![]() |
|
|
Vol. 14, Issue 12, 4885-4895, December 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
to the Plasma Membrane in RBL-2H3 Cells
Department de Bioquímica y Biología Molecular (A), Facultad de Veterinaria, Universidad de Murcia, Apdo. 4021, E-30100 Murcia, Spain
Submitted May 13, 2003;
Revised July 3, 2003;
Accepted August 6, 2003
Monitoring Editor: Carl Henrik-Heldin
| ABSTRACT |
|---|
|
|
|---|
(PKC
) localization and activation after stimulation of the IgE receptor in RBL-2H3 cells, we used a series of mutants located in the phospholipid binding region of the enzyme. The results obtained suggest that the interaction of the C2 domain with the phospholipids in the plasma membrane is essential for anchoring the enzyme in this cellular compartment. Furthermore, the use of specific inhibitors of the different pathways that generate both diacylglycerol and phosphatidic acid has shown that the phosphatidic acid generated via phospholipase D (PLD)-dependent pathway, in addition to the diacylglycerol generated via phosphoinosite-phospholipase C (PLC), are involved in the localization of PKC
in the plasma membrane. Direct stimulation of RBL-2H3 cells with very low concentrations of permeable phosphatidic acid and diacylglycerol exerted a synergistic effect on the plasma membrane localization of PKC
. Moreover, the in vitro kinase assays showed that both phosphatidic acid and diacylglycerol are essential for enzyme activation. Together, these results demonstrate that phosphatidic acid is an important and essential activator of PKC
through the C2 domain and locate this isoenzyme in a new scenario where it acts as a downstream target of PLD. | INTRODUCTION |
|---|
|
|
|---|
(PKC
) isoenzyme, which belongs to the group of novel PKCs, has been linked with the regulation of several biological processes, including neuronal differentiation (Brodie et al., 1999
exhibits two areas at the top surface of the molecule that might participate in its binding to anionic membranes (Ochoa et al., 2001
to bind to negatively charged phospholipid vesicles in a Ca2+-independent manner, similarly to that seen for other novel PKC isoenzymes (Medkova and Cho, 1998
The C2 domain of PKC
has been involved in several proteinprotein interactions. For example, it has been demonstrated that the coatomer protein
'-COP (also called RACK2) interacts with PKC
(Csukai et al., 1997
). Recent findings have shown that PKC
can also interact with RACK1, positively regulating the integrin-dependent adhesion, spread, and motility of human glioma cells (Besson et al., 2002
). Another function attributed to this interaction with RACK1 is that it serves as a scaffold to anchor the enzyme close to the cystic fibrosis transmembrane regulator (Liedtke et al., 2002
). Nevertheless, besides proteinprotein interactions, no other roles have been attributed to the C2 domain of PKC
in biological systems and the mechanisms operating in the phospholipid-dependent translocation of this enzyme are still not well characterized in vivo, leaving many questions still unresolved. For example, it is unclear to what extent negatively charged phospholipids are involved in the plasma membrane translocation of the enzyme and what exactly is the molecular mechanism driving this enzymemembrane interaction after physiological activation of the membrane receptors.
The cross-linking of the high-affinity IgE receptor (Fc
RI) with antigen in mast or basophilic cells stimulates a number of lipid-signaling events, which include the activation of phospholipase C
, phospho-inositide 3-kinase, and phospholipase D (PLD) (Schneider et al., 1992
; Brown et al., 1998
; Djouder et al., 2001
) and many serine/threonine kinases (Millard et al., 1989
; Park et al., 1991
; Gruchalla et al., 1990
), including the PKC family among others (Ozawa et al., 1993
). However, it is not well established how PLC and PLD, or other enzymes, participate in the generation of the different activators of the variety of PKCs or how they contribute to the localization and activation of each isoenzyme.
RBL-2H3 cells (a rat basophilic cell line) contain at least five species of PKC isoenzymes:
,
,
,
, and
. More particularly, it has been suggested that PKC
serves as a link between the aggregation of the IgE receptor and the subsequent expression of c-fos and c-jun (Razin et al., 1994
). In addition, it has been demonstrated that upon antigen stimulation, this isoenzyme translocates to the plasma membrane where it contributes to cell proliferation (Chang et al., 1997
).
In the present study, we have examined the effect of the substitution of several amino acidic residues localized in the C2 domain of PKC
on the localization of the enzyme in the plasma membrane, after activation of Fc
RI. The results have shown that loops 1 and 3 of the C2 domain participate in the membrane anchorage of the enzyme by interacting with phosphatidic acid (PtdOH). This phospholipid is mainly generated via PLD, although a small contribution on the part of diacylglycerol kinase (DGK) cannot be ruled out. Additionally, an essential interaction with diacylglycerol (DAG), which is generated by phosphoinosite (PI)-PLCs, is necessary to firmly anchor the enzyme in the plasma membrane and to activate its catalytic activity. In conclusion, PKC
has been defined as a new target for biologically generated PtdOH and placed in a new context as a downstream target of PLD.
| MATERIALS AND METHODS |
|---|
|
|
|---|
cDNA was a gift from Drs. Nishizuka and Y. Ono (Kobe University, Kobe, Japan). N-Terminal fusion of rat PKC
to green fluorescent protein (GFP) was generated by inserting cDNA into BglII and BamHI sites of the plasmid enhanced green fluorescent protein (pEGFP)-N3 (BD Biosciences Clontech, Palo Alto, CA) mammalian expression vector. The C2 domain mutants were generated by polymerase chain reaction by using the modified C2 domains generated in our previous work as a template (Ochoa et al., 2001
-GFP. The primers used were 5'GCCAGATCTATGGTAGTGTTCAATG and 3'GAAAAGTCTACGTGATCATCGATC. Then, both wild-type and mutant genes were subcloned into the XbaI and KpnI sites of the pCGN vector (Tanaka and Herr, 1990
fused 3' to the hemagglutinin (HA) epitope. All constructs were confirmed by DNA sequencing.
Previous studies have shown that a C-terminal GFP tag does not affect the localization, catalytic activity or the cofactor dependence of PKC
(Shirai et al., 1998
). Additionally, the stability and viability of the mutated proteins were studied by using specific activity measurements as shown below.
Cell Culture and Transfections
Human embryonic kidney (HEK)293 cells were grown in DMEM with 10% fetal calf serum and transfected following the calcium phosphate method described by Wigler et al. (1977
). Rat basophilic leukemia (RBL-2H3) cells were cultured at 37°C in a humidified atmosphere of 5% CO2 in a growth medium of Dulbecco's modified Eagle's Medium supplemented with 15% (vol/vol) fetal calf serum. Cells were prepared for confocal microscopy as described by Bolsover et al., (2001
). Basically, harvested cells were resuspended in electroporation buffer (120 mM NaCl, 5.5 mM KCl, 2.8 mM MgCl2, 25 mM glucose, 20 mM HEPES, pH 7.2) and 30 µg of cDNA. Cells were electroporated in a GenePulser (Bio-Rad, Hercules, CA) with two 500-V pulses. The cells were immediately placed on ice for 5 min before being plated on glass coverslips and incubated at 37°C for 46 h, after which the growth medium was renewed. RBL cells were used 1624 h later after priming overnight with 500 ng/ml IgE-anti-dinitrophenyl (mouse monoclonal; Sigma-Aldrich Quimica, S.A., Madrid, Spain). The coverslips were washed with 3 ml of extracellular buffer HBS (120 mM NaCl, 25 mM glucose, 5.5 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 20 mM HEPES pH 7.2). All added substances were dissolved or diluted in HBS. 1,2-Dioctanoylglycerol (DiC8) and PtdOH (DiC8-PtdOH) were dissolved in dimethyl sulfoxide and diluted to the final concentration with extracellular buffer shortly before the experiment. During the experiment, the cells were not exposed to dimethyl sulfoxide concentrations >1%. All the experiments were carried out at room temperature and, unless otherwise stated, on at least four different occasions. In each experiment, recordings were obtained from two to six cells.
When used, the various phospholipase inhibitors were present 10 min before stimulation (4 µg/ml dinitrophenyl-human serum albumin [DNP-HAS]) at the following concentrations: 30 µM U73122
[GenBank]
, 30 µM D-609, 50 mM 1-butanol, 100 µM propranolol, and 20 µM DGK inhibitor II (R59022
[GenBank]
). To demonstrate that the inhibitors we used were selective under the conditions of these experiments, we examined their effect on
-hexosaminidase release in RBL-2H3 cells transfected with PKC
-GFP. The results are presented in Table 1. As expected, IgE-dependent release was inhibited by U73122
[GenBank]
, 1-butanol, and propranolol (Schneider et al., 1992
; Cissel et al., 1998
). A slight decrease in the release of
-hexosaminidase was observed when DGK inhibitor was used, and no effect on secretion was detected when the cells were preincubated with D-609 (Table 1). The
-hexosaminidase release was measured as described by Ozawa et al. (1993
).
|
When possible, additional control experiments were performed with U73343 [GenBank] , which is an inactive analogue of U73122 [GenBank] . 1-Butanol can replace water in the reaction catalyzed by PLD to produce choline and phosphatidylbutan-1-ol (PBut) instead of phosphatidic acid and PtdOH; however, 2-butanol does not compete in this reaction and thus can be used as an appropriate control for the inhibition of the PA generated by PLD.
Confocal Microscopy
Cells expressing various PKC
-EGFP constructs were washed with HBS and examined using a TCS SP confocal system (Leica, Heidelberg, Germany) with a Nikon PLAN APO-CS 63x 1.2 numerical aperture water immersion objective. Confocal images were obtained by excitation at 488 nm and emission wavelengths at 500525 nm for GFP. During imaging, cells were stimulated with antigen (DNP-HAS; Sigma-Aldrich Quimica, S.A.) or other agents as described. Series of 60120 confocal images were recorded for each experiment at time intervals of 5 s.
Image Analysis
Background was subtracted from images before the calculations were performed. The time series were analyzed using Image J NIH software (http://rsb.info.nih.gov/ij/, 19972003). An individual analysis of protein translocation for each cell was performed by tracing a line intensity profile across the cell (Meyer and Oancea, 2000
). The relative increase in the amount of enzyme localized in the plasma membrane for each time point was calculated by using the ratio R = (Imb Icyt)/Icyt where Imb is the fluorescence intensity at the plasma membrane and Icyt is the average cytosolic fluorescence intensity. Mean values are given ± SE of the mean.
Purification of Protein Kinase C
and Its Mutants
HEK293 cells (9-cm plates) were transfected with 10 µg of cDNA of pCGN-PKC
and the different mutants. Cells were harvested at 48 h postransfection, pelleted, and resuspended in lysis buffer (5 ml of buffer/g cells) containing 20 mM Tris pH 8, 10 mM EGTA, 2 mM EDTA, 0.25 M sucrose, 1 mM phenyl-methylsulfonyl fluoride, 10 µg/ml leupeptine, 100 µM Na3VO4, 50 mM NaF, and 20 mM n-octyl-
-D-glucopyranoside. The pellet was disrupted by sonication and the resulting lysate was centrifugated at 12,500 rpm for 30 min at 4°C. The supernatant was applied to a DEAE-Sephacel column and equilibrated with E buffer (20 mM Tris-HCl pH 8.0, 0.5 mM EGTA, 0.5 mM EDTA, and 10 mM
-mercaptoethanol). The bound proteins were eluted from the column by the application of a salt gradient (01 M NaCl in buffer E) at a flow rate of 0.5 ml/min. Protein was concentrated by using a 30K Ultrafree centrifugal filter device (Millipore, Billerica, MA). The protein was then aliquoted and stored at 80°C in the presence of 10% (vol/vol) glycerol and 0.05% (vol/vol) Triton X-100.
Preparation of Large Unilamellar Vesicles
The lipid mixtures were generated by mixing chloroform solutions of 1-palmitoyl-2-oleoyl-sn-glicero-3-phosphocoline (POPC), 1-palmitoyl-2-oleoyl-sn-glicero-3-phosphate (POPA), and 1,2-sn-dioleylglycerol (DOG) (Avanti Polar Lipids, Alabaster, AL) and dried from the organic solvent under a stream of nitrogen and then further dried under vacuum for 90 min. Sucrose-loaded vesicles were prepared as described by Rebecchi et al., (1992
).
Kinase Activity Assay
The kinase activity was assayed in vitro with purified wild-type and mutants PKC
by measuring the incorporation of 32Pi into the substrate histone III-S. The reaction was started by addition of 0.033 µg of PKC
to a 48-µl reaction mixture containing 20 mM Tris-HCl pH 8.0, 0.2 mM EGTA, 5 mM MgCl, 0.2 mg/ml histone III-S, 0.05 mM ATP with [32P]ATP (200,000 cpm/nmol) and 0.2 mM final concentration of lipids. After 20 min, the reaction was stopped using 1 ml of 25% trichloroacetic acid and 1 ml of 0.05% bovine serum albumin. The reaction mixture was then stored on ice for 30 min and the proteins were colleted on a 2.5-cm-diameter glass fiber filter and washed twice with 10% trichloroacetic acid. The incorporation of 32Pi was measured by liquid scintillation counting. Background specific activity in the absence of lipids was also measured and subtracted to that obtained in the presence of the distinct phospholipid mixtures. Additional control experiments were performed with mock cell lysates to eliminate the endogenous activity, which represented <1% of the total enzyme activity measured.
| RESULTS |
|---|
|
|
|---|
Translocates to the Plasma Membrane of RBL-2H3 Cells after the Activation of the IgE Receptor
participated in the interaction of the domain with liposomes containing negatively charged phospholipids (Ochoa et al., 2001
-W23A/R26A/R32A-GFP), and I89N (PKC
-I89N-GFP) and Y91A (PKC
-Y91A-GFP) both located in loop 3 (Figure 1, A and B). A triple substitution was chosen in the case of loop 1, because previous in vitro binding assays showed that a single substitution of these residues does not affect the membrane binding properties of the domain (Ochoa et al., 2001
-GFP), which enabled us to study the spatio-temporal localization of the enzyme by using confocal microscopy in time-lapse experiments.
|
Figure 2A shows images of IgE-stimulated RBL-2H3 cells expressing PKC
-GFP. In unstimulated cells, the protein was uniformly distributed through the cytosol (Figure 2A, a), whereas stimulation with 4 µg/ml DNP-HSA resulted in a translocation of the enzyme to the plasma membrane (Figure 2A, b). When the relative increase in plasma membrane over cytosolic fluorescence intensity (R) was calculated at each time point, it was observed that maximal translocation was reached after 105 s of antigen stimulation (Figure 2B), indicating the slow progress of plasma membrane localization (1.75 min) especially compared with the classical isoenzymes (26 s) (Oancea and Meyer, 1998
; Bolsover et al., 2003
). The protein was anchored to the plasma membrane for 108 s and started to revert slowly to the cytosol, reaching half plasma membrane dissociation 455 s after antigen stimulation.
|
To test whether a membrane-permeant diacylglycerol (DiC8) was able to bring about the localization of the enzyme in the plasma membrane, the cells were stimulated first with 4 µg/ml DNP-HSA. When the protein was half-dissociated from the plasma membrane, 25 µg/ml DiC8 was added, maximal enzyme translocation to the plasma membrane being reached in 31 s, whereas the protein remained anchored to the plasma membrane for at least 200 s (Figure 2C).
Role of Lipid-binding Residues Located in the C2 Domain of PKC
in the Antigen-dependent Translocation of the Enzyme to the Plasma Membrane
To determine the role of the C2 domain in the antigen-dependent translocation of PKC
, we examined the effect of antigen stimulation on the plasma membrane translocation of each of the mutant proteins generated. In the case of the PKC
-W23A/R26A/R32A-GFP mutant, antigen stimulation was not sufficient to induce the translocation of the protein to the membrane, and only when DiC8 was added to the incubation media did the protein anchor itself to the membrane permanently (Figure 3, A and B). When the cells were transfected with PKC
-I89N-GFP mutant, a very low and partial degree of membrane localization was observed (Figure 3A), the maximal translocation ratio (R) calculated being 0.34 ± 0.09 272 s after antigen stimulation (Figure 3B). A less damaging effect was observed when Y91 was substituted by A (Figure 3A), in which case partial translocation (R = 0.49 ± 0.1) was obtained 178 s after antigen stimulation (Figure 3B). Both these two mutants also translocated to the plasma membrane after the addition of DiC8.
|
These data suggest that both loop 1 and 3 are critical for PKC
membrane targeting and might interact with some other activators probably generated upon antigen stimulation besides diacylglycerol. Another possibility is that the C2 domain cooperates with the C1 domain by increasing its affinity for diacylglycerol, the mutagenesis producing an overall decrease in the affinity of the enzyme for this compound.
Effect of Direct Stimulation with DiC8 on the Membrane Translocation of PKC
and the Different Mutants
To directly determine the role of diacylglycerol in the plasma membrane translocation of PKC
, RBL-2H3 cells were transfected with wild-type protein, PKC
-W23A/R26A/R32A-GFP, or PKC
-I89N-GFP mutants. The cells were then stimulated with different concentrations of DiC8. Figure 4A shows that no differences in localization were found between the wild-type and the two mutants when the cells were stimulated with 10 µg/ml DiC8. Furthermore, the proteins bound to the plasma membrane 27 s after DiC8 addition. Similar results were obtained when the cells were stimulated with 25 µg/ml DiC8 (our unpublished data). However, when the concentration of DiC8 was decreased to 5 µg/ml (Figure 4B), the wild-type protein translocated to the plasma membrane 35 s after stimulation, and the PKC
-W23A/R26A/R32A mutant exhibited a slightly slower translocation profile. Surprisingly, the effect was greater in the PKC
-I89N mutant, which only half-translocated (R = 0.48 ± 0.09) 105 s after DiC8 stimulation (Figure 4B). These experiments suggest that I89 located in loop 3 of the C2 domain might enhance the affinity of the C1 domain for diacylglycerol or even participate directly in the interaction.
|
It is important to note that the very low degree of inhibition obtained in the plasma membrane localization of the mutants after DiC8 stimulation differed from the dramatic inhibition obtained after stimulation with DNP-HSA, strongly suggesting that the force driving the enzyme translocation to the plasma membrane under physiological conditions is not only DiC8 but also other components generated in this process, such as phosphatidic acid.
Involvement of PLD, DGK, and PI-PLC in the Plasma Membrane Localization of PKC
To shed light on the plasma membrane localization of PKC
under physiological conditions, we used several specific inhibitors of the different signaling pathways related with the biological generation of both DAG and PtdOH. Thus, we used U73122
[GenBank]
, a specific inhibitor of PI-PLC (Bleasdale et al., 1990
), and D-609, which has been reported to inhibit phosphatidylcholine (PC)-PLC (Muller-Decker, 1989
), both of which impede DAG synthesis from phosphatidylinositol 4,5-bisphosphate and PC, respectively. One of the main ways in which PtdOH is generated in the cell is by the activation of PLD, which hydrolyzes PC to produce PtdOH and choline. The primary alcohol, 1-butanol, can effectively replace water in this reaction to produce choline and phosphatidylbutan-1-ol, thus inhibiting PtdOH synthesis (Cissel et al., 1998
). Another way of blocking the synthesis of PtdOH is to use propranolol, which directly binds to PtdOH and to phosphatidic acid phosphohydrolase, inhibiting the synthesis of DAG (Koul and Hauser, 1987
). An additional source of PtdOH in cell signaling is DGK, which phosphorylates DAG to produce PtdOH, a reaction we blocked by using DGK inhibitor II (R59022
[GenBank]
) (de Chaffoy de Courcelles et al., 1985
). We then investigated the effect of each drug on the antigen-dependent membrane localization of PKC
.
RBL-2H3 cells were transfected with PKC
-GFP and primed with anti-IgE antibody for 16 h. Before antigen was added, they were incubated for 10 min with each inhibitor (Figure 5). In resting cells, the protein was localized in the cytosol in all cases, but when the cells were stimulated with 4 µg/ml DNP-HSA, protein translocation to the plasma membrane was completely inhibited by U73122
[GenBank]
, 1-butanol, and propranolol (Figure 5, a, b, e, f, g, and h). When possible, control experiments were performed with U73343
[GenBank]
and 2-butanol, neither of which competed in these reactions, allowing PKC
to localize in the plasma membrane (our unpublished data). An intermediate effect was observed when DGK inhibitor II was used at saturating concentrations of 20 µM (Figure 5, i and j), probably reflecting a smaller contribution of DGK to the generation of PtdOH in this pathway, but more importantly, showing that several sources of PtdOH are needed for PKC
localization. No inhibitory effect on the membrane localization of PKC
was observed when the cells were incubated with D-609, demonstrating that PC-PLC plays no role in this process.
|
These data suggest that both DAG generated by PI-PLC and PtdOH generated mainly via PLD are necessary for proper PKC
membrane docking, the absence of either completely impeding the localization of this enzyme.
However, the final product of the reaction initiated by PLD is DAG (Figure 10A), and thus, with the use of 1-butanol and propranolol, the possibility cannot be ruled out that instead of the first product (PtdOH), it is the second product (DAG) of the reaction that is responsible for the PKC
plasma membrane localization. Furthermore, it cannot be discarded that there may be a direct effect of the inhibitors on the diacylglyceroldependent translocation of the enzyme. To address this question, the DiC8-dependent PKC
localization was studied in the presence of 50 mM 1-butanol or 100 µM propranolol. When the cells were stimulated with 10 µg/ml DiC8, no differences in the plasma membrane localization of PKC
were observed between the cells in the absence and in the presence of each inhibitor (Figure 6A). Similar results were obtained when the cells were stimulated with lower concentrations of DiC8 (5 µg/ml), and neither 1-butanol nor propranolol produced an inhibitory effect on the localization of PKC
(Figure 6B). Together, these data suggest that no additional inhibitory effects over the direct diacylglycerol-dependent translocation of the enzyme seem to occur and most probably, the effect observed when both 1-butanol and propranolol were used as inhibitors in the antigen-dependent localization of PKC
is derived from the direct inhibition of the generation of PtdOH.
|
|
Direct Phosphatidic Acid Stimulation Produces a Similar Pattern of Plasma Membrane Translocation to That Produced by Antigen Stimulation
Previous in vitro experiments in our laboratory demonstrated the tendency of the isolated C2 domain of PKC
to preferentially bind phospholipid vesicles containing phosphatidic acid (Garcia-Garcia et al., 2001
; Ochoa et al., 2001
). The results obtained above also suggest that the full-length enzyme needs a continuous source of PtdOH to translocate to the plasma membrane in physiological conditions. Because exogenous PtdOH (DiC8-PtdOH) can be added to the cell culture medium and is incorporated rapidly into cell membranes where it subsequently participates in cellular functions (Fang et al., 2001
), we tested the ability of this soluble-permeant phosphatidic acid to activate both wild-type and the different mutants. When cells transfected with PKC
-GFP were stimulated with 22 µg/ml PtdOH (Figure 7A), maximal plasma membrane localization was reached 60 s after PtdOH addition and the protein remained located in the plasma membrane for the 600 s the experiment lasted (R = 0.82 ± 0.07). However, when cells transfected with PKC
-I89N-GFP were stimulated with PtdOH, a maximal translocation of R = 0.55 ± 0.03 was observed 89 s after stimulation. A more drastic effect was obtained when the cells were transfected with PKC
-W23A/R26A/R32A-GFP mutant, when R = 0.44 ± 0.01 was the maximal translocation ratio obtained 136 s after stimulation with PtdOH. To test whether these results were concentration dependent, we also studied the effect of a lower concentration of PtdOH (11 µg/ml) on the plasma membrane localization of both wild-type and mutants (Figure 7B). In this case, the rate of localization of PKC
-GFP slowed down, maximal localization (R = 0.84 ± 0.08) being obtained 119 s after PtdOH stimulation. A more drastic effect was obtained when the cells were transfected with PKC
-W23A/R26A/R32A-GFP and PKC
-I89N-GFP mutants, when maximal translocations to the plasma membrane were R = 0.42 ± 0.05 and 0.54 ± 0.11 224 and 179 s after stimulation, respectively.
|
These data confirm that PtdOH is able to induce the translocation of the enzyme to the plasma membrane. Furthermore, the translocation profiles of both wild-type and mutant proteins were more similar to those exhibited by cells activated by antigen than the profiles occurring when the cells were stimulated by DiC8. The more drastic effect of the C2 domain mutations on protein localization observed after IgE receptor stimulation could be due to the lower levels of phosphatidic acid generated into the cells physiologically. In fact, it has been described that the normal molar concentration of PtdOH in cell membranes is <5% of that of PC (Buckland and Wilton, 2000
).
PKC
Is Activated by PA In Vitro
We also studied the ability of PKC
to phosphorylate a specific substrate in vitro under PtdOH-dependent conditions. For this, HEK293 cells were transfected with the same constructs as mentioned above, the only difference being that they were cloned in a vector, which enabled us to express them, fused to a hemagglutinin tag. After purification of the wild-type PKC
and the different mutants, we studied the PtdOH dependence of enzyme activation in the absence and in the presence of DAG (Figure 8A) by using histone III-S as a substrate. It is interesting to note that under the conditions used in these experiments, no basal specific activity was detected when the phospholipid vesicles contained 5 or 10 mol% DOG in the absence of POPA. Interestingly, Figure 8A also shows that it was necessary to include DAG in the lipid vesicles to observe a POPA-dependent activation, suggesting that at least in vitro both PtdOH and DAG interactions with PKC
are necessary for the full activation of the enzyme.
|
In addition, we studied the effect of the different substitutions of the amino acidic residues in loops 1 and 3 on the POPA-dependent activation of the enzyme (Figure 8B). As shown, the more drastic effect was once again observed by the mutations performed in loop 1, where 80 mol% of POPA in the lipid vesicles only produced 50% of the catalytic activity of the enzyme. However, the mutants containing the substitutions affecting loop 3 were activated almost identically to the wild-type protein.
Because the plasma membrane also contains phosphatidylserine constitutively, we included in the lipid mixture 20 mol% 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoserine (POPS), which is assumed to be a physiological concentration in the plasma membrane (McMurray, 1973
). Thus, the vesicles used to measure the specific activity of the wild-type PKC
contained POPC/POPS/DOG and increasing concentrations of POPA. As shown in Figure 8C, the POPA-dependent activity of the enzyme was similar both in the presence and in the absence of POPS in the phospholipid vesicles and no additive effect was observed, suggesting that POPA is a more specific activator than phosphatidylserine under these conditions.
PtdOH and DAG Exhibit Synergistic Effects on the Translocation of PKC
to the Plasma Membrane
Together, the results obtained in this work strongly suggest that both PtdOH and DAG generated in the plasma membrane upon activation of the IgE receptor in RBL-2H3 cells, are responsible for the localization of PKC
in the membrane and for its activation. To further test this hypothesis, we promoted the plasma membrane localization of PKC
by adding exogenous applications of low concentrations of PtdOH and DAG. Thus, when 2 µg/ml DiC8 was used to stimulate RBL-2H3 cells transfected with PKC
-GFP, no translocation of the enzyme was detected, only and small and localized amount of protein was observed in the plasma membrane 380 s after stimulation (Figure 9A). Similar results were obtained when the cells transfected with PKC
-GFP were stimulated with 0.5 µg/ml PtdOH (Figure 9B). However, when the cells were stimulated with the two agents together (2 µg/ml DiC8 + 0.5 µg/ml PtdOH), a partial PKC
-GFP localization was observed 60 s after stimulation (R = 0.48) that was increasing until R = 0.6 at 130 s and R = 0.78 at 380 s (Figure 9C). These results further support the hypothesis proposed previously where simultaneous production of PtdOH and DAG is essential for the PKC
localization in the plasma membrane upon activation of the IgE receptor.
|
| DISCUSSION |
|---|
|
|
|---|
might interact with acidic phospholipids through several amino acidic residues located at the top of the molecule (Ochoa et al., 2001
interacts with the plasma membrane under physiological conditions, demonstrating that the C2 domain of PKC
is an important and critical player in the biological membrane localization and activation of the enzyme.
Physiological and Molecular Mechanism for PKC
Membrane Targeting
Some of the most interesting aspects of PKC
localization to emerge from this study are the profiles obtained when the cells were transfected with the wild-type and the different mutant proteins and stimulated with antigen. These experiments demonstrate that the residues located in loops 1 and 3 of the C2 domain directly or indirectly participate in the localization of the enzyme in the plasma membrane. Furthermore, these results suggest that the diacylglycerol generated by receptor activation is not the only force anchoring the enzyme in the plasma membrane because the translocation profiles obtained when cells (transfected with wild-type and mutant enzymes) were stimulated only with permeable DiC8 did not correlate well with the profiles obtained after physiological stimulation of the Fc
RI (IgE receptor) (compare Figures 3B and 4B).
To get further insights into the pathways involved in the PKC
membrane localization, which is dependent on IgE receptor stimulation, we used a collection of specific inhibitors that block the different phospholipases activated and that, in turn, generate both PtdOH and DAG. The fact that the inhibition of PI-PLC or PLD led to the total inhibition of PKC
membrane localization and that the inhibition of DGK led only to a partial localization of the enzyme leads us to postulate the following sequence of events (Figure 10A): antigen cross-linking of the IgE receptor activates both PI-PLC and PLD and generates both DAG and PtdOH, respectively, which are essential for enzyme localization; these two second messengers produced might be further metabolized in a second step in which DAG is transformed into PtdOH by DGK and, the PtdOH generated by PLD is transformed into DAG by phosphatidate phosphohydrolase, thus maintaining the equilibrium of activators between DAG and PtdOH. This way of extent the existence of both activators in the plasma membrane acting on the same PKC
molecule would increase the time that the enzyme is localized in the plasma membrane and prolong enzyme activation, explaining the slow membrane dissociation exhibited by PKC
when the cells were activated with antigen (Figure 2B).
The partial inhibition of PKC
localization obtained after using DGK inhibitor II further supports the hypothesis that PtdOH generated by PLD together with the DAG generated by PI-PLC in a first step is essential for the membrane targeting. This is lent weight by the fact that both enzymes were activated and partial membrane targeting was observed. The partial inhibition also confirms the idea that DGK generates PtdOH, which is needed to fully localize the enzyme in the plasma membrane, although to a lesser extent than the PtdOH generated by PLD (Figure 10A). Few conclusions can be obtained from the use of propranolol except that the results reinforce the hypothesis that the lack of both PtdOH and DAG impedes the proper localization of the enzyme. This is due to the double action mechanism of propranolol because both the PtdOH and the phosphohydrolase are blocked by the drug (Koul and Hauser, 1987
).
Together, the cell localization and in vitro kinase assays performed in this study suggest a model for the physiological activation of PKC
, whereby the enzyme can anchor in the membrane either by means of the C2 domain or alternatively through the C1 domain if PtdOH or DiC8, respectively, are present at high concentrations. When PtdOH and DiC8 are present in the plasma membrane at very low concentrations, which seems to be the case under physiological conditions, both messengers need to act together and they can potentiate the effect of each other, leading to PKC
localization in the plasma membrane. Additionally, full activation of the catalytic activity of the enzyme is only reached when both activators are present in the plasma membrane and bound to the enzyme, thus conferring its active state conformation (Figure 10B).
It has been shown that PKC
can colocalize with PLD and DGK, suggesting an activating role in the case of PLD and an inhibitory effect in the case of DGK (Slaaby et al., 2000
; Powner et al., 2002
; Luo et al., 2003
). Nevertheless, there is no evidence of the colocalization of PLD, DGK, and PKC
to date. Taking into account that the spatio-temporal membrane localization of PKC
(1.5 min) is a slower process than for PKC
(226 s) (Bolsover et al., 2003
), these results would fit a sequential model whereby, after IgE receptor stimulation of RBL-2H3 cells, PKC
would translocate first to the plasma membrane, where it would activate PLD, which in turn would promote PKC
membrane localization and activation in a PtdOH-dependent manner. Unfortunately, the function of PKC
upon activation of the Fc
RI is still far from clear. Early evidence suggested that this enzyme activates the AP-1 transcription factor, leading to an increase in cell proliferation (Razin et al., 1994
; Chang et al., 1997
), but no direct correlation with degranulation has been found when RBL-2H3 cells are transfected with this isoenzyme (Chang et al., 1997
; our unpublished observations). The new findings presented in this work place PKC
in a new scenario, together with PLD and probably DGK as well. A recent publication has shown very nicely that a continuous source of PtdOH generated by PLD is essential for antigen-stimulated membrane ruffling in mast cells because it regulates phosphatidylinositol 4,5-bisphosphate synthesis (O'Luanaigh et al., 2002
), more specifically, by activating type I phosphatidylinositol 4-phosphate 5-kinase (PIP5) kinase, which can be stimulated indirectly by PtdOH derived from PLD activation (Honda et al., 1999
) or directly by ARF proteins (Jones et al., 2000a
). Whether PKC
is directly involved in this activation process is still unknown; however it might serve as a link between the PtdOH generated and some additional intermediate, which would lead to the activation of type I PIP5 kinase.
Recent reports have demonstrated two important functions for the PtdOH generated by PLD isoenzymes. One of these functions is the recruitment of cytosolic proteins to the membrane and the second is as a regulator in the activation of different proteins and lipid kinases (see Cockcroft, 2001
; Andresen et al., 2002
for extensive reviews). The direct interaction with cellular proteins and/or stimulation by PtdOH have been demonstrated in the cases of the protein kinase cRaf-1 (Ghosh et al., 1996
), type I PIP5 kinase (Jenkins et al., 1994
; Jones et al., 2000b
), the mammalian target of rapamycin (mTOR) (Fang et al., 2001
), cAMP-specific phosphodiesterase PDE4D3 (Grange et al., 2000
), tyrosine protein phosphatase SHP-1 (Frank et al., 1999
) and the p47phox subunit of phagocyte NADPH oxidase (Karathanassis et al., 2002
). The results obtained in this work suggest that PKC
can be included in this family as well.
In conclusion, this work defines a new role for the PtdOH generated by IgE receptor stimulation: the membrane localization and activation of PKC
. A new model for the enzyme's activation has been proposed, where, importantly, the C2 domain plays a key role in both localization and activation. Further studies to identify downstream targets of this specific PKC isoenzyme are under way and will hopefully be of great help in unveiling this complex puzzle.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Abbreviations used: DAG, diacylglycerol; DGK, diacylglycerol kinase; DiC8, 1,2-dioctanoylglycerol; DNP-HSA, dinitrophenyl-human serum albumin; PC-PLC, phosphatidylcholine-phospholipase C; PI-PLC, phosphoinosite-phospholipase C; PIP5, phosphatidylinositol 4-phosphate 5-kinase; PLD, phospholipase D; PtdOH, phosphatidic acid; POPA, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphate.
* Corresponding author. E-mail address: senena{at}um.es.
| REFERENCES |
|---|
|
|
|---|
Andresen, B.T., Rizzo, M.A., Shome, K., and Romero, G. (2002). The role of phosphatidic acid in the regulaton of the Ras/MEK/ERK signalling cascade. FEBS Lett. 531, 6568.[CrossRef][Medline]
Barker, S.A., Caldwell, K.K., Pfeiffer, J.R., and Wilson, B.S. (1998). Wortmannin-sensitive phosphorylation, translocation and activation of PLC
1 but not PLC
2, in antigen-stimulated RBL-2H3 mast cells. Mol. Biol. Cell 9, 483496.
Besson, A., Wilson, T.L., and Yong, V.W. (2002). The anchoring protein RACK1 links protein kinase C epsilon to integrin beta chains. J. Biol. Chem. 277, 2207322084.
Bleasdale, J.E., Thakur, N.R., Gremban, R.S., Bundy, G.L., Fitzpatrick, F.A., Smith, R.J., and Bunting, S. (1990). Selective inhibition of receptor-coupled phospholipase C-dependent processes in human platelets and polymorphonuclear neutrophils. J. Pharmacol. Exp. Ther. 255, 756768.
Bolsover, S., Gomez-Fernandez, J.C., and Corbalan-Garcia, S. (2003). Role of the Ca2+/phosphatidylserine binding region of the c2 domain in the translocation of protein kinaseC alpha to the plasma membrane. J. Biol. Chem. 278, 1028210290.
Bolsover, S., Ibrahim, O., O'Luanaigh, N., Williams, H., and Cockcroft, S. (2001). Biochem. J. 356, 345352.[CrossRef][Medline]
Brodie, C., Bogi, K., Acs, P., Lazarovici, P., Petrovics, G., Anderson, W.B., and blumberg, P.M. (1999). Protein kinase C-epsilon plays a role in neurite outgrowth in response to EGF and NGF in PC12 cells. Cell Growth Diff. 10, 183191.
Brown, F.D., Thompson, N., Saqib, K.M., clark, J.M., Powner, D.J., Thompson, N.T., Solari, R., and Wakelam, M.J.O. (1998). Phospholipase D1 localizes to secretory granules and lysosomes and is plasma membrane translocated on cellular stimulation. Curr. Biol. 8, 835838.[CrossRef][Medline]
Buckland, A.G., and Wilton, D.C. (2000). Anionic phospholipids, interfacial binding and the regulation of cell functions. Biochim. Biophys. Acta 1483, 199216.[Medline]
Chang, E-Y., Szallasi, Z., Acs, P., Raizada, V., wolfe, P.C., Fewtrell, C., Blumberg, P.M., and Rivera, J. (1997). Functional effects of overexpression of PKC alpha, beta, delta, epsilon and mu in the mast cell line RBL-2H3. J. Immunol. 159, 26242632.[Abstract]
Cissel, D.S., Fraundorfer, P.F., and Beaven, M.A. (1998). Thapsigargin-induced secretion is dependent on activation of a cholera toxin-sensitive and PI3-kinase regulated phospholipase D in a mast cell line. J. Pharmacol. Exp. Ther. 285, 110118.
Cockcroft, S. (2001). Signaling roles of mammalian phospholipase D1 and D2. Cell. Mol. Life. Sci. 58, 16741687.[CrossRef][Medline]
Csukai, M., Chen, C-H., De Matteis, M.A., and Mochly-Rosen, D. (1997). The coatomer protein beta'-COP, a selective binding protein (RACK) for protein kinase Cepsilon. J. Biol. Chem. 272, 2920029206.
de Chaffoy de Courcelles, D.C., Roevens, P., and Van Belle, H. (1985). R59022
[GenBank]
, a diacylglycerol kinase inhibitor. Its effect on diacylglycerol and thrombin-induced C kinase activation in the intact platelet. J. Biol. Chem. 260, 1576215770.
Djouder, N., Schmidt, G., Frings, M., Cavalie, A., Thelen, M., and Aktories, K. (2001). Rac, and phosphatidylinositol 3-kinase regulate the protein kinase B in FceRI signalling in RBL-2H3 mast cells. J. Immunol. 166, 16271634.
Fang, Y., Vilella-Bach, M., Bachmann, R., Flanigan, A., and Chen, J. (2001). Phosphatidic acid-mediated mitogenic activation of mTOR signalling. Science 294, 19421945.
Frank, C., Keilhack, H., Opitz, F., Zschornig, O., and Bohmer, F.D. (1999). Binding of phosphatidic acid to the protein-tyrosine phosphatase SHP-1 as a basis for activity modulation. Biochemistry 38, 1199312002.[CrossRef][Medline]
Garcia-Garcia, J., Gomez-Fernandez, J.C., and Corbalan-Garcia, S. (2001). Structural characterization of the C2 domain of novel protein kinase Cepsilon. Eur. J. Biochem. 268, 11071117.[Medline]
Ghosh, S., Strum, J.C., Sciorra, V.A., Daniel, L. and Bell, R.M. (1996). Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic acid. Phosphatidic acid regulates the translaction of Raf-1 in 12-O-tetradecanoylphorbol-13-acetate-stimulated Madin-Darby canine kidney cells. J. Biol. Chem. 271, 84728480.
Grange, M., Sette, C., Cuomo, M., Conti, M., Lagarde, M., Prigent, A.F., and Nemoz, G. (2000). The cAMP-specific phosphodiesterase PDE4D3 is regulated by phosphatidic acid binding. Consequences for cAMP signaling pathway and characterization of a phosphatidic acid binding site. J. Biol. Chem. 275, 3337933387.
Gruchalla, R.S., Dinh, T.T., and Kennerly, D.A. (1990). An indirect pathway of receptor-mediated 1,2-diacylglycerol formation in mast cells IgE receptor-mediated activation of phospholipase D. J. Immunol. 144, 23342342.[Abstract]
Honda, A., Nogami, M., Yokozeki, T., Yamazaki, M., Nakamura, H., and Watanabe, H. (1999). PIP 5 kinase alpha is a downstream effector of the small G protein ARF6 in membrane ruffle formation. Cell 99, 521532.[CrossRef][Medline]
Ivaska, J., Whelan, R.D.H., Watson, R., and Parker, P.J. (2002). PKCepsilon controls the traffic of
1-integrins in motile cells. EMBO J. 21, 36083619.[CrossRef][Medline]
Ivaska, J., Bosca, L., and Parker, P.J. (2003). PKCepsilon is a permissive link in integrin-dependent IFN-
signalling that facilitates JAK phosphorylation of STAT1. Nat. Cell Biol.
Jenkins, G.H., Fisette, P.L., and Anderson, R.A. (1994). Type I phosphatidylinositol 4-phosphate 5-kinase isoforms are specifically stimulated by phosphatidic acid. J. Biol. Chem. 269, 1154711554.
Jones, D.H., Morris, J.B., Morgan, C.P., Kondo, H., Irvine, R.F., and Cockcroft, S. (2000a). Type I PIP5 kinase directly interacts with ARF1 and is responsible for PIP2 synthesis in the Golgi compartment. J. Biol. Chem. 275, 1396213966.
Jones, D.R., Sanjuan, M.A., and Merida, I. (2000b). Type I alpha PIP5 kinase is a putative target for increased intracellular phosphatidic acid. FEBS Lett. 476, 160165.[CrossRef][Medline]
Karathanassis, D., Stahelin, R.V, Bravo, J., Perisic, O., Pacold, C.M., Cho, W., and Williams, R.L. (2002). Binding of the PX domain of p47(phox) to phosphatidylinositol 3, 4-bisphosphate and phosphatidic acid is masked by an intramolecular interaction. EMBO J. 21, 50575068.[CrossRef][Medline]
Koul, O., and Hauser, G. (1987). Modulation of rat brain cytosolic phosphatidate phosphohydrolase: effect of cationic amphiphilic drugs and divalents cations. Arch. Biochem. Biophys. 253, 453461.[CrossRef][Medline]
Lehel, C., Olah, Z., Mischack, H., Mushinski, J.F., and Anderson, W.B. (1994). Overexpressed protein kinase C-delta and -epsilon subtypes in NIH 3T3 cells exhibit differential subcellular localization and differential regulation of sodium-dependent phosphate uptake. J. Biol. Chem. 269, 47614766.
Liedtke, C.M., Yun, C.H.C., Kyle, N., and Wang, D. (2002). PKC epsilon-dependent regulation of cystic fibrosis transmembrane regulator involves binding to a receptor for RACK1 and RACK1 binding to Na+/H+ exchange regulatory factor. J. Biol. Chem. 277, 2292522933.
Luo, B., Prescott, S.M., and Topham, M.K. (2003). Association of DGKzeta with PKC alpha: spatial regulation of diacylglycerol signaling. J. Cell Biol. 160, 929937.
Millard, P.J., Ryan, T.A., Webb, W.W., and Fewtrell, C. (1989). Immunoglobulin E receptor cross-linking induces oscillations in intracellular free ionized calcium in individual tumor mast cells. J. Biol. Chem. 264, 1973019739.
McMurray, M. (1973). In: Form and Function of Phospholipids, ed. G.B. Ansell, J.N. Hawthorne, and R.M.C. Dawson, Amsterdam: Elsevier, 205211.
Medkova, M., and Cho, W. (1998). Mutagenesis of the C2 domain of protein kinase C
. J. Biol. Chem. 273, 1754417552.
Meyer, T., and Oancea, E. (2000). Studies of signal transduction events using chimeras to green fluorescent protein. Methods Enzymol. 327, 500513.[Medline]
Muller-Decker, K. (1989). Interruption of TPA-induced signals by an antiviral and antitumoral xanthate compound: inhibition of a phospholipase C-type reaction. Biochem. Biophys. Res. Commun. 162, 198205.[CrossRef][Medline]
Newton, A.C. (2001). Protein kinase C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular interactions. Chem. Rev. 101, 23532364.[CrossRef][Medline]
Oancea, E., and Meyer, T. (1998). Protein Kinase C as a molecular machine for decoding calcium and diacylglycerol signals. Cell 95, 307318.[CrossRef][Medline]
Ochoa, W.F., Garcia-Garcia, J., Fita, I., Corbalan-Garcia, S., Verdaguer, N., and Gomez-Fernandez, J.C. (2001). Structure of the C2 domain from novel protein kinase C
. A membrane binding model for Ca2+-independent C2 domains. J. Mol. Biol. 311, 837849.[CrossRef][Medline]
O'Luanaigh, N., Pardo, R., Fensome, A., Allen-Baume, V., Jones, D., Holt, M.R., and Cockcroft, S. (2002). Continual production of phosphatidic acid by phospholipase D is essential for antigen-stimulated membrane ruffling in cultured mast cells. Mol. Biol. Cell 13, 37303746.
Ozawa, K., Yamada, K., Kazanietz, M., Blumberg, P.M., and Beaven, M.A. (1993). Different isoenzymes of PKC mediate feedback inhibition of PLC and stimulatory signals for exocytosis in rat RBL-2H3 cells. J. Biol. Chem. 268, 22802283.
Park, D.J., Min, H.K., and Rhee, S.G. (1991). IgE-induced tyrosine phosphorylation of phospholipase C-gamma 1 in rat basophilic leukemia cells. J. Biol. Chem. 266, 2423724240.
Pfeffer, L.M., Eisenkraft, B.L., Reich, N.C., Improta, T., Baxter, G., Daniel, S., Issakani, S., and Strulovici, B. (1991). Transmembrane signaling by interferon alpha involves diacylglycerol production and activation of the epsilon isoform of protein kinase C in Daudi cells. Proc. Natl. Acad. Sci. USA 88, 79887992.
Powner, D.J., Hodgkin, M.N., and Wakelam, M.J. (2002). Antigen-stimulated activation of phospholipase D1b by Rac1, ARF6, and PKCalpha in RBL-2H3 cells. Mol. Biol. Cell 13, 12521262.
Razin, E., Szallasi, Z., Kazanietz, M.G., Blumberg, P.M., and Rivera, J. (1994). protein kinases C beta and epsilon link the mast cell high-affinity receptor for IgE to the expression of c-fos and c-jun. Proc. Natl. Acad. Sci. USA 91, 77227726.
Rebecchi, M., Peterson, A., and McLaughlin, S. (1992). Phosphoinositide-specific phospholipase C-delta 1 binds with high affinity to phospholipid vesicles containing phosphatidylinositol 4,5-bisphosphate. Biochemistry 31, 1274212747.[CrossRef][Medline]
Szallasi, Z., Bogi, K., Gohari, S., Biro, T., Acs, P., and Blumberg, P.M. (1996). Non-equivalent roles for the first and second zinc fingers of protein kinase Cdelta. Effect of their mutation on phorbol ester-induced translocation in NIH 3T3 cells. J. Biol. Chem. 271, 1829918301.
Schneider, H.A., Cohen-Dayang, A., and Pecht, I. (1992). Tyrosine phosphorylation of PLC
1 couples the Fc epsilon receptor mediated signal to mast cells secretion. Int. Immunol. 4, 447453.
Shirai, Y., Kashiwagi, K., Yagi, K., Sakai, N., and Saito, N. (1998). Distinct effects of fatty acids on translocation of
and
subspecies of PKC. J. Cell Biol. 143, 511521.
Slaaby, R., Du, G., Altshuller, Y.M., Frohman, M.A., and Seedorf, K. (2000). Insulin-induced phospholipase D1 and phospholipase D2 activity in human embryonic kidney-293 cells mediated by the phospholipase C gamma and protein kinase C alpha signalling cascade. Biochem. J. 351, 613619.
Tanaka, M., and Herr, W. (1990). Differential transcriptional activation by Oct-1 and Oct-2, interdependent activation domains induce Oct-2 phosphorylation. Cell 60, 375386.[CrossRef][Medline]
Wigler, M., Silverstein, S., Lee, L.S., Pellicer, A., Cheng, V.C., and Axel, R. (1977). Transfer of purified herpes virus thymidine kinase gene to cultured mouse cells. Cell 11, 223227.[CrossRef][Medline]
Zeidman, R., Lofgren, B., Pahlman, S., and Larsson, C. (1999). PKCepsilon, via its regulatory domain and independently of its catalytic domain, induces neurite-like processes in neuroblastoma cells. J. Cell Biol. 145, 713726.
This article has been cited by other articles:
![]() |
S.-y. Morita, K. Ueda, and S. Kitagawa Enzymatic measurement of phosphatidic acid in cultured cells J. Lipid Res., September 1, 2009; 50(9): 1945 - 1952. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lu and C. Benning A 25-Amino Acid Sequence of the Arabidopsis TGD2 Protein Is Sufficient for Specific Binding of Phosphatidic Acid J. Biol. Chem., June 26, 2009; 284(26): 17420 - 17427. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Steinberg Structural Basis of Protein Kinase C Isoform Function Physiol Rev, October 1, 2008; 88(4): 1341 - 1378. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Farah, I. Nagakura, D. Weatherill, X. Fan, and W. S. Sossin Physiological Role for Phosphatidic Acid in the Translocation of the Novel Protein Kinase C Apl II in Aplysia Neurons Mol. Cell. Biol., August 1, 2008; 28(15): 4719 - 4733. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Albert, C. Pergola, A. Koeberle, G. Dodt, D. Steinhilber, and O. Werz The role of diacylglyceride generation by phospholipase D and phosphatidic acid phosphatase in the activation of 5-lipoxygenase in polymorphonuclear leukocytes J. Leukoc. Biol., April 1, 2008; 83(4): 1019 - 1027. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Huang, H.-C. Cheng, R. Isom, C.-S. Chen, R. A. Levine, and B. U. Pauli Protein Kinase C{epsilon} Mediates Polymeric Fibronectin Assembly on the Surface of Blood-borne Rat Breast Cancer Cells to Promote Pulmonary Metastasis J. Biol. Chem., March 21, 2008; 283(12): 7616 - 7627. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Testerink, P. B. Larsen, D. van der Does, J. A. J. van Himbergen, and T. Munnik Phosphatidic acid binds to and inhibits the activity of Arabidopsis CTR1 J. Exp. Bot., November 13, 2007; (2007) erm243v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gomez-Cambronero, M. Di Fulvio, and K. Knapek Understanding phospholipase D (PLD) using leukocytes: PLD involvement in cell adhesion and chemotaxis J. Leukoc. Biol., August 1, 2007; 82(2): 272 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Gowri, S. Sengupta, S. Bertera, and B. S. Katzenellenbogen Lipin1 Regulation by Estrogen in Uterus and Liver: Implications for Diabetes and Fertility Endocrinology, August 1, 2007; 148(8): 3685 - 3693. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Sossin Isoform specificity of protein kinase Cs in synaptic plasticity Learn. Mem., April 2, 2007; 14(4): 236 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Mane, C. Vasquez-Robinet, A. A. Sioson, L. S. Heath, and R. Grene Early PLD{alpha}-mediated events in response to progressive drought stress in Arabidopsis: a transcriptome analysis J. Exp. Bot., January 1, 2007; 58(2): 241 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Cheeseman, T. Ueyama, T. M. Michaud, K. Kashiwagi, D. Wang, L. A. Flax, Y. Shirai, D. J. Loegering, N. Saito, and M. R. Lennartz Targeting of Protein Kinase C-{epsilon} during Fc{gamma} Receptor-dependent Phagocytosis Requires the {epsilon}C1B Domain and Phospholipase C-{gamma}1 Mol. Biol. Cell, February 1, 2006; 17(2): 799 - 813. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bacchiocchi, G. Baldanzi, D. Carbonari, C. Capomagi, E. Colombo, W. J. van Blitterswijk, A. Graziani, and F. Fazioli Activation of {alpha}-diacylglycerol kinase is critical for the mitogenic properties of anaplastic lymphoma kinase Blood, September 15, 2005; 106(6): 2175 - 2182. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Hucho, O. A. Dina, and J. D. Levine Epac Mediates a cAMP-to-PKC Signaling in Inflammatory Pain: An Isolectin B4(+) Neuron-Specific Mechanism J. Neurosci., June 29, 2005; 25(26): 6119 - 6126. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. V. Stahelin, M. A. Digman, M. Medkova, B. Ananthanarayanan, H. R. Melowic, J. D. Rafter, and W. Cho Diacylglycerol-induced Membrane Targeting and Activation of Protein Kinase C{epsilon}: MECHANISTIC DIFFERENCES BETWEEN PROTEIN KINASES C{delta} AND C{epsilon} J. Biol. Chem., May 20, 2005; 280(20): 19784 - 19793. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Avila-Flores, T. Santos, E. Rincon, and I. Merida Modulation of the Mammalian Target of Rapamycin Pathway by Diacylglycerol Kinase-produced Phosphatidic Acid J. Biol. Chem., March 18, 2005; 280(11): 10091 - 10099. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Komati, F. Naro, S. Mebarek, V. De Arcangelis, S. Adamo, M. Lagarde, A.-F. Prigent, and G. Nemoz Phospholipase D Is Involved in Myogenic Differentiation through Remodeling of Actin Cytoskeleton Mol. Biol. Cell, March 1, 2005; 16(3): 1232 - 1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Delon, M. Manifava, E. Wood, D. Thompson, S. Krugmann, S. Pyne, and N. T. Ktistakis Sphingosine Kinase 1 Is an Intracellular Effector of Phosphatidic Acid J. Biol. Chem., October 22, 2004; 279(43): 44763 - 44774. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||