![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 14, Issue 2, 516-528, February 2003


*Laboratory of Cell Biology, National Heart, Lung, and
Blood Institute, National Institutes of Health, Bethesda, Maryland
20892; and
Cell Biology and Metabolism Branch,
National Institute of Child Health and Human Development, National
Institutes of Health, Bethesda, Maryland 20892
| |
ABSTRACT |
|---|
|
|
|---|
We previously demonstrated, using fluorescence recovery after photobleaching, that clathrin in clathrin-coated pits at the plasma membrane exchanges with free clathrin in the cytosol, suggesting that clathrin-coated pits are dynamic structures. We now investigated whether clathrin at the trans-Golgi network as well as the clathrin adaptors AP2 and AP1 in clathrin-coated pits at the plasma membrane and trans-Golgi network, respectively, also exchange with free proteins in the cytosol. We found that when the budding of clathrin-coated vesicle is blocked without significantly affecting the structure of clathrin-coated pits, both clathrin and AP2 at the plasma membrane and clathrin and AP1 at the trans-Golgi network exchange rapidly with free proteins in the cytosol. In contrast, when budding of clathrin-coated vesicles was blocked at the plasma membrane or trans-Golgi network by hypertonic sucrose or K+ depletion, conditions that markedly affect the structure of clathrin-coated pits, clathrin exchange was blocked but AP2 at the plasma membrane and both AP1 and the GGA1 adaptor at the trans-Golgi network continue to rapidly exchange. We conclude that clathrin-coated pits are dynamic structures with rapid exchange of both clathrin and adaptors and that adaptors are able to exchange independently of clathrin when clathrin exchange is blocked.
| |
INTRODUCTION |
|---|
|
|
|---|
Clathrin-mediated endocytosis at the plasma membrane is thought to
be initiated by binding of the clathrin adaptor AP2 to various plasma
membrane receptors and possibly synaptotagmin as well. AP2 is thought
to then recruit clathrin to the nascent clathrin-coated pits followed
by invagination of the clathrin-coated pits to form clathrin-coated
vesicles. The budding of clathrin-coated vesicles also involves other
proteins such as dynamin, amphiphysin, epsin, eps15, endophilin, and
synaptojanin but, in most cases, the exact functions of these proteins
remain speculative (Brodin et al., 2000
; Marsh and McMahon,
1999
). In addition, dephosphorylation of AP2 (Wilde and Brodsky, 1996
)
and several of these other proteins apparently plays an important role
in formation of the clathrin-coated pit as does interaction of AP2 and
several of these other proteins with the phospholipid
phosphatidylinositol-4,5-bisphosphate (PIP2) on the membrane
(Beck and Keen, 1991
; Voglmaier et al., 1992
). In addition
to budding of clathrin-coated vesicles at the plasma membrane,
clathrin-coated vesicles also bud from the trans-Golgi network (TGN), transporting enzymes complexed with the
mannose-6-phosphate receptor to late endosomes and thence to lysosomes.
Clathrin coat formation at the TGN is initiated by the binding of
ARF1-GTP, which in turn recruits the clathrin adaptors AP1 and GGA
(Robinson and Bonifacino, 2001
). Although dynamin isozymes are involved in scission and perhaps signaling at both the plasma membrane and the
TGN, relatively little is known about the other proteins involved in
budding of clathrin-coated vesicles from the TGN (McNiven et
al., 2000
; Danino and Hinshaw, 2001
).
Despite differences in the proteins involved in the budding of
clathrin-coated vesicles from the plasma membrane and the TGN, it is
clear that in both cases as the curvature of the membrane increases the
polymerized clathrin must be transformed from a planar hexagonal array
into a curved mixture of hexagons and pentagons. One way this process
could occur is through addition of clathrin at the edges of a growing
clathrin-coated pit so that pentagons are formed de novo from newly
attached clathrin triskelions (Kirchhausen, 2000
). Alternatively,
hexagons may be transformed into pentagons through the exchange of
bound and free clathrin triskelions as the curvature of the planar
clathrin-coated pit increases (Wu et al., 2001
).
We recently demonstrated, using fluorescence recovery after
photobleaching (FRAP), that clathrin exchange occurs during
clathrin-mediated endocytosis at the plasma membrane (Wu et
al., 2001
). Furthermore, there was little effect on the rate of
replacement of the bleached clathrin when endocytosis was blocked by
cholesterol depletion, expression of the dynamin mutant K44A, or a
decrease in temperature. On the other hand, we found that treatment of
the cells by hypertonic sucrose or K+ depletion,
conditions that have been shown to affect profoundly the structure of
the pits, not only blocked clathrin-mediated endocytosis but also
completely blocked clathrin exchange. In addition, ATP depletion also
blocked clathrin exchange. We concluded that ATP-dependent clathrin
exchange is a fundamental property of intact clathrin-coated pits at
the plasma membrane, a property that may be involved in the
transformation of clathrin structure that occurs as clathrin-coated
pits invaginate. In this regard, it is interesting that, in addition to
clathrin exchange at the plasma membrane, both ARF1 and COPI bound to
the membranes of the Golgi apparatus have been shown to exchange with
cytosolic ARF1 and COPI, respectively (Presley et al.,
2002
).
In the present study, we extended our investigation into the exchange of clathrin coats, addressing several questions raised by the results we obtained in our initial study. First, we asked whether exchange of clathrin occurs at the TGN where clathrin budding is initiated by a different mechanism than occurs at the plasma membrane and, if so, whether this exchange is affected by the same agents that affect clathrin exchange and clathrin-mediated endocytosis at the plasma membrane. Second, we asked whether the major clathrin adaptors, AP2 at the plasma membrane and AP1 at the TGN, also exchange and, if so, whether their exchange is linked to clathrin exchange. Our results show that, when clathrin-mediated endocytosis is blocked under conditions where clathrin-coated pits remain intact, AP2 at the plasma membrane exchanges at about the same rate as clathrin. Likewise, both clathrin and AP1 bound to the TGN exchange at the same rate when vesicle budding is blocked by decreasing the temperature to 20°C. However, although clathrin exchange is blocked at the TGN as well as at the plasma membrane by K+ depletion or treatment of the cells by hypertonic sucrose, AP2 and AP1 exchange continue to occur under these conditions, although at slightly decreased rates. Likewise, GGA1 localized at the TGN continues to exchange when clathrin exchange is blocked. We conclude that not only can exchange of clathrin adaptors occur at the same rate as clathrin exchange but it can also occur independently of clathrin exchange in vivo.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
2-(N-Morpholino)ethanesulfonic acid, HEPES,
deoxyglucose, imidazole, tetracycline, brefeldin A,
methyl-
-cyclodextrin, oubain, and anti-AP1 monoclonal antibody (mAb)
(100/3) were from Sigma-Aldrich (St. Louis, MO). Anti-clathrin mAb
(X22) and anti-AP2 mAb (AP.6) were from Affinity Bioreagents (Golden,
CO). Secondary antibodies and cy5-transferrin were from Jackson
Immunoresearch Laboratories (West Grove, PA). All media and supplements
were obtained from Biofluids (Rockville, MD). Fugene6 was from Roche
Diagnostics (Indianapolis, IN).
DNA Constructs
Green fluorescent protein (GFP)-clathrin light chain and
GFP-GGA1 were cloned as described previously (Puertollano et
al., 2001
; Wu et al., 2001
). GFP-AP2 was imaged using
the rat AP2
chain (X53773) with a GFP attached at its
NH2 terminus. The rat AP2
chain (X53773) in
pACT2 was subcloned into pEGFP-N1 (BD Biosciences Clontech, Palo Alto,
CA) by using the polymerase chain reaction (PCR) primers
CTCGAGATGCCGGCGTATCCAAGGGGGAG and GGATCCCGGAACTGTTCCGACAGCAATTC. The
PCR fragment was first cloned into XhoI and BamHI
sites of pEGFP-N1 and then replaced with cDNA fragment via
SacI and Acl I sites. DNA sequencing confirmed the correct
sequences cloned in the pEGFP-N1. The GFP-AP1 was derived from the
mouse cDNA AP1
-adaptin (NM 009677) in pACT2. The PCR primers used
were CGAATTCTGATGCCAGCCCCCATCAGATTG and
GGATCCCGTTGCCAGGACTGAGGGGGGAAATTG. The PCR fragment was cloned into a
TA vector first and then replaced with cDNA fragment via Age I and
StuI sites. After DNA sequencing confirmed the correct sequences was cloned, the EcoRI/BamHI fragment
was then cloned into pEGFP-C3 vector.
Cell Culture and Transfection
HeLa cells were maintained in DMEM supplemented with 10% fetal
bovine serum, 2 mM glutamine, penicillin (100 unit/ml), and streptomycin (100 unit/ml) in a humidified incubator with 5%
CO2 at 37°C. HeLa cells stably expressing
mutant (K44A) dynamin were grown under control of a tetracycline
promoter and induced by removal of tetracycline (Damke et
al., 1995
). Cells were transfected with the GFP-constructs with
Fugene6. Hypertonic treatment was performed by incubating the cells in
0.2 M sucrose for 45 min at 37°C. K+ depletion
was performed by hypotonic swelling of the cells in 50% diluted DMEM
containing 1 mM oubain and then incubating the cells in ice-cold
K+-free medium (100 mM NaCl, 50 mM HEPES, 1 mM
MgCl2, 0.1 mM CaCl2, 10 mM
glucose at pH 7.3) for 20 min (Lukacs et al., 1997
).
Cholesterol was depleted by incubating the cells in 10 mM
methyl-
-cyclodextrin for 30 min at 37°C (Rodal et al.,
1999
; Subtil et al., 1999
).
Confocal Microscopy
Cells were grown in chamber slides and imaged using a confocal
microscope (Carl Zeiss, Thornwood, NY) as described previously. All FRAP experiments were done using a 40×, 1.4 numerical
aperture objective, whereas a 63×, 1.4 numerical aperture objective
was used to examine the plasma membrane at higher magnification. GFP- and CFP-constructs were imaged and photobleached using 488- and 413-nm
laser, respectively. When GFP- and CFP-constructs were simultaneously
imaged, the configuration was designed and tested to ensure there was
no spill over of the CFP-fluorescence into the GFP-channel. A defined
region was photobleached at a high laser power to reduce the
fluorescence intensity by 50 to 80%. The recovery of fluorescence was
monitored by scanning the whole cell at low laser power. Temperature
was regulated at 37°C using a heating fan and a precision thermometer
(YSI, Yellow Springs, OH) to check the temperature and at 15 or 20°C
by using a Micro Devices microincubator (20/20 Technology, Wilmington,
NC). Data were analyzed as described previously (Wu et
al., 2001
).
| |
RESULTS |
|---|
|
|
|---|
We began our study by investigating whether fluorescently tagged
AP2 colocalizes with clathrin in clathrin-coated pits on the plasma
membrane of HeLa cells. We constructed and transfected HeLa cells with
a plasmid encoding the rat AP2
chain with GFP attached at its amino
terminus. Immunofluorescence studies using both anti-clathrin and
anti-AP2 antibodies showed that most of the GFP-AP2 colocalized with
the clathrin-coated pits. We also found that expression of GFP-AP2 had
no effect on transferrin uptake, suggesting that labeling the
chain
of AP2 with GFP did not affect the function of the AP2 (our unpublished
data). Figure 1, A-C, shows that,
as expected, essentially all of the GFP-AP2 colocalizes with cyan
fluorescent protein (CFP)-clathrin. Many of the GFP-AP2 pits at the
cell periphery were ~0.3 µm or smaller in diameter, about the same
size we obtained for the pits with CFP-clathrin (Wu et al.,
2001
). However, whether we used CFP-clathrin or GFP-AP2 to visualize
the pits, the cells always had areas where pits were clustered (Figure
1, arrow); these areas may represent hot spots of pit formation
(Gaidarov et al., 1999
).
|
We next determined whether the fluorescence of GFP-AP2 in
clathrin-coated pits recovered after photobleaching. Figure
2, A-C, shows that after photobleaching
a small region of the plasma membrane of control cells at 37°C there
was an immediate decrease in the fluorescence of GFP-AP2 followed by
nearly full fluorescence after 2 min. Of course, because
clathrin-mediated endocytosis was occurring in these cells, the
fluorescence recovery was at least partly due to old pits invaginating
and new pits forming. Although it seems that the new pits reformed at
the same position as the old pits (Figure 2C), this is because to avoid
damage in the FRAP studies we used a 40× objective rather than a 63×
objective so that clusters of pits tended to be brighter than
individual pits. This was much less of problem when we imaged
GFP-clathrin because the individual pits were brighter than with
GFP-AP2. When we used a 63× objective to follow the fluorescence of
GFP-AP2 it was clear that old pits disappeared and new pits formed
because there was little overlap of fluorescent pits over a period of 1 min (our unpublished data).
|
To determine whether replacement of AP2 occurred in clathrin-coated
pits even when endocytosis was blocked we carried out FRAP
experiments on GFP-AP2 in cells either depleted of cholesterol or
expressing the dynamin mutant K44A, treatments that block endocytosis but do not significantly affect the structure of clathrin-coated pits
(Damke et al., 1994
; Rodal et al., 1999
; Subtil
et al., 1999
). We found that with both treatments, GFP-AP2
fluorescence recovered after photobleaching (Figure 2, D-I). Thus, as
occurred with clathrin, even though endocytosis is blocked the bleached
GFP-AP2 in the pits is replaced by unbleached GFP-AP2.
Figure 3 shows the time course of
recovery of GFP-AP2 fluorescence after photobleaching both in control
cells and in cells expressing K44A dynamin or depleted of cholesterol
to block endocytosis. As summarized in Table
1, our data show that blocking
clathrin-mediated endocytosis had little effect on the rate or extent
of fluorescence recovery, demonstrating that GFP-AP2 exchange occurs at
a rapid rate even when clathrin-mediated endocytosis is blocked.
Another method of blocking clathrin-mediated endocytosis is to decrease the temperature to 15°C, which we previously found greatly reduced the rate of transferrin uptake so that over a period of 5 min almost no
uptake occurred (Wu et al., 2001
). Over the same period of
time almost complete recovery of AP2 fluorescence occurred (Table 1),
and the time course of this recovery in all cases was essentially the
same as that previously found for clathrin at the plasma membrane (Wu
et al., 2001
). Therefore, consistent with our previous
observations (Wu et al., 2001
), rapid replacement of
bleached GFP-AP2 occurs in clathrin-coated pits even when
clathrin-mediated endocytosis is blocked.
|
|
Our data with AP2 at the plasma membrane show that clathrin-coated pits
are dynamic structures in which both clathrin and AP2 rapidly exchange
during clathrin-mediated endocytosis. However, clathrin and adaptors
are present not only in clathrin-coated pits at the plasma membrane but
also at the TGN where AP1 is a major clathrin adaptor. Because we were
interested in examining the fluorescence recovery during clathrin
budding at the TGN of AP1 we constructed a GFP-AP1. Immunofluorescence
studies using antibodies showed that the GFP-AP1 colocalized with AP1
and clathrin at the TGN. We also found that, after treatment with
brefeldin A, GFP-AP1 dissociated from the TGN with the same time course as native AP1 (our unpublished data), suggesting that labeling the
chain of AP1 with GFP does not affect AP1 function. AP1 has
also been labeled with YFP on its µ1A chain to study vesicle movement
form the TGN (Huang et al., 2001
). Figure
4, A-F, shows the colocalization of
GFP-AP1 and CFP-clathrin at the TGN as well as their recovery after
photobleaching at 37°C. It should be noted that although much of the
perinuclear clathrin and AP1 is undoubtedly present in the TGN, some
may also be present in endosome, which we cannot distinguish from the
TGN in the 2-min period of these studies. As expected, in control
cells, after bleaching of both CFP-clathrin and GFP-AP1, essentially
complete replacement of the bleached clathrin and AP1 occurred at
37°C. Because CFP-constructs cause more UV damage to proteins upon
photobleaching than GFP, this result was confirmed using GFP-clathrin,
and we found that, as with CFP-clathrin, after photobleaching the
fluorescence of the GFP-clathrin at the TGN recovered over a short
period of time (Table 1).
|
We next determined whether this same recovery of fluorescence occurs at
20°C, a temperature that blocks transport from the TGN (Griffiths
et al., 1985
). As shown in Figure 4, G-L, the fluorescence of both the bleached CFP-clathrin and the bleached GFP-AP1 recovered over a period of 5 min, demonstrating that replacement of both AP1 and
clathrin occur at the TGN under conditions where clathrin budding is
prevented. Figure 5 and Table 1 show the
time course of the fluorescence recovery of GFP-clathrin and GFP-AP1 at
the TGN both at 37 and 20°C. At both temperatures, particularly at 20°C, the time course of recovery of GFP-AP1 is faster than that of
GFP-clathrin. Perhaps because the GFP-clathrin on the TGN was unusually
sensitive to damage by photobleaching at 20°C, we observed only
~55% recovery of the GFP-clathrin fluorescence after photobleaching at 20°C but fluorescence loss in photobleaching experiments confirmed that all of the bound clathrin was freely exchangeable at this temperature (our unpublished data). We conclude that replacement of
clathrin and adaptors during budding of clathrin-coated pits is a
general phenomenon that occurs at both the plasma membrane and the TGN.
Of course, although we could observe individual clathrin-coated pits at
the plasma membrane and, therefore, conclude that replacement was due
to clathrin exchange (Wu et al., 2001
), at the TGN we could
not observe individual pits and therefore this replacement could have
been caused by either exchange or dissolution and replacement of whole
clathrin-coated pits.
|
The observation that at 20°C AP1 exchange is somewhat faster than
clathrin exchange at the TGN suggests that adaptor exchange may not
always be linked with clathrin exchange. Another way of approaching
this question is to treat the cells with hypertonic sucrose or by
K+ depletion. Although cholesterol depletion and
expression of K44A block endocytosis without significantly affecting
the structure of the clathrin-coated pits, hypertonic sucrose and
K+ depletion also block endocytosis but they do
so by altering the structure of the clathrin-coated pits. It has been
reported that both hypertonic sucrose and K+
depletion reduce the number of clathrin-coated pits at the plasma membrane and at the same time induce the formation of clathrin microcages near the remaining clathrin latices on the plasma membrane (Heuser and Anderson, 1989
). Hansen et al. (1993)
, however,
using ultrastructural immunogold microscopy, did not detect either
clathrin on the plasma membrane or clathrin microcages in HEp-2 cells
in hypertonic sucrose and K+ depletion. In our
previous study on clathrin exchange, we found that both hypertonic
sucrose and K+ depletion not only blocked
endocytosis but also almost completely blocked clathrin exchange at the
plasma membrane. Therefore, we were interested in determining whether
AP2 exchange was also blocked by these treatments.
As we showed previously, these treatments caused a marked alteration in
clathrin distribution (Figure 6, A and
B). Both treatments tended to cause formation of clusters of clathrin
structures some of which were not colocalized with AP2 (arrows) and
therefore may represent the the clathrin microcages observed by
freeze-fracture electron microscopy. In addition, based on MetaMorph
(Universal Imaging, Downingtown, PA) analysis we found that ~50% of
the AP2 colocalized with both clusters of clathrin structures and with smaller clathrin fluorescent spots. Therefore, these structures may
represent clusters of clathrin-coated pits and individual clathrin-coated pits, respectively. In support of this view, electron microscopy of the treated samples indeed showed that there were clathrin-coated pits present after treatment with either hypertonic sucrose or K+ depletion (our unpublished
data). Finally we observed AP2 structures devoid of clathrin
similar to the structures that were observed by Brown et
al., 1999
. Therefore, although clathrin microbaskets without AP2 and AP2 pits without clathrin are present, considerable clathrin-coated pits also occur in the treated samples.
|
This allowed us to test whether, after treatment of the cells to
hypertonic sucrose or K+ depletion, clathrin and
AP2 exchange occurred in the fluorescent structures on the plasma
membrane that contained both clathrin and AP2. Table 1 shows that, in
contrast to the previous results we obtained in which clathrin exchange
was completely blocked (Wu et al., 2001
), more than
90% of the GFP-AP2 fluorescence recovered after photobleaching, and
this AP2 exchange occurred at essentially the same rate as occurs in
untreated cells. Furthermore, we found that this AP2 exchange
specifically occurred in structures where AP2 and clathrin were
colocalized (Figure 7). Because our
fluorescence studies do not reveal whether AP2 is present in any of the
clathrin microcages, we obviously cannot determine whether AP2 exchange occurs in the microcages. However, because all of the clathrin we
observe on the plasma membrane shows no exchange, whereas 90% of the
AP2 we observe does show exchange, including the AP2 colocalized with
clathrin, it seems that AP2 is exchanging in clathrin-coated pits on
the plasma membrane where clathrin exchange is blocked.
|
We next investigated how hypertonic sucrose and
K+ depletion affect clathrin and AP1 dynamics at
the TGN. Hypertonic sucrose and K+ depletion were
previously found to markedly decrease the number of clathrin buds at
the TGN as well as at the plasma membrane in HEp-2 cells (Hansen
et al., 1993
). However, we observed no significant decrease
in fluorescence of the GFP clathrin on the plasma membrane and TGN in
HeLa cells after treatment with hypertonic sucrose or
K+ depletion. Furthermore, we found that recovery
of clathrin fluorescence at the TGN was completely blocked by both
K+ depletion and hypertonic sucrose just as we
observed at the plasma membrane (Figures
8B and 9, A-C and G-I). In addition, like AP2 at the plasma membrane, AP1 at
the TGN showed significant fluorescence recovery (Figures 8B and 9,
D-F and J-L), although the rate of AP1 fluorescence recovery was
slightly slower than in control cells (Table 1). Therefore, AP1 bound
to the TGN is in equilibrium with free AP1 in the cytosol even when
clathrin is immobilized on the TGN by treatment with hypertonic sucrose
or K+ depletion.
|
|
Fluorescence recovery after photobleaching of GFP-GGA1, a recently
discovered AP (Dell'Angelica et al., 2000; Hirst
et al., 2000
; Costaguta et al.,
2001
) at the TGN, also occurred at about the same rate as
clathrin (Figure 10; Table 1).
Furthermore in HeLa cells depleted of K+ or
treated with hypertonic sucrose, after photobleaching GFP-GGA1 showed
~70% fluorescence recovery at a rate slightly slower than the rate
of GFP-AP1 fluorescence recovery under the same conditions (Figure 10;
Table 1). Therefore, when clathrin exchange at the TGN is blocked by
treatment with hypertonic sucrose or K+
depletion, like AP1, GGA1 is still able to detach from and reattach to
the TGN. It should be noted that treatment of the TGN with hypertonic
sucrose or K+ depletion caused fragmentation (our
unpublished data). Nevertheless, even after fragmentation
occurred, clathrin exchange was still blocked while both AP1 and GGA1
continued to exchange.
|
| |
DISCUSSION |
|---|
|
|
|---|
In a previous study, we showed that clathrin in clathrin-coated
pits on the plasma membrane exchanges with free clathrin in the cytosol
both during clathrin-mediated endocytosis and when clathrin-mediated
endocytosis is blocked by cholesterol depletion or expression of a
dynamin mutant (Wu et al., 2001
). On the basis of these
data, we suggested that clathrin exchange may be a fundamental characteristic of the budding of clathrin-coated vesicles, perhaps involved in the structural change that occurs in the clathrin lattice
as clathrin-coated pits invaginate. Clathrin-coated vesicles not only
bud from the plasma membrane but also from the TGN where the initiation
of budding occurs by a very different mechanism requiring ARF1. In the
present study, we found that both at 37°C where clathrin budding
takes place and at 20°C where it is blocked, clathrin exchange also
occurs at the TGN and, furthermore, at nearly the same rate as at the
plasma membrane, supporting our view that clathrin exchange is a
fundamental property of the budding of clathrin-coated vesicles.
Previous experiments (Greener et al., 2001
) suggested
that auxilin is required in Caenorhabditis elegans, for both
clathrin-mediated endocytosis and exchange of clathrin on existing
clathrin-coated pits. We, therefore, proposed that Hsc70 and auxilin
may be involved in both the irreversible dissociation of clathrin that
occurs after clathrin-coated vesicles bud off from the plasma membrane and in the clathrin exchange that occurs during clathrin-mediated endocytosis. At the same time, PIP2 binds directly to AP2 (Beck and
Keen, 1991
; Voglmaier et al., 1992
), and there is evidence that the level of PIP2 on the plasma membrane, affected in part by the
PIP2 phosphatase synaptojanin, controls whether clathrin-coated vesicles are uncoated after they pinch off from the plasma membrane (Cremona et al., 1999
; Gad et al., 2000
;
Stenmark, 2000
). Therefore, it was not clear whether clathrin, which
binds to the
chain of AP2, and AP2 would show similar exchange
properties or exchange at different rates.
Our results clearly show that photobleached AP2 was replaced at
about the same rate as photobleached clathrin when clathrin budding
from the plasma membrane was blocked by agents that did not affect the
structure of the clathrin-coated pits. This is an intriguing finding
given the recent determination of the core structure of AP2 that
indicated AP2 undergoes a large-scale conformational change upon
binding cargo (Collins et al., 2002
). We also found that
when clathrin-coated vesicle budding was blocked at the TGN by reducing
the temperature to 20°C, AP1 exchanged at a two- to threefold faster
rate than clathrin exchanged. Therefore, we conclude that
clathrin-coated pits are not only dynamic structures in regard to
clathrin but also in regard to the two major clathrin adaptors AP2 and
AP1. Furthermore, at the TGN, the rates of AP1 and clathrin exchange
seem to be at least partially uncoupled, which we also observed using
fluorescence loss in photobleaching (our unpublished data).
Treatment of cells with hypertonic sucrose or
K+ depletion supported this observation. We (Wu
et al., 2001
) previously found that both hypertonic sucrose
and K+ depletion blocked clathrin exchange. Both
of these treatments are thought to act in part by removing clathrin
from clathrin-coated pits to form clathrin microcages (Heuser and
Anderson, 1989
). We, therefore, suggested that because clathrin-coated
vesicles and clathrin baskets show no clathrin exchange in vitro,
clathrin-microcages in vivo would likewise show no clathrin exchange.
In the present study, although hypertonic sucrose and
K+ depletion blocked clathrin exchange at both
the plasma membrane and the TGN, AP2, AP1 and GGA1 continued to
exchange at almost the same rate as in untreated cells. Furthermore,
closer examination of the effect of hypertonic sucrose and
K+ depletion suggested that, although some
clathrin no longer colocalizes with AP2, there was still a considerable
amount of colocalization of clathrin and AP2 at the plasma membrane in
what seemed to be clathrin-coated pits. In confirmation of this view,
electron microscopy studies showed that clathrin-coated pits still
occurred on the plasma membrane of HeLa cells after treatment with
hypertonic sucrose and K+ depletion. Heuser and
Anderson (1989)
likewise saw clathrin-coated pits in fibroblasts under
these conditions, but they were not observed in HEp-2 cells (Hansen
et al., 1993
). Therefore, our data suggest that even though
clathrin that remains in clathrin-coated pits after hypertonic sucrose
and K+ depletion no longer exchanges, AP2 in
these pits does exchange. This is rather surprising because global
treatments such as hypertonic sucrose and K+
depletion might be expected to have global effects in which case there
may be an alteration of the PIP2 level on the membrane and the
phosphorylation level of the AP2 both of which are thought to affect
the binding strength of AP2 to the clathrin-coated pits (Wilde and
Brodsky, 1996
; Jost et al., 1998
). Yet neither of these treatments significantly affected the rate of AP2 exchange.
Furthermore, AP2 is such a large molecule that immobilization of the
clathrin lattice by hypertonic sucrose and K+
depletion might be expected to inhibit AP2 exchange sterically. Yet, it
is clear from out data that adaptor exchange is not directly linked to
clathrin exchange.
On the other hand, it seems unlikely that adaptor exchange and
clathrin exchange are completely independent because in control cells
the rates of AP2 and clathrin exchange at the plasma membrane are
almost identical and there is only a twofold difference in the rates of
AP1 and clathrin exchange at the TGN. Also, PIP2 has been shown to
affect the rate at which clathrin dissociates from clathrin-coated
vesicles at the plasma membrane and, because AP2 directly interacts
with PIP2 and clathrin does not, it seems likely that PIP2 indirectly
affects the rate of clathrin dissociation through its effect on AP2
dissociation. Therefore, we favor a model in which clathrin exchange is
linked to adaptor exchange, which, in turn, is linked to the PIP2
level. Furthermore, we think it likely that, rather than clathrin
passively dissociating when adaptors dissociate, Hsc70 and auxilin are
required to unravel individual clathrin molecules from the intricate
clathrin lattice present in clathrin-coated pits (Wu et al.,
2001
).
Further evidence that Hsc70 may be involved in this process comes
from the data of Schmid and colleagues (Hannan et al., 1998
) who showed that Hsc70 is not only required for dissociation of clathrin
from clathrin-coated vesicles in vitro but also, in an ATP-dependent
process, is involved along with another cofactor in AP2 dissociation.
Hsc70 may also be involved in dissociation of clathrin from
clathrin-coated pits at the TGN. ARF1-GFP recruits AP1 to the TGN but
Kornfeld and coworkers (Zhu et al., 1998
), using a
reconstituted assay, showed that after the membrane is primed by ARF1
to bind AP1, the ARF1 dissociates, leaving AP1 and clathrin bound to
the membrane. Therefore, factors other than ARF1 could be involved in
dissociation of clathrin and AP1 from clathrin-coated vesicles produced
at the TGN, raising the possibility that Hsc70 may be involved in
uncoating at the TGN as well as at the plasma membrane. Clearly, much
more work will be required to understand the coordinated control of
adaptor and clathrin dissociation at both the TGN and the plasma membrane.
| |
ACKNOWLEDGMENTS |
|---|
We thank Myoung-Soon Cho for preparing the electron micrographs of the HeLa cells under different conditions, Dr. James Keen for informing us before publication how to prepare GFP-AP2, and Samir Bhasin for assistance in analysis of the FRAP data.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
greenel{at}helix.nih.gov.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-06-0353. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-06-0353.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D.-w. Lee, X. Zhao, Y.-I. Yim, E. Eisenberg, and L. E. Greene Essential Role of Cyclin-G-associated Kinase (Auxilin-2) in Developing and Mature Mice Mol. Biol. Cell, July 1, 2008; 19(7): 2766 - 2776. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Braun, C. Deschamps, G. Raposo, P. Benaroch, A. Benmerah, P. Chavrier, and F. Niedergang AP-1 and ARF1 Control Endosomal Dynamics at Sites of FcR mediated Phagocytosis Mol. Biol. Cell, December 1, 2007; 18(12): 4921 - 4931. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Mardones, P. V. Burgos, D. A. Brooks, E. Parkinson-Lawrence, R. Mattera, and J. S. Bonifacino The Trans-Golgi Network Accessory Protein p56 Promotes Long-Range Movement of GGA/Clathrin-containing Transport Carriers and Lysosomal Enzyme Sorting Mol. Biol. Cell, September 1, 2007; 18(9): 3486 - 3501. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Z. Rappoport, S. Kemal, A. Benmerah, and S. M. Simon Dynamics of clathrin and adaptor proteins during endocytosis Am J Physiol Cell Physiol, November 1, 2006; 291(5): C1072 - C1081. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Keyel, S. K. Mishra, R. Roth, J. E. Heuser, S. C. Watkins, and L. M. Traub A Single Common Portal for Clathrin-mediated Endocytosis of Distinct Cargo Governed by Cargo-selective Adaptors Mol. Biol. Cell, October 1, 2006; 17(10): 4300 - 4317. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-w. Lee, X. Wu, E. Eisenberg, and L. E. Greene Recruitment dynamics of GAK and auxilin to clathrin-coated pits during endocytosis J. Cell Sci., September 1, 2006; 119(17): 3502 - 3512. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hinrichsen, A. Meyerholz, S. Groos, and E. J. Ungewickell Bending a membrane: How clathrin affects budding PNAS, June 6, 2006; 103(23): 8715 - 8720. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shah, K. Patel, S. Mukhopadhyay, F. Xu, G. Guo, and P. B. Sehgal Membrane-associated STAT3 and PY-STAT3 in the Cytoplasm J. Biol. Chem., March 17, 2006; 281(11): 7302 - 7308. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Leon-Sicairos, M. Reyes-Lopez, A. Canizalez-Roman, R. M. Bermudez-Cruz, J. Serrano-Luna, R. Arroyo, and M. de la Garza Human hololactoferrin: endocytosis and use as an iron source by the parasite Entamoeba histolytica Microbiology, December 1, 2005; 151(12): 3859 - 3871. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-w. Lee, X. Zhao, F. Zhang, E. Eisenberg, and L. E. Greene Depletion of GAK/auxilin 2 inhibits receptor-mediated endocytosis and recruitment of both clathrin and clathrin adaptors J. Cell Sci., September 15, 2005; 118(18): 4311 - 4321. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Choudhury, A. Diao, F. Zhang, E. Eisenberg, A. Saint-Pol, C. Williams, A. Konstantakopoulos, J. Lucocq, L. Johannes, C. Rabouille, et al. Lowe Syndrome Protein OCRL1 Interacts with Clathrin and Regulates Protein Trafficking between Endosomes and the Trans-Golgi Network Mol. Biol. Cell, August 1, 2005; 16(8): 3467 - 3479. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-I. Yim, S. Scarselletta, F. Zang, X. Wu, D.-w. Lee, Y.-s. Kang, E. Eisenberg, and L. E. Greene Exchange of clathrin, AP2 and epsin on clathrin-coated pits in permeabilized tissue culture cells J. Cell Sci., June 1, 2005; 118(11): 2405 - 2413. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Legendre-Guillemin, M. Metzler, J.-F. Lemaire, J. Philie, L. Gan, M. R. Hayden, and P. S. McPherson Huntingtin Interacting Protein 1 (HIP1) Regulates Clathrin Assembly through Direct Binding to the Regulatory Region of the Clathrin Light Chain J. Biol. Chem., February 18, 2005; 280(7): 6101 - 6108. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Roth Phosphoinositides in Constitutive Membrane Traffic Physiol Rev, July 1, 2004; 84(3): 699 - 730. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Keyel, S. C. Watkins, and L. M. Traub Endocytic Adaptor Molecules Reveal an Endosomal Population of Clathrin by Total Internal Reflection Fluorescence Microscopy J. Biol. Chem., March 26, 2004; 279(13): 13190 - 13204. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Z. Rappoport, B. W. Taha, S. Lemeer, A. Benmerah, and S. M. Simon The AP-2 Complex Is Excluded from the Dynamic Population of Plasma Membrane-associated Clathrin J. Biol. Chem., November 28, 2003; 278(48): 47357 - 47360. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||