![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 14, Issue 4, 1479-1488, April 2003
and
*Department of Biochemistry and Molecular Biology,
Uniformed Services University of the Health Sciences, Bethesda,
Maryland 20814; and
Max-Planck-Institute for
Terrestrial Microbiology, D-35043 Marburg, Germany
| |
ABSTRACT |
|---|
|
|
|---|
The mechanism(s) by which microtubule plus-end tracking proteins are targeted is unknown. In the filamentous fungus Aspergillus nidulans, both cytoplasmic dynein and NUDF, the homolog of the LIS1 protein, localize to microtubule plus ends as comet-like structures. Herein, we show that NUDM, the p150 subunit of dynactin, also forms dynamic comet-like structures at microtubule plus ends. By examining proteins tagged with green fluorescent protein in different loss-of-function mutants, we demonstrate that dynactin and cytoplasmic dynein require each other for microtubule plus-end accumulation, and the presence of cytoplasmic dynein is also important for NUDF's plus-end accumulation. Interestingly, deletion of NUDF increases the overall accumulation of dynein and dynactin at plus ends, suggesting that NUDF may facilitate minus-end-directed dynein movement. Finally, we demonstrate that a conventional kinesin, KINA, is required for the microtubule plus-end accumulation of cytoplasmic dynein and dynactin, but not of NUDF.
| |
INTRODUCTION |
|---|
|
|
|---|
In eukaryotic cells, the microtubule cytoskeleton is essential for
cell cycle progression, the establishment of cell polarity, and cell
migration. In most interphase cells, microtubules are polarized in such
a way that the minus ends are located at the microtubule organizing
center near the nucleus while the plus ends extend to the
periphery. Microtubule plus ends are very dynamic, constantly exploring
the cytoplasmic space with alternate growing and shrinking phases
(reviewed by Desai and Mitchison, 1997
; Gundersen, 2002
). Kinesin
superfamily members and cytoplasmic dynein together play important
roles in intracellular trafficking of various proteins, vesicles, and
organelles. Because conventional kinesin is a plus-end-directed motor
and dynein is a minus-end-directed motor, it is thought that
conventional kinesin is responsible for moving materials from the cell
body toward cell periphery, whereas cytoplasmic dynein moves materials
from the cell periphery back to the cell body (reviewed by Goldstein
and Yang, 2000
).
We have shown that cytoplasmic dynein is required for the proper
distribution of nuclei within the hyphae of the filamentous fungus
Aspergillus nidulans (reviewed by Morris et al.,
1998b
). Cytoplasmic dynein is a complex that consists of heavy
chains (HCs), intermediate chains (ICs), light intermediate chains, and light chains (reviewed by King, 2000
; Tynan et al., 2000
).
The HC contains the motor domain (reviewed by Asai and Koonce, 2001
), and the other chains may target the motor to various cargoes (Steffen et al., 1997
; Tai et al., 1999
; Young et
al., 2000
). The function of cytoplasmic dynein requires dynactin
(reviewed by Holleran et al., 1998
; Ma et al.,
1999
; Roghi and Allan, 1999
; King and Schroer, 2000
; Kumar et
al., 2000
), a complex that contains multiple subunits, including
the 150-kDa dynactin protein and the actin-related proteins Arp1 and
Arp11 (reviewed by Holleran et al., 1998
; Eckley et
al., 1999
). Our genetic analyses of nuclear distribution
identified multiple nuclear distribution
(nud) genes encoding components of the cytoplasmic dynein
and dynactin complexes. For example, the nudA,
nudI and nudG genes encode the HC, the IC and the
8-kDa light chain of cytoplasmic dynein (Xiang et al.,
1995a
; Beckwith et al., 1998
; Zhang et al.,
2002
). The nudK gene encodes the actin-related protein Arp1
of the dynactin complex (Xiang et al., 1999
). Novel proteins
have also been discovered such as NUDC, NUDF, and NUDE (Osmani et
al., 1990
; Xiang et al., 1995b
; Efimov and Morris, 2000
). NUDF functions in the cytoplasmic dynein pathway and is homologous to a human protein, LIS1, required for neuronal migration (Xiang et al., 1995b
; Willins et al.,
1997
). Both NUDC and NUDE interact with NUDF/LIS1 (Morris
et al., 1998a
; reviewed by Morris et al.,
1998b
; Efimov and Morris, 2000
). The human Lis-1 gene was
identified as a causal gene for a type 1 lissencephaly, a human disease
characterized by brain malformation due to neuronal migration defects
(Reiner et al., 1994
). Since the discovery that LIS1
homologs participate in dynein function in fungal systems (Xiang
et al., 1995b
; Geiser et al., 1997
), LIS1 and its
homologs also have been found to have dynein-related functions in
higher eukaryotes (Swan et al., 1999
; Faulkner et
al., 2000
; Liu et al., 2000
; Smith et al.,
2000
; Dawe et al., 2001
). More importantly, a direct
physical interaction between LIS1/NUDF and the motor domain of
cytoplasmic dynein heavy chain has been demonstrated in both mammalian
cells and A. nidulans (Sasaki et al., 2000
; Hoffmann et al., 2001
; Tai et al., 2002
),
suggesting that LIS1 may regulate dynein motor activity. However,
because LIS1 was not isolated as a component of the dynein complex,
interaction between LIS1 and dynein may be transient and restricted to
special sites in the cell.
Recently, we have shown that GFP-labeled cytoplasmic dynein and its
putative regulator NUDF form comet-like structures that accumulate at
the dynamic plus ends of microtubules in A. nidulans (Han
et al., 2001
). This is consistent with discoveries made in mammalian cells that dynactin, and in some cases dynein, localize at
the plus ends of microtubules near the cell periphery (Vaughan et
al., 1999
; Valetti et al., 1999
; Habermann et
al., 2001
; Vaughan et al., 2002
). These proteins belong
to a growing family of proteins named "plus-end
tracking proteins" or +TIPs, which
also include the cytoplasmic linker protein CLIP170, the tumor
suppressor protein APC, and its binding protein EB1 (Perez et
al., 1999
; Tirnauer et al., 1999
; Brunner and Nurse,
2000
; Mimori-Kiyosue et al., 2000a
,b
; Lin et al.,
2001
; reviewed by Schuyler and Pellman, 2001
; Schroer, 2001
). How +TIPs
accumulate at microtubule plus ends in vivo is unknown. In this study,
we show that in A. nidulans, the p150 subunit of dynactin,
which is encoded by the nudM gene, is also localized to
microtubule plus ends. We used loss-of-function mutants of cytoplasmic
dynein, dynactin, NUDF, and the conventional kinesin KINA to
investigate the genetic requirements for dynein, dynactin, and
NUDF/LIS1 plus-end localization. Our data support a mutually
cooperative role for dynein and dynactin in each other's plus-end
localization. Our results also demonstrate that the KINA kinesin is
required for cytoplasmic dynein and dynactin localization to
microtubule plus ends. However, NUDF most likely uses a
KINA-independent mechanism for its plus-end association. Interestingly,
the nudF deletion mutant increases the plus-end accumulation
of dynein and dynactin, suggesting that NUDF may facilitate dynein's
departure from the plus ends of microtubules.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Aspergillus nidulans Strains, Media, and Techniques
A. nidulans strains used in this study are listed in
Table 1. Growth media used were YAG, YAG + UU, and MM + glycerol. Aspergillus growth and
transformation were as described previously (Osmani et al.,
1987
; Waring et al., 1989
; Xiang et al.,
1995a
,b
). MM medium for strains with GR5 background was
supplemented with 5 µg/ml pyridoxine. Aspergillus protein
isolation and Western analysis was done as described previously (Zhang
et al., 2002
).
|
Cloning of the nudM p150 Dynactin Gene from A. nidulans
We first searched the A. nidulans genome
database (http://microbial.cereon.com/) for sequence homologs
of the RO3 protein, the p150 dynactin of Neurospora crassa
(Tinsley et al., 1996
). Several sequences were identified.
We then designed two oligos: AAATGGCCGAGCTTACCATC
(underlined sequence indicates the first codon ATG) and
TTCGAGACCCACAACCTC for amplifying the genomic DNA encoding the p150
dynactin. By using the GR5 (wild-type strain) genomic DNA as a
template, we amplified a region of 4 kb and cloned it into the PCR2.1
vector (Invitrogen, Carlsbad, CA). Sequencing of this clone confirmed
that it encodes the p150 dynactin from A. nidulans because
it shows high sequence homology with dynactin genes in other organisms.
Strong protein sequence homology between the A. nidulans
dynactin and the Neurospora crassa Ro-3 dynactin also helped
us in identifying the only intron at the 5'-coding region of the gene.
For further sequence analysis, the intron sequence was removed based on
the presence of the conserved splicing sites. For sequencing the whole
p150 dynactin coding region, we also designed two oligos,
CTCGATGCACCTCTTACG and AGATGATTGACATAGTGG, and used them for polymerase
chain reaction on genomic DNA template. This allowed us to obtain a
clone of the C terminus of dynactin that overlaps with the 4-kb clone.
We transformed the 4-kb fragment of p150 dynactin into various new
nud mutants (Xiang et al., 1999
). The
autoreplicating plasmid pAid was cotransformed for selection. We found
that the 4-kb p150 dynactin fragment complemented the
nudM116 mutation. Our cloned p150 dynactin gene most likely
represents the nudM gene rather than an extragenic
suppressor of the nudM116 mutation, based on the following
evidence. The 4-kb fragment used to transform the nudM116
mutant is not a full-length gene containing promoter and termination
sequences. It starts from ATG and ends in the middle of the C terminus.
Thus, it is most likely that this fragment repaired the mutation by
homologous recombination rather than integrated into another site as an
extracopy number suppressor. Furthermore, we analyzed a cross between a
ts+ transformant and a wild-type strain R153. (To
facilitate such a cross, we first streaked the
ts+ transformant on YUU plates to allow the
spontaneous loss of the cotransformed extrachromosomal vector pAid
carrying the pyrG gene). This cross yielded 100%
ts+ progeny (n = 420), consistent with the
notion that the original nudM116 mutation was repaired by
the p150 dynactin genomic DNA that underwent homologous recombination.
Construction of GFP-nudM (p150 Dynactin) Strain
To construct the GFP-nudM strain in which the
endogenous nudM gene is replaced by a functional
GFP-nudM fusion gene, we used a strategy similar to what has
been described previously for the construction of the
GFP-nudI strain (Zhang et al., 2002
). For construction of the GFP-nudM plasmid, a 1.4-kb DNA sequence
of the N-terminal region of nudM was amplified with oligos
D-NotI AAGCGGCCGCTGGCCGAGCTTACCATC and D-SmaI
AACCCGGGTCTTCTCCATCTGCAAC as primers. The polymerase chain reaction
product was digested with NotI/SmaI and ligated
to the NotI and SmaI sites of pLB01 (Liu and
Morris, 2000
). The resulting plasmid contains sequence of a
codon-modified GFP (Fernandez-Abalos et al., 1998
), fused to
the N terminus of NUDM and the expression of the fusion protein is
under the control of the alcA promoter (Waring et
al., 1989
). On transformation, homologous integration of the
nudM sequence on the plasmid into the genomic
nudM sequence generates a truncated nudM gene
with its own promoter and a GFP-nudM fusion gene under the
control of the alcA promoter. The ability to repress the
alcA promoter by using glucose allows us to select for
transformants in which homologous integration occurred based on their
nud-like colony morphology on glucose (similarly described by Zhang
et al., 2002
). One such transformant for which the single
integration event was confirmed by Southern analysis was designated the
GFP-nudM strain and used for further observation. GFP-NUDM
is functional in vivo because the GFP-nudM cells grow as
well as the wild-type cells and exhibit normal nuclear distribution on
glycerol medium that is nonrepressing to the alcA promoter
(our unpublished data). A similar strategy was also used to
create a GFP-nudK (Arp1 of the dynactin complex) strain.
However, adding GFP to the N terminus of NUDK Arp1 causes Arp1 to lose
its function as the GFP-nudK strain grows like a
nud mutant on a glycerol plate. Therefore, we focused on the
GFP-nudM (p150 dynactin) strain to study dynactin localization in A. nidulans.
Placing the GFP-nudA, GFP-nudI, GFP-nudM, and GFP-nudF Fusion Alleles into Various Mutants
Standard genetic techniques in A. nidulans were used
for genetic crosses. To place a GFP fusion in the background of a
specific nud mutation, a nud mutant carrying the
pyrG89 mutation was crossed to the strain harboring the GFP
fusion. The GR5 parental strain carrying the GFP fusions has the
pyrG89 marker, and therefore requires uridine and uracil for
growth. The GFP fusions are genetically marked by the Neurospora
pyr4 gene that was integrated into the genome along with GFP. This
pyr4 gene allows the cells to grow without uridine and
uracil. Thus, if any pyrG89 strain is crossed to the GFP
strains, only those progeny that contain the GFP-fusion can grow
without uridine and uracial. Progeny carrying both the GFP fusion gene
and the nud mutation were identified by their ability to
grow without uridine and uracil supplementation and by their
temperature-sensitive nud phenotype at 42°C. To identify progeny carrying a GFP fusion in the background of a particular nud deletion strain in which the deletion allele is also
marked by pyr4 or pyrG, we rely on phenotypic
analyses. Specifically, for the cross between the
nudF or
nudA strain and the GFP-nudA, GFP-nudI, GFP-nudM or GFP-nudF
strains, the progeny that carry the GFP fusion proteins in the
nudF or
nudA background were selected by
the presence of the nud phenotype on a glycerol plate at
32°C and the presence of green fluorescence under the microscope using
nudF or
nudA as negative control, and
confirmed by Western analysis demonstrating the presence of the
GFP-fusion proteins. For the crosses between the
kinA
strain and the GFP-nudA, GFP-nudI, GFP-nudM, or GFP-nudF strains, the progeny that
carry the GFP fusion proteins in the
kinA background were
selected by the presence of the nud phenotype of the GFP
strains on YUU plates (repressive medium for the alcA
promoter) at 32°C and the smaller colony phenotype of the
kinA mutant on a glycerol plate. In addition, Southern blot analyses were used to confirm the presence of the
kinA allele in strains with various GFP fusion proteins.
Image Acquisition and Analyses, Immunostaining, and Western Blotting
Cells were grown in
TC3 culture dishes (Bioptechs, Butler,
PA) in 1.5 ml of MM + glycerol + pyridoxine medium at 32°C overnight. In contrast to ethanol or threonine that causes overexpression of the
alcA-driven genes, glycerol is a noninducing but
derepressing carbon source (Waring et al., 1989
), which does
not cause the alcA-driven dynein or NUDF to be overproduced
compared with the endogenous protein in a wild-type strain (our
unpublished data). Images were captured using an IX70 inverted
fluorescence microscope (Olympus, Tokyo, Japan) (with a 63× objective)
linked to a 5-MHz MicroMax cooled charge-coupled device camera
(Princeton Scientific Instruments, Monmouth Junction, NJ) as described
previously (Xiang et al., 2000
). For measuring the intensity
of GFP-dynein or dynactin comets in wild-type and
nudF
cells, individual GFP comets were segmented and the intensity sum of
each segment was measured using the Measuring Segment tool in the IPLab
software. Because the GFP-labeled dynein and dynactin comets that are
the closest to the hyphal tip are usually the brightest and have
similar signal intensity among wild-type cells, we only used values
obtained from these comets in each sequence. Data were processed using SigmaPlot and Microsoft Excel.
For visualizing microtubules in cells expressing GFP-NUDM, we used the
DM1A anti-
-tubulin antibody (Sigma-Aldrich, St. Louis, MO) for
immunostaining, with a procedure similar to what was described previously (Willins et al., 1995
; Han et al.,
2001
). For digestion of the cell wall,
-D-glucanase (16 mg/ml) and driselase (10 mg/ml) (Interspex Products, Foster City, CA) were used (Jung et
al., 2000
). Although the GFP comets (dynein, dynactin, and NUDF)
are present in nearly 100% of the living cells, after fixation, cell wall digestion, and staining, only a very low percentage of the cells
show GFP comets. Because this procedure significantly lowered the
GFP-comet signal intensity, we used a polyclonal anti-GFP antibody
(Chemicon International, Temecula, CA) to stain GFP after microtubule
staining. The anti-GFP antibody was used at 1/60. The anti-tubulin
antibody was used at 1/200. Cy3-anti-mouse (1/1000; Sigma-Aldrich) and
fluorescein isothiocyanate-anti-rabbit secondary antibodies (1/1000;
Sigma-Aldrich) were used to visualize microtubules and GFP-NUDM in the
same cell. Using this modified procedure, we were able to see GFP-NUDM
signals at microtubule ends near the hyphal tip in ~20% of fixed
cells. 4,6-Diamidino-2-phenylindole staining and Western blotting
analyses were done as described previously (Zhang et al.,
2002
).
| |
RESULTS |
|---|
|
|
|---|
Cytoplasmic Dynein and Dynactin Require Each Other for Microtubule Plus-End Localization
Our genetic analysis indicated that the nudM gene
encodes the A. nidulans p150 dynactin protein (GenBank
accession no. AY158343). NUDM shows 43.9% overall sequence identity to
the N. crassa dynactin protein RO3 (Tinsley et
al., 1996
) and contains the CAP-Gly microtubule-binding motif at
its N terminus (the GCG program). We have constructed a
GFP-nudM strain in which the endogenous nudM gene
was replaced by a functional GFP-nudM fusion gene. The
GFP-NUDM fusion protein forms dynamic comet-like structures that
locate on the distal plus ends of microtubules near the hyphal tip
(Figure 1, A and B), a behavior similar
to that exhibited by GFP-NUDA (cytoplasmic dynein heavy chain),
GFP-NUDI (cytoplasmic dynein IC), and GFP-NUDF (the LIS1-like protein)
(Xiang et al., 2000
; Han et al., 2001
; Zhang
et al., 2002
).
|
To test whether cytoplasmic dynein plays a role in the localization of
dynactin, we crossed the GFP-nudM strain to the
nudA deletion mutant,
nudA. In the
nudA mutant, the region covering the first four
ATP-binding sites of the heavy chain is replaced by the
pyrG-selective marker gene and the heavy chain protein is
not detectable (Xiang et al., 1995a
). Interestingly, in most of the
nudA cells, the GFP-NUDM dynactin comets were no
longer observed near the hyphal tip (Figure
2). Because microtubules in the
nudA mutant reach the hyphal tip (Figure 2), our result suggests that cytoplasmic dynein is required for dynactin's plus-end accumulation. Similar to our previous observation that an Arp1 mutation
abolishes GFP-NUDA localization (Xiang et al., 2000
), herein
we found that the nudM116 mutation of p150 dynactin also abolishes GFP-NUDA localization (Figure 2), further supporting dynactin's role in dynein localization. Together, these results indicate that dynein and dynactin are dependent upon each other for
their accumulation at microtubule plus ends.
|
Presence of Cytoplasmic Dynein Is Important for Localization of NUDF
We have noticed that the signal intensities of GFP-NUDF comets are
relatively lower in various loss-of-function mutants of cytoplasmic
dynein (nudA2 in the heavy chain, nudI416 in the
IC) and dynactin (nudK317 in Arp1, nudM116 in the
p150 dynactin). The decrease in intensity is most obvious in the dynein
heavy chain deletion mutant
nudA (Figure
3). Because NUDF/LIS1 interacts directly
with the dynein heavy chain (Sasaki et al., 2000
; Hoffmann et al., 2001
; Tai et al., 2002
), we tested
whether the NUDF protein level is decreased in the absence of the
dynein heavy chain. Our Western blot and densitometry analyses showed
that the GFP-NUDF protein level was not significantly decreased in
nudA (Figure 3; our unpublished data). Together,
these results suggest that the presence of cytoplasmic dynein may
enhance NUDF's association with microtubule plus ends. This is
consistent with previous observations in mammalian cells that the
signal intensity of the kinetochore-localized LIS1
decreases in dynein-defective mitotic cells (Coquelle et al., 2002
; Tai et al., 2002
).
|
nudF Deletion Mutant Increases Signal Intensity of GFP-Cytoplasmic Dynein and Dynactin Comet-like Structures
NUDF is apparently not required for cytoplasmic dynein heavy chain
targeting to the microtubule plus ends because bright GFP-NUDA comets
are obvious at the hyphal tip in the background of a nudF deletion mutant (Zhang et al., 2002
; Figure
4). Herein, we show that the GFP-NUDI and
GFP-NUDM comets are also bright in the nudF deletion mutant,
suggesting that NUDF is also not required for the plus end localization
of dynein IC as well as the p150 dynactin (Figure 4). During our
observation of many cells, we have had the impression that the
GFP-NUDA, GFP-NUDI, and GFP-NUDM comets are brighter in the
nudF deletion mutant background compared with that in the
wild-type background. To show the differences in intensity quantitatively, we measured the fluorescence intensity of individual comets close to the hyphal tip of each cell. Our measurements showed
that the sum of fluorescence of individual GFP-NUDA, GFP-NUDI and
GFP-NUDM comets in the nudF deletion cells is significantly higher than that in wild-type cells (Figure
5). These results suggest that although
NUDF does not play a role in dynein/dynactin targeting to microtubule
plus ends, it could be required for the dynamic departure of
dynein/dynactin from the microtubule plus ends. In some
nudF cells, a cloud of background fluorescence around the
hyphal tip can be observed (Figure 4). Although we do not have a good
interpretation of this result, it is possible that overaccumulation of
the proteins causes them to fall off the microtubule ends.
|
|
Deletion of kinA Kinesin Gene Diminishes Plus-End Comets of Both Cytoplasmic Dynein and Dynactin, but Not NUDF
Because cytoplasmic dynein is a minus-end-directed microtubule
motor, its in vivo localization to the plus ends of microtubules may
depend on the transport function of a plus-end motor such as kinesin.
So far, at least seven kinesins have been found in the A. nidulans genome (Fischer, unpublished data; Liu, personal communication), and KINA is the only identified conventional kinesin. Although the kinA deletion mutant grows better than the
dynein mutants, it does exhibit a partial defect in nuclear positioning (Requena et al., 2001
). In addition, although microtubules
look normal in the kinA deletion mutant, genetic evidence
suggests that they are more stable than in wild-type cells, which is
also similar to what has been described for the cytoplasmic dynein mutants (Willins et al., 1995
; Han et al., 2001
;
Requena et al., 2001
). To test whether KINA is involved in
cytoplasmic dynein localization to the plus ends in vivo, we crossed a
kinA deletion strain (
kinA) to the
GFP-nudA (cytoplasmic dynein HC) strain and the
GFP-nudI strain (cytoplasmic dynein IC), and observed GFP-NUDA as well as GFP-NUDI in the
kinA background.
Interestingly, cytoplasmic dynein comet-like structures near the hyphal
tip are much less obvious in the
kinA mutant (Figure
6). These results demonstrated that KINA
is important for cytoplasmic dynein accumulation to the plus ends of
microtubules.
|
Because dynactin and NUDF/LIS1 also accumulate at the plus ends of
microtubules, it was of interest to test whether their localization is
also KINA dependent. To do this, we crossed
kinA to the
GFP-nudM (p150 dynactin) strain and to the
GFP-nudF strain and observed GFP-NUDM as well as GFP-NUDF in
the
kinA background. Our results show that similar to
GFP-NUDA, GFP-NUDM comets structures near the hyphal tip are hardly
visible in the
kinA mutant (Figure 6), indicating that
KINA is also important for the plus-end accumulation of dynactin.
However, GFP-NUDF comets were easily observed near the hyphal tip
(Figure 6), suggesting that the plus-end localization of NUDF does not
require the KINA kinesin. However, consistent with the notion that KINA
is required for dynein/dynactin localization and that the presence of
dynein/dynactin may enhance NUDF's association with microtubule plus
ends, we found that the signal intensity of many GFP-NUDF comets was lower.
To address whether KINA functions only in the cytoplasmic dynein
genetic pathway, a previous study has analyzed the double mutant
containing a temperature-sensitive nudA allele,
nudA1, and the
kinA allele (Requena et
al., 2001
). Although the nuclear migration phenotype of the double
mutant resembles that of the nudA1 single mutant, the double
mutant grows more poorly than the nudA1 single mutant
(Requena et al., 2001
). In this study, we compared an
alcA-promoter-based nudA conditional null mutant (GFP-nudA) with the corresponding double null mutant
(GFP-nudA/
kinA). On a glucose-containing
medium that shuts off the alcA promoter, the double null
mutant exhibited a more severe growth defect than that of the
nudA or the kinA single null mutant (Figure
7A). However, the nuclear migration
phenotype of the double null mutant is similar to that exhibited by the
nudA single null mutant when germlings of similar lengths
are compared (Figure 7B). These results suggest that, in addition to
being involved in dynein-related functions such as nuclear migration,
KINA also participates in pathway(s) that regulate other cellular
processes.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we have provided the genetic evidence that KINA, a
conventional kinesin, is involved in the localization of both
cytoplasmic dynein and dynactin to the plus ends of microtubules in
A. nidulans. In the deletion mutant of kinA, the
microtubule plus-end accumulation of both cytoplasmic dynein (the NUDA
heavy chain and the NUDI IC) and dynactin (the NUDM p150 dynactin) are significantly diminished. Although it is possible that KINA may transport cytoplasmic dynein and dynactin toward the microtubule plus
end, other possibilities also exist. For example, KINA itself may be
targeted to the plus ends, and its presence there is required for
dynein/dynactin to associate to the plus ends. However, a previous
study has shown that KINA itself is not a plus-end-associated protein.
Although in many cells the GFP-KINA fusion protein does not show
specific localization, it does light up microtubule-like structures in
some cells (Requena et al., 2001
). Similarly, a homologous
conventional kinesin in Ustilago maydis is also a
cytoplasmic protein, which exhibits localization to microtubule-like
structures only when cells are treated to deplete ATP (Lehmler et
al., 1997
). At this point, we have not detected any physical
interaction between KINA and cytoplasmic dynein. Therefore, it is also
possible that the effect of kinA deletion on dynein and
dynactin localization is indirect. For example, the deletion of
kinA may change the microtubule ends in such a way that
dynein and dynactin can no longer be associated. In fact, genetic
evidence has shown that the kinA deletion mutant slows down
microtubule dynamics (Requena et al., 2001
). However,
because dynein and dynactin are clearly accumulated at the plus ends of
microtubules in the nudF mutant, in which microtubules are
also less dynamic (Han et al., 2001
), it is unlikely that
dynein/dynactin's failure to accumulate at the microtubule plus ends
in the kinA mutant is caused by microtubules being too stable.
Interestingly, the KINA-dependent mechanism may not be the only mechanism for dynein/dynactin's accumulation to the plus ends of microtubules. In some kinA deletion cells, faint dynein and dynactin comets moving toward the hyphal tip can still be observed. This suggests the participation of a redundant player. The fact that the kinA deletion mutant exhibits a nuclear distribution defect, which is less severe than that of a dynein heavy chain null mutant, is also consistent with KINA being a player in the dynein pathway whose function is partially redundant with other protein(s) yet to be identified.
It would be interesting to know whether dynein/dynactin's
localization to the microtubule plus ends in higher eukaryotic cells also depends on conventional kinesin. Several studies have suggested that cytoplasmic dynein may be present on cargoes that are transported by kinesin (Hirokawa et al., 1990
; reviewed by Goldstein and
Yang, 2000
; Ma and Chisholm, 2002
; Gross et al., 2002
). A
very recent study in Drosophila has also demonstrated the
role of kinesin in dynein localization (Brendza et al.,
2002
). Whether other +TIPs use kinesins to get to the plus ends is also
an interesting question. APC, a tumor suppressor protein that
associates with another plus-end protein EB1, physically interacts with
KAP3, a KIF3A-KIF3B kinesin superfamily-associated protein, and this
interaction is important for APC's accumulation to the membrane
protrusions (Jimbo et al., 2002
). Our results show that
NUDF's localization is not dependent upon the conventional kinesin
KINA, suggesting that +TIPs may use different mechanisms for their
microtubule plus-end targeting. The CLIP170 protein that physically
interacts with LIS1 may be targeted to the microtubule plus end by
copolymerization with tubulins (Diamantopoulos et al., 1999
;
Perez et al., 1999
; Coquelle et al., 2002
).
However, its localization to the plus end rather than along the length
of a microtubule would require its dissociation from the
early-polymerized segments, and how that may be achieved is not clear.
The growing end distinguishes itself from the rest of the microtubule
in both its structure and the presence of a GTP cap (reviewed by Desai
and Mitchison, 1997
). Although the size of the GTP cap is estimated to
be very small (Panda et al., 2002
), such a cap combined with
the structure feature of a growing end may be sufficient to prevent the
proteins from falling off the end.
In this study, we have also found that cytoplasmic dynein is required
for the plus-end localization of dynactin. This result seems
contradictory to the observation made in mammalian cells that only
dynactin but not dynein accumulates at the microtubule plus end under
physiological conditions (Vaughan et al., 1999
; Habermann
et al., 2001
). However, it is possible that cytoplasmic dynein is required for the initial targeting but not for maintaining the association of dynactin to the microtubule plus end. In contrast to
A. nidulans in which the plus-end localization of
cytoplasmic dynein has been observed under physiological temperatures
(Xiang et al., 2000
; Han et al., 2001
), the
plus-end localization of cytoplasmic dynein in mammalian cells has only
been observed upon a shift to a lower temperature (Vaughan et
al., 1999
). This may indicate that mammalian cytoplasmic dynein
but not dynactin leaves the microtubule plus end frequently under
physiological conditions.
Interestingly, NUDF/LIS1 may be required for the departure of
dynein and dynactin from the microtubule plus end. The fluorescence intensities of the dynein and dynactin comets near the hyphal tip are
significantly higher in the absence of NUDF. Because cytoplasmic dynein
is involved in retrograde vesicle transport in filamentous fungi
(Seiler et al., 1999
), the plus-end dynein/dynactin in
filamentous fungi may also represent a cargo-loading site as has been
suggested and recently demonstrated in mammalian cells (Vaughan
et al., 1999
, 2002
; Valetti et al., 1999
;
Habermann et al., 2001
). Because LIS1 physically interacts
with both the cargo-binding region and the first AAA
(ATPases associated with cellular
activities) repeat of the dynein heavy chain, it was
proposed that LIS1 may be involved in the coordination between motor
activity and cargo binding in vivo (Tai et al., 2002
). Thus,
it is possible that in the absence of NUDF, dynein and dynactin fail to
depart from the microtubule plus ends toward the minus end, which
results in an overaccumulation of dynein and dynactin at the plus end
(Figure 8).
|
The function of the plus-end cytoplasmic dynein may be multifold.
Recent work has shown that in the budding yeast Saccharomyces cerevisiae, cytoplasmic dynein IC is also localized to the
microtubule plus end (Beach and Bloom, personal communication). The
microtubules and their motors in S. cerevisiae are used only
for spindle function and nuclear migration (Cottingham et
al., 1999
), and thus the plus-end dynein may be involved in
regulating microtubule-cortex interaction and microtubule dynamics,
which are important for nuclear migration and spindle orientation in
fungi (Oakley and Morris, 1981
; Willins et al., 1995
;
Carminati and Stearns, 1997
; Shaw et al., 1997
; Cottingham
et al., 1999
; Adames and Cooper, 2000
; Han et
al., 2001
; Requena et al., 2001
; Tran et
al., 2001
). Our previous observation that microtubules are less
dynamic in both the nudF and dynein mutant cells indicates
that NUDF may also regulate microtubule dynamics (Han et
al., 2001
). In some
nudF cells, disorientated
dynein/dynactin comets can be observed, which is also consistent with
some microtubules curling around and growing back from the hyphal tip
in the nudF and dynein mutant cells (see movie
GFP-NUDI/
nudF in Supplementary Materials; Han et al.,
2001
).
Note added in proof. Since the acceptance of this article, the articles listed below, covering two related topics, have been published.
Topic A: A nidulans and S. cerevisiae dynein localization: Efimov, V.P. (2003). Roles of NUDE and NUDF proteins of Aspergillus nidulans: insights from intracellular localization and overexpression effects. Mol. Biol. Cell. 14, 871-888. Lee, W.L., Oberle, J.R., and Cooper, J.A. (2003). The role of the lissencephaly protein Pac1 during nuclear migration in budding yeast. J. Cell Biol. 160, 355-364. Liu, B., Xiang, X., Lee, Y.R. (2003). The requirement of the LC8 dynein light chain for nuclear migration and septum positioning is temperature dependent in Aspergillus nidulans. Mol. Microbiol. 47, 291-301. Sheeman, B., Carvalho, P., Sagot, I., Geiser, J., Kho, D., Hoyt, M.A., and Pellman, D. (2003). Determinants of S. cerevisiae dynein localization and activation. Implications for the mechanism of spindle positioning. Curr Biol. 13, 364-372. Xiang, X. (2003). L1S1 at the microtubule plus end and its role in dynein-mediated nuclear migration. J. Cell Biol. 160, 289-290. Topic B: The kinesin-dynein relationship in Drosophila Duncan, J.E., Warrior, R. (2002). The cytoplasmic dynein and kinesin motors have interdependent roles in patterning the Drosophila oocyte. Curr. Biol. 12, 1982-1991. Januschke, J., Gervais, L., Dass, S., Kaltschmidt, J.A., Lopez-Schier, H., Johnston, D.S., Brand, A.H., Roth, S., and Guichet, A. (2002). Polar transport in the Drosophila oocyte requires dynein and kinesin I cooperation. Curr Biol. 12, 1971-1981. Palacios, I.M., and Johnston, D.S. (2002). Kinesin light chain-independent function of the kinesin heavy chain in cytoplasmic streaming and posterior localisation in the Drosophila oocyte. Development. 129, 5473-5485.| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. Teresa Dunn, John. A. Hammer, Vladimir P. Efimov, and Tian Jin for helpful reading of the manuscript. We thank Dr. Bo Liu for communicating information about A. nidulans kinesins. We also thank Drs. Kerry Bloom and Dale Beach for communicating the budding yeast results on dynein IC localization. The p150 dynactin gene was initially identified in Cereon Microbe Sequence database (http://microbial.cereon.com). We thank the Monsanto Company for allowing us to use this database and we also thank the stuff members for help. This work is supported by a National Science foundation grant and a Uniformed Services University of the Health Sciences intramural grant (to X.X.).
| |
FOOTNOTES |
|---|
Online version of this article contains video material for some
figures. Online version available at www.molbiolcell.org.
Corresponding author. E-mail address:
xxiang{at}usuhs.mil.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-08-0516. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-08-0516.
| |
REFERENCES |
|---|
|
|
|---|
-D-glucanase as a substitute for Novozyme 234 in immunofluorescence, and protoplasting.
Fungal Genet. Newsl.
47, 65-66.
-tubulin mutation in Aspergillus nidulans that blocks microtubule function without blocking assembly.
Cell
24, 837-845[CrossRef][Medline].
tubulin mutation suppresses nuclear migration mutations in Aspergillus nidulans.
Genetics
141, 1287-1298[Abstract].
tubulin onto centrosomes.
Mol. Biol. Cell
11, 2047-2056This article has been cited by other articles:
![]() |
N. Zekert and R. Fischer The Aspergillus nidulans Kinesin-3 UncA Motor Moves Vesicles along a Subpopulation of Microtubules Mol. Biol. Cell, January 1, 2009; 20(2): 673 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vogt and S. Seiler The RHO1-specific GTPase-activating Protein LRG1 Regulates Polar Tip Growth in Parallel to Ndr Kinase Signaling in Neurospora Mol. Biol. Cell, November 1, 2008; 19(11): 4554 - 4569. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Helmstaedt, K. Laubinger, K. Vosskuhl, O. Bayram, S. Busch, M. Hoppert, O. Valerius, S. Seiler, and G. H. Braus The Nuclear Migration Protein NUDF/LIS1 Forms a Complex with NUDC and BNFA at Spindle Pole Bodies Eukaryot. Cell, June 1, 2008; 7(6): 1041 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Takeshita, Y. Higashitsuji, S. Konzack, and R. Fischer Apical Sterol-rich Membranes Are Essential for Localizing Cell End Markers That Determine Growth Directionality in the Filamentous Fungus Aspergillus nidulans Mol. Biol. Cell, January 1, 2008; 19(1): 339 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Enke, N. Zekert, D. Veith, C. Schaaf, S. Konzack, and R. Fischer Aspergillus nidulans Dis1/XMAP215 Protein AlpA Localizes to Spindle Pole Bodies and Microtubule Plus Ends and Contributes to Growth Directionality Eukaryot. Cell, March 1, 2007; 6(3): 555 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhuang, J. Zhang, and X. Xiang Point Mutations in the Stem Region and the Fourth AAA Domain of Cytoplasmic Dynein Heavy Chain Partially Suppress the Phenotype of NUDF/LIS1 Loss in Aspergillus nidulans Genetics, March 1, 2007; 175(3): 1185 - 1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Taya, T. Shinoda, D. Tsuboi, J. Asaki, K. Nagai, T. Hikita, S. Kuroda, K. Kuroda, M. Shimizu, S. Hirotsune, et al. DISC1 Regulates the Transport of the NUDEL/LIS1/14-3-3{varepsilon} Complex through Kinesin-1 J. Neurosci., January 3, 2007; 27(1): 15 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fink and G. Steinberg Dynein-dependent Motility of Microtubules and Nucleation Sites Supports Polarization of the Tubulin Array in the Fungus Ustilago maydis Mol. Biol. Cell, July 1, 2006; 17(7): 3242 - 3253. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zhou, W. Zimmerman, X. Liu, and R. L. Erikson A mammalian NudC-like protein essential for dynein stability and cell viability PNAS, June 13, 2006; 103(24): 9039 - 9044. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P. Efimov, J. Zhang, and X. Xiang CLIP-170 Homologue and NUDE Play Overlapping Roles in NUDF Localization in Aspergillus nidulans Mol. Biol. Cell, April 1, 2006; 17(4): 2021 - 2034. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xiang A +TIP for a smooth trip J. Cell Biol., February 27, 2006; 172(5): 651 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Williams, C. J. Locke, A. L. Braden, K. A. Caldwell, and G. A. Caldwell Epileptic-like convulsions associated with LIS-1 in the cytoskeletal control of neurotransmitter signaling in Caenorhabditis elegans Hum. Mol. Genet., September 15, 2004; 13(18): 2043 - 2059. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Ligon, M. Tokito, J. M. Finklestein, F. E. Grossman, and E. L. F. Holzbaur A Direct Interaction between Cytoplasmic Dynein and Kinesin I May Coordinate Motor Activity J. Biol. Chem., April 30, 2004; 279(18): 19201 - 19208. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||