaps high concentrations of interacting proteins
in the two-hybrid and pull-down systems uncovered the weak interaction
between N terminus of Aurora B and Survivin. Alternatively, the
difference between the two results may be a problem with Aurora B
folding in overexpression systems. We have found that soluble
recombinant Aurora B can be purified from E. coli; however,
protein from these preparations migrates in the void fractions of
subsequent gel filtration columns (unpublished data, W. Lan, P.T.
Stukenberg). We feel that it is likely that recombinant Aurora B
purified from E. coli is at least partially denatured and
therefore the high NaCl sensitivity in the pull-down assay may be an
artifact of an in vitro experiment. Because of this problem with
recombinant protein, we have been forced to design all activity and
interaction experiments with endogenous xAurora B. For further
biochemical examination of the passenger protein complex, it will be
necessary to develop overexpression systems that can generate the
complex in its native folded state.
Although a physical interaction between xAurora B, xINCENP, and xSurvivin is detected during both interphase and mitosis, the hydrodynamic properties of the complex change dramatically during the cell cycle. Specifically, the peak off a gel filtration column is much broader in interphase than in mitosis, but peaks in the same fractions (migrating at 107 Å). Also, our sucrose density gradient data indicate that the interphase complex sediments significantly faster than the mitotic complex (9.5S and 4.5S, respectively). The simplest model to explain such hydrodynamic characteristics is that the active complex in mitosis is a highly elongated molecule that contains at least one molecule of xINCENP, xSurvivin, and xAurora B; in interphase, two of these complexes dimerize to double the molecular weight (Figure 7B). It is equally possible that there are unknown subunits that are bound in interphase.
There is a 2:1 M ratio of xAurora B:xSurvivin in extracts, and all of the xSurvivin protein is complexed with xAurora B. This finding was surprising because Survivin has been shown to have two functions: one as a mitotic spindle regulator and another as a chromosome passenger protein required for chromosome segregation and cytokinesis. Because Aurora B kinase has not been localized to the metaphase mitotic spindle, we expected xSurvivin to exist in at least two complexes. It is likely that the mitotic spindle requirement of Survivin is not required in the early embryo, but becomes essential during the mitosis of somatic cells. Interestingly, the metaphase spindle/centrosome localization of Survivin has been implicated to regulate apoptosis, a process that is not present in the Xenopus early embryo until after the midblastula transition (12th division).
xAurora B Kinase Activity Is Regulated by xSurvivin Binding and Phosphorylation
Mitotic kinases are highly regulated to ensure that their activity
is restricted to the proper time and location of the cell cycle. For
example, both the activity and localization of CDK1 kinase is regulated
by binding of a cyclin subunit (Labbé et al., 1989
;
Gautier et al., 1990
; Draviam et al., 2001
). CDK1
kinase activity is also both positively and negatively regulated by
phosphorylation (Simanis and Nurse, 1986
; Russell and Nurse, 1987
;
Murray et al., 1989
; Solomon et al., 1990
;
Gautier et al., 1991
). Our goal in beginning this study was
to describe in molecular detail the mechanisms of Aurora B kinase
activation in mitosis. To this end, we have developed a robust IP
kinase assay in Xenopus extracts to measure xAurora B kinase
activity and found that the kinase is stimulated >10-fold in mitosis.
Using this assay, we have made two significant contributions to our
understanding of xAurora B kinase regulation. First, we have
demonstrated that xAurora B kinase activity is stimulated by xSurvivin
binding. Second, we have confirmed that the phosphorylation state of
the mitotic complex is critical for the stimulation of kinase activity
(Figure 7B; Murnion et al., 2000
).
Survivin binding could increase Aurora kinase activity by two
mechanisms. It could either change the substrate recognition of xAurora
kinase or it could increase the rate of catalysis. Our data cannot
distinguish between these two models. During the preparation of this
manuscript, Chan and colleagues (Kang et al., 2001
)
published that the in vitro activity of the budding yeast Aurora
(Ipl1p) is stimulated 10- to 20-fold by direct binding of the INCENP
homolog (Sli15p). Thus, it is either possible that Aurora B activity
requires binding by both INCENP and Survivin or that Sli15p has
acquired Survivin's activation role. We have not detected stimulation
of Aurora kinase activity by the addition of the C-terminal fragment of
xINCENP to our Aurora B IPs. However, this is not surprising as
xINCENP, unlike Survivin, is not washed off in the salt washes.
Unfortunately, recombinant xINCENP and xAurora B from both E. coli and baculovirus appear highly misfolded after purification,
making direct activation experiments in the Xenopus system
impossible at this time.
We have also shown that activation of the xAurora B kinase depends upon
mitotic phosphorylation. This corroborates a recent study of
Xenopus Aurora B kinase and is consistent with previous work
that suggests that Aurora A kinase is regulated by phosphorylation (Walter et al., 2000
; Murnion et al., 2001
).
Currently, it is unknown if the activating mitotic phosphorylation is
on the xAurora B kinase or an interacting protein. Recent data from our
laboratory indicate that all three proteins are phosphorylated in
mitosis, and we have previously demonstrated that the xINCENP protein
is specifically hyperphosphorylated in mitosis (Stukenberg et
al., 1997
). We have extended this knowledge by mapping 26 cell
cycle-specific phosphorylation sites on Xenopus INCENP (F. White, D. Hunt, W. Lan, and P.T. Stukenberg, unpublished data).
Survivin has been shown previously to be a substrate of CDK1 in mitosis
(O'Connor et al., 2000
), and if phosphatase inhibitors are
used, we often see multiple bands in Survivin blots consistent with
heterogeneous phosphorylation (Figure 3). We have mapped seven cell
cycle-specific phosphorylation sites on the xAurora B protein that are
currently being characterized (F. White, D. Hunt, W. Lan, and P.T.
Stukenberg, unpublished data). Therefore, the phosphorylation-dependent
stimulation of Aurora B activity is likely to be very complex.
Why does Survivin binding regulate kinase activity? The simplest model
is that the kinase is not active until the entire complex is properly
assembled. The most provocative interpretation of our data is a highly
speculative model that we propose in Figure 7C. In this model, the
interaction between Survivin and Aurora is regulated within mitosis to
control kinase activity. One way to regulate the interaction of
Survivin with Aurora could be through a mechanical force, which could
separate Aurora and Survivin in the same complex, or Survivin could
simply dissociate from INCENP. Such a mechanism could permit spatial
regulation within parts of the same mitotic cell, allowing for pools of
active Aurora kinase with Survivin bound versus inactive Aurora kinase
with no Survivin interaction. However, we have yet to find conditions where xSurvivin binding to xAurora B is used as a regulatory mechanism in the Xenopus early embryo. Similar amounts of xSurvivin
are bound to xAurora B in both interphase and mitotic extracts (Figure 4). We have also immunoblotted Xenopus embryos
traversing the early embryonic cell cycles and we do not detect a gross
difference of xSurvivin levels (M. Bolton, P.T. Stukenberg, unpublished
data). However, the fact that xSurvivin is stable in interphase
is probably a unique feature of embryonic systems, as the protein
levels peak during mitosis in somatic cells (Li et al.,
1998
; Figure 2).
| |
ACKNOWLEDGMENTS |
|---|
We thank Dan Burke, Marko Kallio, and Gary Gorbsky for numerous helpful discussions and critical reading of the manuscript, Dario Altieri for sharing his manuscript before publication, and Ethan Lee and Susannah Rankin for reagents. We also thank John Daum for excellent technical advice and assistance with image acquisition. This work was supported by grants from the National Institutes of Health (GM63045-01), and the Pew Charitable Trust.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
pts7h{at}virginia.edu.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-02-0092. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-02-0092.
| |
ABBREVIATIONS |
|---|
Abbreviations used: EST, expressed sequence tag; GST, glutathione S-transferase; I, interphase; INCENP, inner centromere protein; IP, immunoprecipitation; MBP, myelin basic protein; PBS, phosphate-buffered saline; PBS-T, PBS containing 0.1% Tween 20; PCR, polymerase chain reaction; Pre-I, preimmune sera; xAurora B and xAurB, Xenopus Aurora B; xINCENP, Xenopus inner centromere protein; xSurvivin, Xenopus Survivin.
| |
REFERENCES |
|---|
|
|
|---|
-helical extensions.
Mol. Cell.
6, 183-189[CrossRef][Medline].This article has been cited by other articles:
![]() |
F. Ferri, H. Bouzinba-Segard, G. Velasco, F. Hube, and C. Francastel Non-coding murine centromeric transcripts associate with and potentiate Aurora B kinase Nucleic Acids Res., June 19, 2009; (2009) gkp529v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fu, M. Bian, J. Liu, Q. Jiang, and C. Zhang A single amino acid change converts Aurora-A into Aurora-B-like kinase in terms of partner specificity and cellular function PNAS, April 28, 2009; 106(17): 6939 - 6944. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yue, A. Carvalho, Z. Xu, X. Yuan, S. Cardinale, S. Ribeiro, F. Lai, H. Ogawa, E. Gudmundsdottir, R. Gassmann, et al. Deconstructing Survivin: comprehensive genetic analysis of Survivin function by conditional knockout in a vertebrate cell line J. Cell Biol., October 20, 2008; 183(2): 279 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Xia, P. M. Canovas, T. M. Guadagno, and D. C. Altieri A Survivin-Ran Complex Regulates Spindle Formation in Tumor Cells Mol. Cell. Biol., September 1, 2008; 28(17): 5299 - 5311. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Mita, M. M. Mita, S. T. Nawrocki, and F. J. Giles Survivin: Key Regulator of Mitosis and Apoptosis and Novel Target for Cancer Therapeutics Clin. Cancer Res., August 15, 2008; 14(16): 5000 - 5005. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Yamamoto, A. L. Lewellyn, and J. L. Maller Regulation of the Aurora B Chromosome Passenger Protein Complex during Oocyte Maturation in Xenopus laevis Mol. Cell. Biol., June 15, 2008; 28(12): 4196 - 4203. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Brennan, E. Rexhepaj, S. L. O'Brien, E. McSherry, D. P. O'Connor, A. Fagan, A. C. Culhane, D. G. Higgins, K. Jirstrom, R. C. Millikan, et al. Altered Cytoplasmic-to-Nuclear Ratio of Survivin Is a Prognostic Indicator in Breast Cancer Clin. Cancer Res., May 1, 2008; 14(9): 2681 - 2689. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chanrion, V. Negre, H. Fontaine, N. Salvetat, F. Bibeau, G. M. Grogan, L. Mauriac, D. Katsaros, F. Molina, C. Theillet, et al. A Gene Expression Signature that Can Predict the Recurrence of Tamoxifen-Treated Primary Breast Cancer Clin. Cancer Res., March 15, 2008; 14(6): 1744 - 1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thomas and K. B. Kaplan A Bir1p Sli15p Kinetochore Passenger Complex Regulates Septin Organization during Anaphase Mol. Biol. Cell, October 1, 2007; 18(10): 3820 - 3834. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Chen, G. S. Lakshmikanth, J. A. Spudich, and A. De Lozanne The Localization of Inner Centromeric Protein (INCENP) at the Cleavage Furrow Is Dependent on Kif12 and Involves Interactions of the N Terminus of INCENP with the Actin Cytoskeleton Mol. Biol. Cell, September 1, 2007; 18(9): 3366 - 3374. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, W. Lan, S. C. Ems-McClung, P. T. Stukenberg, and C. E. Walczak Aurora B Phosphorylates Multiple Sites on Mitotic Centromere-associated Kinesin to Spatially and Temporally Regulate Its Function Mol. Biol. Cell, September 1, 2007; 18(9): 3264 - 3276. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kaneko, N. Tsuji, K. Asanuma, H. Tanabe, D. Kobayashi, and N. Watanabe Survivin Down-regulation Plays a Crucial Role in 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase Inhibitor-induced Apoptosis in Cancer J. Biol. Chem., July 6, 2007; 282(27): 19273 - 19281. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vogel, C. Hager, and H. Bastians Mechanisms of Mitotic Cell Death Induced by Chemotherapy-Mediated G2 Checkpoint Abrogation Cancer Res., January 1, 2007; 67(1): 339 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fu, M. Bian, Q. Jiang, and C. Zhang Roles of Aurora Kinases in Mitosis and Tumorigenesis Mol. Cancer Res., January 1, 2007; 5(1): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Monier, S. Mouradian, and K. F. Sullivan DNA methylation promotes Aurora-B-driven phosphorylation of histone H3 in chromosomal subdomains J. Cell Sci., January 1, 2007; 120(1): 101 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Vader, R. H. Medema, and S. M.A. Lens The chromosomal passenger complex: guiding Aurora-B through mitosis J. Cell Biol., June 19, 2006; 173(6): 833 - 837. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. R. Klein, E. A. Nigg, and U. Gruneberg Centromere Targeting of the Chromosomal Passenger Complex Requires a Ternary Subcomplex of Borealin, Survivin, and the N-Terminal Domain of INCENP Mol. Biol. Cell, June 1, 2006; 17(6): 2547 - 2558. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rosa, P. Canovas, A. Islam, D. C. Altieri, and S. J. Doxsey Survivin Modulates Microtubule Dynamics and Nucleation throughout the Cell Cycle Mol. Biol. Cell, March 1, 2006; 17(3): 1483 - 1493. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Chen, H. Li, and A. De Lozanne Contractile Ring-independent Localization of DdINCENP, a Protein Important for Spindle Stability and Cytokinesis Mol. Biol. Cell, February 1, 2006; 17(2): 779 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-I Chao and H.-F. Liu The Blockage of Survivin and Securin Expression Increases the Cytochalasin B-Induced Cell Death and Growth Inhibition in Human Cancer Cells Mol. Pharmacol., January 1, 2006; 69(1): 154 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Hanson, A. C. Kelley, and M. Bienz Loss of Drosophila borealin causes polyploidy, delayed apoptosis and abnormal tissue development Development, November 1, 2005; 132(21): 4777 - 4787. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-K. Huang, J. M. Bailis, J. D. Leverson, E. B. Gomez, S. L. Forsburg, and T. Hunter Suppressors of Bir1p (Survivin) Identify Roles for the Chromosomal Passenger Protein Pic1p (INCENP) and the Replication Initiation Factor Psf2p in Chromosome Segregation Mol. Cell. Biol., October 15, 2005; 25(20): 9000 - 9015. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. P. Cho, Y. Liu, M. Gomez, J. Dunlap, M. Tyers, and Y. Wang The Dual-Specificity Phosphatase CDC14B Bundles and Stabilizes Microtubules Mol. Cell. Biol., June 1, 2005; 25(11): 4541 - 4551. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yan, L. Cao, Q. Li, Y. Wu, H. Zhang, H. Saiyin, X. Liu, X. Zhang, Q. Shi, and L. Yu Aurora C is directly associated with Survivin and required for cytokinesis Genes Cells, June 1, 2005; 10(6): 617 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Samuel, K. Okada, M. Hyer, K. Welsh, J. M. Zapata, and J. C. Reed cIAP1 Localizes to the Nuclear Compartment and Modulates the Cell Cycle Cancer Res., January 1, 2005; 65(1): 210 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Scrittori, D. A. Skoufias, F. Hans, V. Gerson, P. Sassone-Corsi, S. Dimitrov, and R. L. Margolis A Small C-Terminal Sequence of Aurora B Is Responsible for Localization and Function Mol. Biol. Cell, January 1, 2005; 16(1): 292 - 305. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-C. Kuo, H.-F. Liu, and J.-I Chao Survivin and p53 Modulate Quercetin-induced Cell Growth Inhibition and Apoptosis in Human Lung Carcinoma Cells J. Biol. Chem., December 31, 2004; 279(53): 55875 - 55885. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Johnson and E. W. Howerth Survivin: A Bifunctional Inhibitor of Apoptosis Protein Vet. Pathol., November 1, 2004; 41(6): 599 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Boman, R. Walters, J. Z. Fields, A. J. Kovatich, T. Zhang, G. A. Isenberg, S. D. Goldstein, and J. P. Palazzo Colonic Crypt Changes during Adenoma Development in Familial Adenomatous Polyposis: Immunohistochemical Evidence for Expansion of the Crypt Base Cell Population Am. J. Pathol., November 1, 2004; 165(5): 1489 - 1498. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Beardmore, L. J. Ahonen, G. J. Gorbsky, and M. J. Kallio Survivin dynamics increases at centromeres during G2/M phase transition and is regulated by microtubule-attachment and Aurora B kinase activity J. Cell Sci., August 15, 2004; 117(18): 4033 - 4042. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Geddis and K. Kaushansky Megakaryocytes express functional Aurora-B kinase in endomitosis Blood, August 15, 2004; 104(4): 1017 - 1024. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gassmann, A. Carvalho, A. J. Henzing, S. Ruchaud, D. F. Hudson, R. Honda, E. A. Nigg, D. L. Gerloff, and W. C. Earnshaw Borealin: a novel chromosomal passenger required for stability of the bipolar mitotic spindle J. Cell Biol., July 19, 2004; 166(2): 179 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Gruneberg, R. Neef, R. Honda, E. A. Nigg, and F. A. Barr Relocation of Aurora B from centromeres to the central spindle at the metaphase to anaphase transition requires MKlp2 J. Cell Biol., July 19, 2004; 166(2): 167 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ohi, T. Sapra, J. Howard, and T. J. Mitchison Differentiation of Cytoplasmic and Meiotic Spindle Assembly MCAK Functions by Aurora B-dependent Phosphorylation Mol. Biol. Cell, June 1, 2004; 15(6): 2895 - 2906. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-I Chao, P.-C. Kuo, and T.-S. Hsu Down-regulation of Survivin in Nitric Oxide-induced Cell Growth Inhibition and Apoptosis of the Human Lung Carcinoma Cells J. Biol. Chem., May 7, 2004; 279(19): 20267 - 20276. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Asanuma, N. Tsuji, T. Endoh, A. Yagihashi, and N. Watanabe Survivin Enhances Fas Ligand Expression via Up-Regulation of Specificity Protein 1-Mediated Gene Transcription in Colon Cancer Cells J. Immunol., March 15, 2004; 172(6): 3922 - 3929. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Eyers and J. L. Maller Regulation of Xenopus Aurora A Activation by TPX2 J. Biol. Chem., March 5, 2004; 279(10): 9008 - 9015. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lewis, E. Burstein, S. B. Reffey, S. B. Bratton, A. B. Roberts, and C. S. Duckett Uncoupling of the Signaling and Caspase-inhibitory Properties of X-linked Inhibitor of Apoptosis J. Biol. Chem., March 5, 2004; 279(10): 9023 - 9029. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Wheatley, A. J. Henzing, H. Dodson, W. Khaled, and W. C. Earnshaw Aurora-B Phosphorylation in Vitro Identifies a Residue of Survivin That Is Essential for Its Localization and Binding to Inner Centromere Protein (INCENP) in Vivo J. Biol. Chem., February 13, 2004; 279(7): 5655 - 5660. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Glotzer Cleavage furrow positioning J. Cell Biol., February 2, 2004; 164(3): 347 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zhang, J. Z. Fields, S. M. Ehrlich, and B. M. Boman The Chemopreventive Agent Sulindac Attenuates Expression of the Antiapoptotic Protein Survivin in Colorectal Carcinoma Cells J. Pharmacol. Exp. Ther., February 1, 2004; 308(2): 434 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martinez, B. Bellosillo, F. Bosch, A. Ferrer, S. Marce, N. Villamor, G. Ott, E. Montserrat, E. Campo, and D. Colomer Nuclear Survivin Expression in Mantle Cell Lymphoma Is Associated with Cell Proliferation and Survival Am. J. Pathol., February 1, 2004; 164(2): 501 - 510. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Daidone, A. Costa, M. Frattini, D. Balestra, L. Bertario, M. A. Pierotti, B. M. Boman, T. Zhang, and J. Z. Fields Correspondence re: T. Zhang et al., Evidence That APC Regulates Survivin Expression: A Possible Mechanism Contributing to the Stem Cell Origin of Colon Cancer. Cancer Res., 61: 8664-8667, 2001. Cancer Res., January 15, 2004; 64(2): 776 - 779. [Full Text] [PDF] |
||||
![]() |
Z. Xing, E. M. Conway, C. Kang, and A. Winoto Essential Role of Survivin, an Inhibitor of Apoptosis Protein, in T Cell Development, Maturation, and Homeostasis J. Exp. Med., January 5, 2004; 199(1): 69 - 80. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Reed and D. B. Wilson Cancer Immunotherapy Targeting Survivin: Commentary re: V. Pisarev et al., Full-Length Dominant-Negative Survivin for Cancer Immunotherapy. Clin. Cancer Res., 9:6523-6533, 2003. Clin. Cancer Res., December 15, 2003; 9(17): 6310 - 6315. [Full Text] [PDF] |
||||
![]() |
R. Neef, C. Preisinger, J. Sutcliffe, R. Kopajtich, E. A. Nigg, T. U. Mayer, and F. A. Barr Phosphorylation of mitotic kinesin-like protein 2 by polo-like kinase 1 is required for cytokinesis J. Cell Biol., September 1, 2003; 162(5): 863 - 876. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Honda, R. Korner, and E. A. Nigg Exploring the Functional Interactions between Aurora B, INCENP, and Survivin in Mitosis Mol. Biol. Cell, August 1, 2003; 14(8): 3325 - 3341. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Song, X. Yao, and M. Wu Direct Interaction between Survivin and Smac/DIABLO Is Essential for the Anti-apoptotic Activity of Survivin during Taxol-induced Apoptosis J. Biol. Chem., June 13, 2003; 278(25): 23130 - 23140. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Romano, A. Guse, I. Krascenicova, H. Schnabel, R. Schnabel, and M. Glotzer CSC-1: a subunit of the aurora b kinase complex that binds to the survivin-like protein BIR-1 and the incenp-like protein ICP-1 J. Cell Biol., April 28, 2003; 161(2): 229 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. McCleland, R. D. Gardner, M. J. Kallio, J. R. Daum, G. J. Gorbsky, D. J. Burke, and P. T. Stukenberg The highly conserved Ndc80 complex is required for kinetochore assembly, chromosome congression, and spindle checkpoint activity Genes & Dev., January 1, 2003; 17(1): 101 - 114. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||