|
|
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 14, Issue 3, 1182-1194, March 2003

and
*Wellcome Centre for Molecular Parasitology, University of
Glasgow, The Anderson College, Glasgow G11 6NU, United Kingdom;
Wellcome Trust Laboratories for Molecular
Parasitology, Department of Biological Sciences and Centre for
Molecular Microbiology and Infection, Imperial College, London SW7 2AY,
United Kingdom; and
Division of Infection and
Immunity, Institute of Biomedical and Life Sciences, University of
Glasgow, Glasgow G12 8QQ, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
The survival of Trypanosoma brucei, the causative
agent of Sleeping Sickness and Nagana, is facilitated by the expression of a dense surface coat of glycosylphosphatidylinositol
(GPI)-anchored proteins in both its mammalian and tsetse fly hosts. We
have characterized T. brucei GPI8, the gene encoding the
catalytic subunit of the GPI:protein transamidase complex that adds
preformed GPI anchors onto nascent polypeptides. Deletion of
GPI8 (to give
gpi8) resulted in the
absence of GPI-anchored proteins from the cell surface of procyclic
form trypanosomes and accumulation of a pool of non-protein-linked GPI
molecules, some of which are surface located. Procyclic
gpi8, while viable in culture, were unable to
establish infections in the tsetse midgut, confirming that GPI-anchored
proteins are essential for insect-parasite interactions. Applying
specific inducible GPI8 RNAi with bloodstream form
parasites resulted in accumulation of unanchored variant surface
glycoprotein and cell death with a defined multinuclear,
multikinetoplast, and multiflagellar phenotype indicative of a block in
cytokinesis. These data show that GPI-anchored proteins are essential
for the viability of bloodstream form trypanosomes even in the absence
of immune challenge and imply that GPI8 is important for proper cell
cycle progression.
| |
INTRODUCTION |
|---|
|
|
|---|
Trypanosoma brucei is the heteroxenous,
hemoflagellate protozoan parasite responsible for Sleeping Sickness in
humans and Nagana in domestic animals in the tsetse belt of sub-Saharan
Africa. All life cycle stages of the parasite utilize
glycosylphosphatidylinositol (GPI) anchors as the predominant
method for attaching proteins to their plasma membrane. In the
mammalian host, these proteins include one subunit of the
heterodimeric transferrin receptor (Schell et al., 1991
), an
alanine-rich protein of unknown function (Nolan et al.,
2000
), and the variant surface glycoprotein (VSG) (Ferguson et
al., 1988
) essential for evasion of the host's immune system.
The bloodstream forms of T. brucei differentiate into
procyclic forms once ingested by the tsetse fly vector. This
differentiation involves remodeling of the surface by shedding the VSG
coat and replacing it with an invariant coat of GPI-anchored proteins
known as procyclins (Roditi et al., 1989
). There are four
types of procyclin, three bearing between 18 and 30 internal -Glu-Pro-
repeats (EP1, EP2, and EP3; see Acosta-Serrano et al., 2000
for alignment), and one with a -Gly-Pro-Glu-Glu-Thr- (GPEET) repeat
region (Mowatt et al., 1989
). Although EP1 and EP3 both
undergo N-glycosylation, EP2 and GPEET do not, although the latter is
phosphorylated on the threonine residues of the repeat region
(Butikofer et al., 1999
). All procyclin isoforms are
anchored by a GPI modified with a heterogeneous
poly-N-acetyllactosamine side chain (Treumann et
al., 1997
), widely believed to form a glycocalyx over the cell surface. Displayed above this, both EP and GPEET procyclins are thought
to adopt a rod-like conformation (Roditi et al., 1989
; Treumann et al., 1997
). Although the N-termini of these
proteins are proteolytically cleaved during infection of tsetse, their repeat domains are resistant to protease digestion, suggesting that one
of the functions of this coat is to act as a mechanical barrier within
the proteolytic environment of the tsetse midgut (Acosta-Serrano
et al., 2001
). A hierarchy of procyclin expression during
establishment within the tsetse has recently been discovered (Acosta-Serrano et al., 2001
). GPEET is the predominant
species at day 3 after the blood meal, but there is a switch to
glycosylated EP isoforms by day 7. It is known that there is a dramatic
decline in parasite numbers during this initial 3 d, whereupon the
parasites remaining rapidly multiply to become an established infection with a maximum density of 2-5 × 105
parasites/mid-gut (Van den Abbeele et al., 1999
).
GPI anchors are synthesized in the endoplasmic reticulum (ER) by the
sequential addition of sugars and ethanolamine phosphates onto
phosphatidylinositol (for a recent reviews see Ferguson, 1999
;
Kinoshita and Inoue, 2000
). Precursor proteins destined to receive a
GPI anchor possess an N-terminal, ER-directing signal sequence that is
cleaved upon translocation into the ER and a C-terminal domain
comprising a GPI anchor addition signal sequence (Moran and Caras,
1991
; Gerber et al., 1992
; Nuoffer et al., 1993
). This C-terminal domain is recognized by a transamidase complex consisting of at least four subunits (Fraering et al., 2001
;
Ohishi et al., 2001
). The complex proteolytically cleaves
the protein at the
-site and in a transamidation reaction adds a
preformed GPI en bloc via an amide linkage to the terminal
ethanolamine phosphate (Mayor et al., 1991
; Maxwell et
al., 1995
).
Utilization of GPIs for anchoring proteins to the plasma membrane is
widespread throughout eukaryotes. GPI anchoring is essential in yeast
(Fraering et al., 2001
), mammalian embryos (Lin et
al., 2000
) and bloodstream form T. brucei (Nagamune
et al., 2000
). However, it is not essential in some
mammalian cell lines (Yu et al., 1997
; Watanabe et
al., 2000
), in procyclic T. brucei (Nagamune et
al., 2000
) or in the related kinetoplastid parasite
Leishmania mexicana (Hilley et al., 2000
).
Although both parasites and their hosts use GPI anchoring, disparity in
the substrate specificities of several orthologous GPI biosynthetic
enzymes exist (for review, see Ferguson et al., 1999
). This
raises the possibility that specific inhibitors of parasite GPI
biosynthetic enzymes could be designed for use as therapeutic agents in
the treatment of disease.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Identification of T. brucei GPI8
A 1.1-kb fragment containing the open reading frame (ORF) of the
L. mexicana GPI8 (Hilley et al., 2000
) was used
to screen a T. brucei EATRO 795 genomic library under low
stringency conditions. A single positive plaque was isolated and DNA
was prepared. After restriction endonuclease digestion, an
EcoRI fragment of ~8.5 kb was subcloned into pUC18 to give
pGL480. Sequencing identified a 960-base pair ORF encoding
TbGPI8.
Southern Blot Analysis
Five micrograms of T. brucei EATRO 795 genomic DNA was digested with restriction endonucleases SacI, BamHI, EcoRI, ApaI, or KpnI, electrophoresed through a 0.7% agarose gel, and blotted onto Hybond C Super (Amersham Pharmacia, Little Chalfant, United Kingdom). The blot was hybridized with a 653-base pair 32P random-primed PCR product (equating to bases 134-787 of the 960-base pair TbGPI8 ORF, Accession number AJ439686) at 65°C overnight. Washes were for 15 min at 65°C with 2× SSC/0.1% SDS and then twice with 0.2× SSC/0.1% SDS.
Culturing and Transfection of Parasites
Procyclic form T. brucei strain EATRO 795 cells were
cultured at 27°C in complete SDM79 medium (Brun and Schonenberger,
1979
) supplemented with 10% (vol/vol) heat-inactivated fetal calf
serum. Five micrograms of linearized DNA was used to transfect 3 × 107 midlog phase procyclics in 0.5 ml
Zimmerman PostFusion medium (132 mM NaCl, 8 mM
Na2HPO4, 1.5 mM
KH2PO4, 0.5 mM Mg acetate, 0.09 mM Ca acetate, pH 7.0) in a 0.4-cm pulse cuvette using a Bio-Rad
gene pulser II set at 1.5 kV, 25 µF. After overnight recovery, selection of clones was by limiting dilution in nonadherent tissue culture plates (Falcon) with appropriate antibiotics (15 µg
ml
1 G418, 10 µg ml
1
puromycin, 20 µg ml
1 blasticidin). Subsequent
culturing was in conventional tissue culture flasks.
Bloodstream form T. brucei strain 427 cells (SMB; Wirtz
et al., 1999
) were used for RNAi analysis. These
trypanosomes express T7 polymerase and the tet repressor protein that
facilitate inducible expression of double-stranded RNA. Cells were
cultured at 37°C with 5% CO2 in HMI-9 (Hirumi
and Hirumi, 1989
) supplemented with 5 µg ml
1
hygromycin and 2.5 µg ml
1 G418. Cells
(107) resuspended in 400 µl Cytomix (25 mM
HEPES, 10 mM K2HPO4, 120 mM
KCl, 0.15 mM CaCl2, 5 mM
MgCl2, 2 mM EGTA, 1 mM hypoxanthine, 0.5%
(wt/vol) glucose, 100 µg ml
1 BSA, pH 7.4)
were electroporated with 25 µg NotI linearized pGL654 using a Bio-Rad Gene Pulser II set at 1.5 kV and 25 µF. Clonal populations were derived by limiting dilution with 2.5 µg
ml
1 phleomycin. Induction of RNAi expression
was with 1 µg ml
1 tetracycline.
Plasmids
For deletion of TbGPI8 the 5' and 3' flanks of the
gene were amplified by PCR using primer pairs OL674
(CAAGCTTTTCGCCATCACTCTCAGCCG) with OL675 (AACTAGTCGCCTGATCCAACTAATCG)
and OL676 (AGGATCCTTACGATTTGTTCTAGTTCC) with OL677
(AAGATCTCAGCTGTAGACAACTCAGCG), respectively, and cloned sequentially
into the HindIII/SpeI and
BamHI/BglII sites flanking the
PURR gene of construct pGL236 (Hilley et
al., 2000
), giving pGL519. The BSDR gene was
excised from pGL437 (Brooks et al., 2000
) using
SpeI/BamHI and cloned into the same sites of
pGL519, replacing the PURR gene and giving
pGL610. pGL519 and pGL610 were digested with HindIII/BglII and the
PURR/BSDR-containing
fragment purified for transfections. Gene deletion was by homologous
recombination, replacing the TbGPI8 ORF and utilizing the
TbGPI8 5' and 3' flanking sequences for correct transcription and processing of drug resistance genes.
For reexpression of TbGPI8, the ORF together with 449 and
579 base pairs of 5' and 3' flanking sequence, respectively, was amplified by PCR using primer pair OL840 (CAAAGCTTGATCCTTAGATACATACCCG) with OL841 (TGGGATCCCACCAGTAACAACAGGCAGC) and cloned into the HindIII/BamHI sites of plasmid pXS219 (Bangs
et al., 1997
), giving pGL620. For transfection, pGL620 was
linearized with MluI, allowing integration into the tubulin
intergenic region.
For RNAi, the ORF of TbGPI8 was amplified by PCR using
primer pair OL765b (ACAAGCCTATGTTGCCCATGTTACTGTGG) with OL766
(CAGGATCCCTAGAACAAATCGAACGTAACTC) and cloned into the BamHI
and HindIII sites of p2T7i (LaCount et al.,
2000
), giving pGL654.
Antisera and Immunoblotting
Antiserum specific to GPI8 was raised by immunization of rabbits
with purified recombinant L. mexicana GPI8 (Sharma et
al., 2000
). TBRP1/247 monoclonal antiserum against EP-procyclin
was from Cedar lane Laboratories (Ontario, Canada). K1 antiserum
against the GPEET-procyclin (Butikofer et al., 2001
) was a
kind gift from I. Roditi. Antiserum against the T. brucei
aldolase was a kind gift from D. Steverding. Antisera against the
T. brucei variant surface glycoprotein (VSG) 221 were kind
gifts from M. Boshart and M. Carrington.
Trypanosome cell pellets were resuspended in Laemmli buffer, electrophoresed on 12% SDS-PAGE gels, and transferred onto PVDF membrane (NEN). Blocking was with 5% (wt/vol) skimmed milk in PBS with 0.1% Tween 20. Primary antibodies for GPI8, EP-procyclin, and GPEET-procyclin were used at dilutions of 1:2000, for VSG at 1:5000, and for aldolase at 1:10,000. Secondary antibody (Promega) was conjugated to HRP and was used at 1:2000. Chemiluminescent detection was with the SuperSignal system (Pierce), whereas chemifluorescent detection was with the ECF Western blotting kit and a Typhoon 8600 phosphoimager (Amersham Pharmacia).
Tsetse Fly Infection Study
Procyclic trypanosomes were harvested by centrifugation at
1000 × g for 5 min at 27°C and then resuspended at
106 ml
1 in red blood
cells washed with heat-inactivated fetal calf serum. Tsetse flies were
fed through a silicon membrane on a 37°C plate and then maintained at
25°C with 65% humidity for 14 d with feeding every 2 d.
After this time, they were dissected and their midguts examined for the
presence of trypanosomes. Images were captured using a Zeiss Axioplan
at ×630 magnification with a Hamamatsu C4742-95 cooled digital CCD
camera and processed using Openlab 2.02.
Metabolic Labeling and Extraction of Parasite Material
For metabolic labeling, 108 procyclic
parasites were harvested at 1000 × g for 5 min at
27°C and washed twice with PBS. The parasites were resuspended in 10 ml SDM79 containing 250 µCi
[1-3H]ethanolamine hydrochloride (Amersham) for
16 h or in 5 ml glucose-free RPMI containing 200 µCi
D-[2,6-3H]mannose
(Amersham) for 5 h. For periodate treatment,
D-[2,6-3H]mannose-labeled
procyclics were resuspended in 20 ml SDM79 for 4 h, washed twice
with ice-cold PBS and then resuspended in 10 ml ice-cold PBS. Samples
were split and NaIO4 added to one of the matched
pair to 10 mM final concentration, after which samples were incubated
on ice for 30 min in the dark. Cells were washed twice with ice-cold
PBS/150 mM glycerol and twice with ice-cold PBS, and pellets were
stored at
80°C.
Lipid extracts were prepared as described previously (Field et
al., 1991b
). After partitioning to remove aqueous-soluble
metabolites, organic phases were dried down in a Speedvac (Savant) and
resuspended in 20 µl solvent. Ten microliters of each sample was
spotted on a Si60 HPTLC plate (Merck) and then developed in
chloroform/methanol/water (10:10:3, vol/vol) in a saturating
atmosphere. The total migration distance was 16 cm. After development,
the plates were air dried, sprayed with EnHance (Perkin Elmer-Cetus),
and exposed to autoradiographic film at
85°C. To generate a PP1*
standard, PP1 was purified by elution from Si60 TLC plates (Merck)
after chromatography in chloroform/methanol/water (10:10:3, vol/vol).
After several rounds of extraction in chloroform/methanol/water (10:10:3, vol/vol), samples were dried and repartitioned between butanol/water, and then lipids located by scintillation counting of an
aliquot. Periodate treatment was done in 250 µl 40% propan-1-ol, 20% MeOH, 40% PBS, with 10 mM periodate on ice in the dark for 10 min. Reactions were stopped by mixing with an equal volume of 150 mM
glycerol in PBS, and samples were chromatographed as described above.
| |
RESULTS |
|---|
|
|
|---|
Isolation of T. brucei GPI8
Use of the ORF of the L. mexicana GPI8 to screen a
T. brucei
library resulted in a positive plaque being
isolated and 1.6 kb of sequence being obtained. This identified a
960-base pair ORF (TbGPI8) encoding the T. brucei
GPI8. TbGPI8 is predicted to be a 37-kDa protein, with a putative
signal peptide cleavage site between positions 20 and 21. Comparison of
TbGPI8 with the protein from other organisms (Figure
1) reveals 49% identity with L. mexicana and 27% identity with both Saccharomyces
cerevisiae and Homo. sapiens. TbGPI8 contains the
catalytic histidine and cysteine dyad (marked in Figure 1) that defines
the clan CD cysteine proteases (Barrett and Rawlings, 2001
). Hydropathy
analysis revealed TbGPI8 lacks the C-terminal transmembrane domain
reported for S. cerevisiae and H. sapiens
(Benghezal et al., 1996
). Amplification of TbGPI8
from cDNA using a gene internal and a spliced leader-specific primer
pair identified the splice acceptor site 304 base pairs 5' of the start
codon.
|
Procyclic Form
gpi8 Trypanosomes Lack GPI-anchored Proteins
Southern blot analysis of endonuclease-digested genomic DNA
(Figure 2A) revealed a single
GPI8-hybridizing DNA fragment with KpnI,
ApaI, EcoRI, or BamHI. Two DNA
fragments were detected with SacI because of the presence of
a SacI site near the middle of the gene. These data show
that the T. brucei GPI8 is a single-copy gene. To
investigate the importance of GPI8 in procyclic T. brucei, sequential rounds of targeted gene replacement with PAC and
BSD antibiotic resistance genes flanked by GPI8
5' and 3' sequences were performed (Figure 2B). After PCR confirmation
of PAC integration at the correct locus, the second allele
of GPI8 was deleted from two independent clones using the
BSD-containing construct. Clonal populations were derived,
and deletion of GPI8 (to give
gpi8) was
confirmed by both PCR (Figure 2C) and Southern blot (unpublished data). The T. brucei GPI8 was targeted into the
tubulin locus of the
gpi8 mutants to generate lines
reexpressing GPI8 (designated
gpi8[GPI8]).
Procyclic form wild-type,
gpi8 and
gpi8[GPI8] were found to have no discernible
difference in either morphology or growth rate in culture.
|
Western blot analysis of whole cell lysates revealed abundant EP and
GPEET procyclins in both wild-type and
gpi8[GPI8] clones, but their apparent
absence from
gpi8 (Figure
3A). This suggested that GPI-anchored
proteins were not present in trypanosomes that lack GPI8.
However, a recent report has indicated that both of the antibodies
against procyclins used in the current study (TBRP1/247 and K1) fail to
detect procyclins that no longer possess GPI anchors (Butikofer
et al., 2001
). Thus it was possible that non-GPI anchored procyclins could still associate with the surface of
gpi8
cells by means of the hydrophobic C-terminal domain normally cleaved during the GPI:protein transamidation reaction. To investigate this
possibility, a previously reported method (Clayton and Mowatt, 1989
)
was used to hypotonically lyse cells in the presence of protease
inhibitors and then extract protein from the membrane fraction using
CHAPS. After PAGE, Stainsall was used to detect protein within the gel.
Procyclin stained a deep blue in both wild-type and
gpi8[GPI8] clones, but was not observed in
gpi8 (Figure 3B). This confirmed that procyclin was not
expressed on the cell surface in the absence of GPI anchoring. Sypro
Ruby staining of the CHAPS extracts showed that there were a number of
proteins expressed in both wild-type and
gpi8[GPI8] trypanosomes that were apparently
absent from
gpi8 (Figure 3B). Also, a subset of proteins
appeared to be expressed at much higher levels in
gpi8
cells relative to both wild-type and
gpi8[GPI8].
|
Effect of ConA on Procyclic
gpi8
The tetrameric lectin concanavalin A has a strong affinity for
mannose residues and binds to the N-linked glycans of EP-procyclins, resulting in procyclic cell death. Cells bearing procyclin isoforms that are either not glycosylated or have altered N-glycans are resistant to ConA-induced death (Pearson et al., 2000
). We
therefore reasoned that because
gpi8 cells lack procyclin
on the cell surface, then they would be resistant to ConA-induced cell
death. To test this hypothesis, wild-type,
gpi8, or
gpi8[GPI8] cells were cultured in medium
containing 50 µg ml
1 ConA. All three clones
showed the same kinetics of cell death, including the characteristic
morphology previously described (Welburn et al., 1996
;
Pearson et al., 2000
). This indicates the presence of other
mannose-bearing structures that replace procyclin on the surface of
procyclic
gpi8 as ligands to which ConA can bind.
Procyclic
gpi8 Accumulate GPI Anchor Precursors
Analysis of chloroform/methanol/water (CMW) extracts from both
3H-ethanolamine- and
3H-mannose-labeled procyclic forms by TLC
revealed that although wild-type EATRO 795 and
gpi8[GPI8] display lipid profiles that are
essentially identical, there is an increase in the abundance of
ethanolamine- and mannose-containing lipids in
gpi8 cells (Figure 4A). Designation of lipid species
is made based on Rf values from previous experiments (Field et
al., 1991b
). PP1, the complete preformed GPI substrate of the
transamidase complex of procyclic T. brucei (Field et
al., 1991a
; Mayor et al., 1991
), was particularly
abundant in cells lacking GPI:transamidase activity. The structure of
PP1 and the procyclin GPI anchor are shown (Figure 4B). The
accumulation of GPI-precursors was due to the loss of GPI:protein
transamidase activity, as reexpression of GPI8 in
gpi8[GPI8] restored the lipid profile to
that of the wild-type parasites. In addition to the build up of
previously observed precursors, a number of novel
ethanolamine/mannose-containing lipid species also accumulated in
gpi8 (Figure 4A [
]). This indicates that in the
absence of addition to proteins a significant proportion of the anchor
pool has undergone further modification. It is feasible that these
novel lipid species are present at low levels in wild-type cells, but
are difficult to detect because of the relatively low PP1 pool.
|
Many eukaryotes express non-protein-linked GPI molecules
on their plasma membranes. These include the lipophosphoglycans and GIPLs of Leishmania and `free' GPI anchors in mammalian
cells (McConville and Ferguson, 1993
; Baumann et al., 2000
).
We therefore speculated that T. brucei may express free GPI
molecules on the extracellular face of the plasma membrane and that the
marked accumulation of GPI molecules detected in
gpi8
cells could be indicative of an amplification of this phenomenon. To
determine if this were the case, we utilized a previously published
method for identifying expression of free GPIs on the exoplasmic
leaflet of the plasma membrane (Baumann et al., 2000
).
Sodium periodate oxidizes the hydroxyl groups of sugars, but because of
its size and negative charge does not diffuse into cells (McConville
and Bacic, 1990
; Baumann et al., 2000
).
gpi8
were labeled with 3H-mannose and after a chase
period incubated in the presence of 10 mM NaIO4.
CMW extracts analyzed by TLC revealed that after periodate treatment a
significant portion of the PP1 fraction had been oxidized (PP1*),
indicating that part of this pool is expressed on the surface of these
parasites (Figure 5A, lanes 1 and 2). As
a control, PP1 was purified by elution from a TLC plate and treated
with periodate to provide an authentic PP1* standard (lanes 3 and 4).
To show that periodate did not permeate the plasma membrane and oxidize
intracellular PP1,
gpi8 cells were labeled for 2.5 h
with 3H-mannose and then treated with periodate
as described above. No substantial change in lipid profile was detected
between the treated and untreated samples (compare Figure 5B, lanes 1 and 2). Once extracted from
gpi8 cells, all PP1 converted
to PP1* upon incubation with periodate (lanes 3 and 4). Additionally, a
glycerol quench applied before periodate treatment ensured that no
oxidation occurred during the experimental procedure (unpublished data). These data provide evidence that a fraction of the PP1 pool of
gpi8 cells is surface located.
|
gpi8 Do Not Establish a Successful Infection in Tsetse
The repeat domains of T. brucei procyclins
are known to be resistant to digestion by tsetse proteases
(Acosta-Serrano et al., 2001
), whereas their GPI anchors are
modified with a large poly-N-acetyllactosamine side chain
(Treumann et al., 1997
). This has led to the hypothesis that
one of the major functions of the procyclin coat is to form a
glycocalyx, which provides the cell with a protective barrier against
the digestive enzymes of the tsetse fly midgut (Ferguson et
al., 1993
; Ruepp et al., 1997
). In the current study,
wild-type,
gpi8 or
gpi8[GPI8]
cells were fed to teneral tsetse flies as part of a blood meal, with
midgut dissection of flies 14 d later. Wild-type and
gpi8[GPI8] procyclics infected 49 and 37%
of flies, respectively, whereas
gpi8 infected <2%
(Table 1). Furthermore, both of the flies
infected by
gpi8 harbored very sparse populations of
parasites, and these cells resembled cultured procyclic forms rather
than the more serpentine procyclic forms that characterize established
midgut infections (Figure 6). Because
gpi8[GPI8] cells behaved in a manner similar
to the wild-type parasites, both in rate of infection and midgut
morphology, failure of
gpi8 trypanosomes to establish in
tsetse must be due to the lack of GPI:protein transamidase activity.
|
|
GPI8 Is Essential for Cell Cycle Progression in Bloodstream form Trypanosomes
We used an inducible RNAi approach (Ngo et al., 1998
;
Wang et al., 2000
) to investigate the requirement for GPI8
in bloodstream trypanosomes. Culturing cells in the presence of
tetracycline-induced expression of double-stranded GPI8 RNA.
A severe growth deficit was observed in induced cells when compared
with uninduced controls (Figure 7A).
Northern blotting confirmed that GPI8 mRNA levels were
reduced significantly in induced cells relative to a MOB1 control (Figure 7B), whereas Western blotting demonstrated GPI8 to be apparently absent (Figure 7C). Interestingly, GPI8
RNAi induction resulted in a 10% increase in the abundance of VSG
(Figure 7C) in comparison to an adolase control, leading us to
speculate that accumulation of unanchored precursor proteins may be
occurring as a result of reduced GPI anchoring. To address this
question, cells cultured for 24 h
/+ induction were
hypotonically lysed and then incubated at 37°C for 30 min. This
treatment allowed the endogenous trypanosomal GPI-PLC to hydrolyze the
GPI anchor of VSG, converting the glycoprotein from a membrane bound to
a water-soluble form (De Almeida and Turner, 1983
). As a control, cells
were lysed in the presence of 10 mM ZnCl2, a
known inhibitor of GPI-PLC. After ultracentrifugation, P100 and S100
fractions were analyzed by Western blotting with
-VSG 221 or with
-aldolase as a loading control. In uninduced cells, GPI-PLC activity
resulted in all VSG being found in the S100 fraction as had been
predicted. By contrast, RNAi induction resulted in the accumulation of
proVSG, which was resistant to GPI-PLC activity and hence remained
associated with membranes.
|
Microscopic analysis revealed that by 12 h post-induction cells
had begun to swell and lose motility and that after 18 h the morphology of many was radically altered. DAPI staining revealed that
the majority of these cells had karyotype defects (Monsters), with
multiple nuclei, kinetoplasts, and flagella (Figure
8). This suggests that lack of
GPI:protein transamidase activity results in perturbation of cell cycle
control, leading to cell death.
|
| |
DISCUSSION |
|---|
|
|
|---|
The GPI8 gene of T. brucei encodes a
predicted protein with significant sequence identity to GPI8 from
L. mexicana, S. cerevisiae, and H. sapiens. However, although GPI8 is a type I ER membrane protein in
both S. cerevisiae and H. sapiens, hydropathy
analysis indicates that the trypanosome GPI8 lacks a C-terminal
transmembrane domain. This is consistent both with the hydropathy
profile of the GPI8 of the closely related trypanosomatid L. mexicana (Hilley et al., 2000
; Sharma et
al., 2000
) and our previous studies that indicated that
trypanosomal GPI8 is a soluble ER protein (Sharma et al.,
2000
). Deletion of GPI8 from procyclic T. brucei
resulted in parasites deficient in GPI-anchored proteins (Figure 3) and with an accumulation of precursor GPIs (Figure 4A), confirming that
GPI8 is a functional component of the GPI:protein transamidase of
T. brucei. The parasite does not have an alternative pathway for GPI anchor addition to proteins, making the GPI8 cysteine protease
essential for the production of GPI-anchored proteins.
A previous study demonstrated that disruption of
TbGPI10, which encodes the third mannosyltransferase in GPI
anchor biosynthesis, resulted in procyclic cells with an in vitro
doubling time approximately twice that of their wild-type counterpart
and a requirement for nonadherent culture conditions (Nagamune et
al., 2000
). Surprisingly, despite their reduced fitness in vitro,
these mutants retained their ability to establish infection within the
midgut of tsetse, albeit with reduced efficiency. As both GPI8 and
GPI10 are essential for GPI anchoring of proteins, we expected that
deletion of GPI8 would result in a phenotype that mimicked
GPI10 null mutants. However, the current study has
demonstrated that the GPI8 and GPI10 null mutants differ in several key
respects. Although both have been shown to lack GPI-anchored proteins,
gpi8 did not require nonadherent culture conditions for
growth, had a cell cycle of comparable length to their wild-type
parent, and yet were unable to establish infection within the tsetse
fly midgut. Comparison of metabolically labeled GPI lipids from these
two mutants provides an explanation for these differences.
gpi8 accumulated PP1, the complete preformed GPI
substrate of the transamidase complex of procyclic T. brucei
(Mayor et al., 1991
; Field et al., 1991a
). This
is in keeping with similar data from L. mexicana (Hilley et al., 2000
), S. cerevisiae (Benghezal et
al., 1996
), and human (Yu et al., 1997
), all of which
accumulate mature GPI in the absence of GPI8 function. Furthermore, our
data indicate that
gpi8 cells express part of the
accumulated PP1 pool on their plasma membrane.
gpi10, by
contrast, did not synthesize complete GPI anchors and accumulated
different mannolipids than wild-type cells (Nagamune et al.,
2000
). They could not express the free surface GPIs we report here,
therefore explaining their reduced fitness in vitro.
Expression of free GPIs on the surface of eukaryotic cells is not
without precedent (McConville and Ferguson, 1993
; Baumann et
al., 2000
) and has also been discovered recently in "naked" procyclic trypanosomes deficient in procyclin (E. Vassella, personal communication). A number of novel lipid species were found to build up
in the
gpi8 mutant, which were not detected in the
wild-type (Figure 4A). These may be a result of the accumulating lipids being acted upon by the normal biosynthetic pathway that decorates lipid anchors in the Golgi and, if this is the case, these lipids are
unlikely to be substrates for the GPI:protein transamidase, which is
located in the ER. The possibility of free GPIs on the surface explains
our observation that Con A was capable of killing
gpi8
cells. Previous studies have shown that Con A binds to the N-linked
glycans of EP procyclins 1 and 3, resulting in a procyclic cell death
phenotype that has been likened to apoptosis in metazoan cells (Welburn
et al., 1996
). Clones that exclusively express the
procyclins EP2 and GPEET, both of which lack N-glycosylation sites and
are not bound by ConA, are resistant to this form of cell death
(Pearson et al., 2000
). The plasma membrane of
gpi8 cells lack all procyclin, but have the tri-mannose
GPI, PP1, which is capable of binding ConA (Vidugiriene and Menon,
1994
). Although Con A-induced death of wild-type procyclic parasites
is mediated through interaction of the lectin with procyclin-borne
glycans, the actual mechanism by which this kills the cells is not
understood. It is therefore entirely feasible that interaction of Con A
with the free GPIs of
gpi8 cells could elicit the same
cellular response. Interestingly, we have noted previously that there
are two pools of PP1 in wild-type parasites, one pool that is turned
over with rapid kinetics (t1/2 = 8 h) and a
more stable pool (M. Field, unpublished). The presence of two pools of
PP1 is consistent with the concept that a portion of PP1 is located on
the surface of wild-type parasites as well as
gpi8.
Surface expression of free GPIs by
gpi8 cells also
provides an explanation for our observation that these mutants cannot establish an infection in the tsetse midgut. One of the proposed functions of the GPI-anchored procyclin coat of T. brucei is
provision of cells with a protease-resistant glycocalyx, enabling them
to survive within the lumen of the tsetse fly midgut. Deletion either of EP procyclin genes (Ruepp et al., 1997
) or
GPI10 (Nagamune et al., 2000
) resulted in reduced
ability of procyclic cultures to establish infections within tsetse,
supporting this view. However, although reduced infection frequencies
were reported in both of these studies, heavy infections were still
observed. By contrast, the current study detected
gpi8
cells in only 2% of flies dissected and with very low parasitaemia and
abnormal morphology in both cases. This suggests that tsetse flies are
essentially refractory to the successful establishment of
gpi8. Little is known about the molecular basis for
refractoriness of tsetse to trypanosome infection. There is some
circumstantial evidence to suggest that tsetse flies possess a
trypanocidal midgut lectin (Maudlin and Welburn, 1987
; Welburn et
al., 1994
), although this lectin has never been purified and
characterized. Such a lectin could be responsible for the inability of
gpi8 parasites to establish infection within the midgut
of the vector, with the tri-mannose core of their exposed GPI coat
being bound by the lectin.
gpi10 mutants by contrast lack
this free GPI on their surface and would not be susceptible to
agglutination. An alternative explanation is that the surface
architecture of the procyclic form will differ between
gpi8 and
gpi10 mutants because of the
variation in their free GPIs. Such differences may alter their
susceptibility to other tsetse immune responses, such as the
antimicrobial peptides attacin, defensin, and diptericin (Hao et
al., 2001
).
The
gpi8 cells that were detected in the midguts of the
two tsetse were morphologically indistinguishable from counterparts grown in in vitro cultures. By contrast, wild-type and
gpi8[GPI8] parasites observed in the midguts
had all assumed the phenotype characteristic of posterior midgut
procyclic trypomastigotes (as described in Van den Abbeele et
al., 1999
). This shows that the failure to differentiate was a
direct result of the GPI8 deletion. However, such a
phenotype was not reported with the
gpi10 mutants, suggesting that it is not simply a consequence of the lack of GPI-anchored proteins.
RNAi was used to show that GPI8 is essential in bloodstream form
trypanosomes grown in in vitro culture. Northern and Western blot data
demonstrated specific down-regulation of both GPI8 mRNA and protein,
with concomitant accumulation of proVSG. Recently it has been shown
that proVSG with an altered GPI-anchor signal sequence accumulates
within the ER and is then degraded (Bohme and Cross, 2002
). Our data
provide direct evidence to support more circumstantial data (Nagamune
et al., 2000
) that expression of GPI-anchored proteins are
essential for bloodstream form trypanosomes. Cells with reduced GPI8
rapidly lost viability, displaying obvious dysfunction in cell cycle
progression with an accumulation of cells with multiple nuclei,
flagella, and kinetoplasts. This phenotype is consistent with a block
in cytokinesis. Studies in our laboratory have indicated that
trypanosomes lack certain key cell cycle checkpoints that are present
in most eukaryotes. In particular, RNAi of the mitotic cyclin CYC6 in
bloodstream form trypanosomes led to a block in mitosis but allowed
reinitiation of nuclear and kinetoplast S-phase (Hammarton and Mottram,
in preparation). For the GPI8 RNAi mutants a block in cytokinesis does
not appear to prevent kinetoplast and nuclear replication or subsequent
organelle segregation, reinforcing the finding that initiation of
S-phase can occur in the absence of completion of cytokinesis. Cell
cycle arrest in response to a defect in GPI biosynthesis has been
reported previously in S. pombe (Colussi and Orlean, 1997
).
It has been hypothesized that this phenomenon in yeast could be the
result of inefficient delivery of GPI-anchored proteins involved in
cell division to their site of action. Depletion of GPI anchors in
Trypanosoma cruzi by heterologous expression of T. brucei GPI-PLC lead to an apparent block in mitosis (Garg et
al., 1997
). In T. brucei, it is possible that reduction
or ablation of GPI-anchored receptors (e.g., transferrin) or other
GPI-anchored protein such as BARP (Nolan et al., 2000
) may
render cells incapable of undergoing cytokinesis. Alternatively, it is
possible that accumulation of GPI precursors, or intracellular proVSG,
results in perturbation of the cell cycle or that VSG occupancy of the
plasma membrane is required at a given density. In the later scenario,
reduction in the rate at which VSG is anchored and trafficked to the
cell surface could negatively impact on the rate at which membrane is
synthesized, resulting in cells being unable to undergo cytokinesis at
a time when mitosis has been initiated. Whatever the cause, the current
work clearly demonstrates that reduced GPI:protein transamidase
activity results in a cytokinesis block in bloodstream form trypanosomes.
| |
ACKNOWLEDGMENTS |
|---|
We thank Alyson Lewis for excellent technical assistance with the tsetse fly infections, Mike Ferguson for suggestions on solvent extractions for the periodate experiment, and Tansy Hammarton for incisive comments on trypanosome cell cycle control. This study was supported by the Medical Research Council (UK). J.C.M. is a MRC Senior Research Fellow. M.C.F. and P.B. acknowledge support from the Wellcome Trust.
| |
FOOTNOTES |
|---|
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-03-0167. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-03-0167.
§ Corresponding author. E-mail address: j.mottram{at}udcf.gla.ac.uk.
| |
REFERENCES |
|---|
|
|
|---|
purification and post-translational modification.
J. Biol. Chem.
264, 15088-15093
lipid structure and biosynthesis.
EMBO J.
10, 2731-2739[Medline].
identification of a candidate biosynthetic precursor of the glycosylphosphatidylinositol anchor of the major procyclic stage surface glycoprotein.
J. Biol. Chem.
266, 8392-8400
GPIs are essential for nuclear division in Trypanosoma cruzi.
J. Biol. Chem.
272, 12482-12491