![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 14, Issue 4, 1583-1596, April 2003



and
*Institute of Medical Technology and Tampere University
Hospital, Lenkkeilijänkatu 6, 33014 University of Tampere,
Tampere, Finland;
Department of Biological
Chemistry, David Geffen School of Medicine, UCLA, Los Angeles,
California 90095; and
Electron Microscopy Unit,
Institute of Biotechnology, 00014 University of Helsinki, Helsinki,
Finland
| |
ABSTRACT |
|---|
|
|
|---|
The organization of multiple mitochondrial DNA (mtDNA) molecules in discrete protein-DNA complexes called nucleoids is well studied in Saccharomyces cerevisiae. Similar structures have recently been observed in human cells by the colocalization of a Twinkle-GFP fusion protein with mtDNA. However, nucleoids in mammalian cells are poorly characterized and are often thought of as relatively simple structures, despite the yeast paradigm. In this article we have used immunocytochemistry and biochemical isolation procedures to characterize the composition of human mitochondrial nucleoids. The results show that both the mitochondrial transcription factor TFAM and mitochondrial single-stranded DNA-binding protein colocalize with Twinkle in intramitochondrial foci defined as nucleoids by the specific incorporation of bromodeoxyuridine. Furthermore, mtDNA polymerase POLG and various other as yet unidentified proteins copurify with mtDNA nucleoids using a biochemical isolation procedure, as does TFAM. The results demonstrated that mtDNA in mammalian cells is organized in discrete protein-rich structures within the mitochondrial network. In vivo time-lapse imaging of nucleoids show they are dynamic structures able to divide and redistribute in the mitochondrial network and suggest that nucleoids are the mitochondrial units of inheritance. Nucleoids did not colocalize with dynamin-related protein 1, Drp1, a protein of the mitochondrial fission machinery.
| |
INTRODUCTION |
|---|
|
|
|---|
Mammalian mitochondrial DNA (mtDNA) is a 16.5-kb
circular double-stranded DNA (Anderson et al., 1981
; Bibb
et al., 1981
) present in one to several thousand of copies
per cell (e.g., Takamatsu et al., 2002
). All proteins
involved in mtDNA maintenance are encoded by the nuclear genome. These
are traditional proteins in replication and repair such as the mtDNA
polymerase POLG, but also include proteins directly or indirectly
involved in e.g., segregation.
MtDNA in the yeast Saccharomyces cerevisiae and to a lesser
extent in a few other species, appears to be organized in discrete foci
within mitochondria called nucleoids (Miyakawa et al.,
1984
). These have been inferred to be the units of inheritance each
containing several copies of yeast mtDNA (Jacobs et al.,
2000
; MacAlpine et al., 2000
and references therein).
Biochemical purification and protein analysis have defined several of
the constituents of yeast nucleoids (Miyakawa et al., 1995
;
Newman et al., 1996
; Kaufman et al., 2000
). One
of the core components is the Abf2 protein (Abf2p), an orthologue of
the human mitochondrial transcription factor TFAM. The function of
Abf2p in yeast is essential for mtDNA maintenance by providing a
mtDNA-packaging function. It also modestly stimulates yeast
transcription in in vitro assays (Parisi et al., 1993
). A
mouse TFAM knockout shows embryonic lethality with complete loss of
mtDNA (Larsson et al., 1998
), but this is generally believed to be the result of impairment of transcription initiation that would
generate primers for mtDNA replication.
Other yeast nucleoid components include Rim1p, the yeast
single-stranded DNA-binding protein, and also several proteins with separate roles believed to be unrelated to nucleoid maintenance. Such
proteins include
-ketoglutarate dehydrogenase subunits and aconitase
(Kaufman et al., 2000
). It seems likely that these
dual-function nucleus-encoded enzymes that nevertheless have conserved
catalytic cores have randomly acquired additional functions and
coevolved with mtDNA in various eukaryotic lineages. This suggests that a great variability in the types of proteins associated with nucleoids in different species can be expected.
Although mtDNA inheritance is significantly different between budding
yeast and mammalians, there is both genetic and cell biological
evidence to believe that also in mammals mtDNA is organized in
nucleoid-like structures (Jacobs et al., 2000
; Lehtinen
et al., 2000
). Nevertheless, only our recent demonstration
of specific colocalization of Twinkle-EGFP with mtDNA in punctate
intramitochondrial structures for the first time clearly visualized the
existence of discrete mtDNA-protein complexes in human mitochondria
(Spelbrink et al., 2001
). Twinkle shows similarity to the
bacteriophage T7 primase/helicase gene 4 protein. Mutations in the gene
for Twinkle, C10orf2, are associated with forms of a late
onset autosomal dominant disorder, progressive external opthalmoplegia,
characterized at the molecular level by the accumulation of multiple
mtDNA deletions.
Mitochondria are maintained as a highly active and flexible network.
This is accomplished by mitochondrial growth, fusion, and division, and
active movement to sites of energy demand. This ensures proper number
and distribution of mitochondria. The distribution and inheritance of
mtDNA during these processes has been relatively underexplored,
especially in mammalian cells, because of a lack of appropriate markers
to directly visualize mtDNA in vivo. Nevertheless, in recent years,
many of the proteins involved in the mitochondrial division and fusion
machinery have been identified. Drosophila, yeast, and
mammalian Fzo/Mitofusin proteins are essential for mitochondrial fusion
(Hales and Fuller, 1997
; Hermann et al., 1998
; Santel and
Fuller, 2001
). They are transmembrane GTPases with the catalytic domain
exposed to the cytoplasm.
The first factor described to be responsible for mitochondrial division
is the Caenorhabditis elegans and mammalian dynamin-related protein Drp1 (also known as Dlp1, Dymple; Kamimoto et al.,
1998
; Smirnova et al., 1998
; Labrousse et al.,
1999
; Pitts et al., 1999
) and its yeast orthologue Dnm1
(Bleazard et al., 1999
; Sesaki and Jensen, 1999
). Mutations
in this protein cause mitochondria to collapse into perinuclear
aggregates consisting of long interconnected tubules. This is probably
the consequence of a shift in the balance between fission and fusion
(Smirnova et al., 2001
). Genetics screens in yeast point at
MDV1 and FIS1 as Drp1(Dnm1) partners (Fekkes et al., 2000
;
Mozdy et al., 2000
; Tieu and Nunnari, 2000
).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture and Transfection
HEK293EBNA, 143B osteosarcoma, A549 adenocarcinoma cells and
primary human fibroblasts were cultured as described (Spelbrink et al., 2000
). Cells were seeded in six-well plates 1-2 d
before transfection at 40-70% density. Transfection used 10 µl
lipofectamine (Life Technologies, Paisley, United Kingdom) for
293 cells, A549 cells and fibroblasts diluted in 1 ml Optimem (Life
Technologies) according to the manufacturer's protocol. Five hours
after transfection, we added 2 ml fresh medium and replaced the medium
24 h after transfection. For 143B cell transfection, we used
FuGENE 6 (Roche, Mannhiem, Germany) as per the manufacturer's specifications.
Expression Constructs
Twinkle-EGFP, Twinkle-MycHis, and GFP-Drp1 constructs were as
described before (Smirnova et al., 2001
; Spelbrink et
al., 2001
)
Immunocytochemistry plus Confocal Microscopy and Time-lapse Epifluorescence Microscopy
Mitotracker Red (Molecular Probes, Eugene, Oregon) staining and
cell preparation were as described elsewhere (Spelbrink et al., 2000
). Cells were fixed for 20 min in PBS/3.7%
formaldehyde/5% sucrose at 37°C, washed twice with PBS and mounted
using Vectashield mounting medium (Vector Laboratories, Burlingame,
CA). For ICC, fixed cells were processed by lysis for 15 min in
PBS/0.5% Triton X-100 at room temperature, washed twice in PBS, and
blocked in PBS/3% BSA. For colocalization studies of Drp1 and mtSSB we
dehydrated and rehydrated samples before ICC as described below for
(5-bromo-2-deoxy-uridine) BrdU labeling. Antibodies were diluted in
PBS/3% BSA. Coverslips were incubated with the antibody solution on
slides for 1 h at room temperature. Dilutions were as follows:
mouse anti-c-Myc mAb 9E10 (Roche) 1:1000 dilution of 5 mg/ml stock;
rabbit anti-human TFAM (kind gift of Dr R. Wiesner) 1:200; rabbit
anti-mtSSB (kind gift of Dr M. Zeviani) 1:100; rabbit anti-POLG (Santa
Cruz, Santa Cruz, CA, sc-5930) 1:50; and rabbit anti-POLG2 (kind gift
of Dr. P. Lestienne) 1:400. Slides were washed three times with PBS and incubated with a 1:200 dilution of secondary biotinylated antibodies (anti-mouse IgG or anti-rabbit IgG, Vector Laboratories, Inc.; anti-goat IgG, DAKO, Glostrup, Denmark), washed as above, and incubated
with a 1:200 dilution of either streptavidin-Texas Red/Rhodamine or
streptavidin-Fluorescein (Vector Laboratories Inc.) All fixed samples
were examined by confocal scanning laser microscopy, using a Perkin
Elmer-Cetus/Wallac UltraView LCI system (Wellesly, MA). Confocal images
were processed by the UltraView 4.0 software and further handled using
Microsoft Photo Editor 3.01 and Adobe Photoshop 6.0 to obtain
appropriate sections with best contrast/brightness and resolution.
Individual images were assembled using Microsoft Powerpoint and further
handled with Adobe Photoshop 6.0 again to obtain best possible
resolution for final printing.
For time-lapse imaging, COS-7 cells were grown in DMEM supplemented with 10% fetal calf serum. Cells were seeded onto glass-bottom dishes (Mat-Tek, Ashland, MA) for in vivo observation and transfected by using FuGENE transfection reagent (Roche) according to the manufacturers' procedures. Before observation, cells were incubated with 0.1 µM MitoTracker Red for 10 min at 37°C. The images were acquired 18 h after the start of the transfection by a cooled CCD camera (PXL; Photometrics) powered by Isee Inovision Corporation software. Time-lapse images were collected every 15 s using Plan 100×/1.25 NA oil immersion objective at room temperature. Individual time-lapse frames were imported to the UltraView 4.0 software, to obtain images of "regions of interest," these were again exported and handled further as above. For the measurement of mitochondrial and Twinkle-GFP movements, all the individual frames were imported into NIH Image 1.62. For each chosen mitochondrion, one of its tips was followed through the frames acquired every 15 s for >7 min. The average velocity was calculated from the measured distances, including the points when the mitochondrion has not moved. The results are expressed as a mean value ± SE.
Metabolic Labeling of mtDNA using BrdU
BrdU and an mAb specific for BrdU in single-stranded DNA were
from Roche. One or 2 d before BrdU labeling 143B osteosarcoma cells deficient for cytoplasmic thymidine kinase (TK
) were seeded at
low density on coverslips. BrdU was added to a final concentration of
10 µM and cells were incubated for 2-24 h. Cells were subsequently fixed and lysed as described above for immunocytochemistry. This was
followed by dehydration using serial washes of 70, 90, and 100%
ethanol. Cells were rehydrated using several PBS washes. DNA was
denatured as described (Davis and Clayton, 1996
). Before antibody
incubations the coverslips were blocked for 15 min using 3% BSA in
PBS. The anti-BrdU mAb was used as a 1:50 dilution in PBS/1% BSA.
Horse anti-mouse-Fluorescein IgG was used as a secondary antibody at a
1:200 dilution in PBS/3% BSA. Slides were subsequently used for ICC or
directly mounted. For the detection of Myc-tagged Twinkle using the
anti-Myc monoclonal in ICC, BrdU-ICC slides were postfixed for 10 min
in PBS/3.7% formaldehyde/5% sucrose at 25°C and washes three times
in PBS before Myc-ICC. After the anti-Myc mAb incubation, slides were
incubated with 1:200 biotinylated anti-mouse IgG as secondary antibody
followed by streptavidin-Texas Red. This resulted in very little or no
cross-reactivity of the biotinylated anti-mouse IgG with the BrdU mAb
that was presumably inaccessible due to cross-linked horse
anti-mouse-Fluorescein IgG (compare Figures 3, D and E, lower left
corner, and unpublished data).
Immunoelectron Microscopy
For immunoelectron microscopy HEK 293 cells were grown on Termanox plastic dishes, fixed with 0.01% glutaraldehyde, and 3.5% paraformaldehyde in 0.1 M phosphate buffer, pH 7.2, and embedded in Lowicryl HM 20 (Agar Scientific, Stamsted, United Kingdom). Thin sections were stained by indirect immunogold labeling according to standard methods with the rabbit anti-human TFAM antibody (1:400) and 5- or 10-nm protein A-gold and poststained with uranyl acetate and lead citrate.
Isolation of Mitochondria
HEK293EBNA cells were disrupted to isolate mitochondria in a
chilled 5 ml Dounce homogenizer by 25 strokes at medium speed, essentially as described (Spelbrink et al., 2000
).
Mitochondria were further purified by isopycnic gradient
centrifugation: the pellet was resuspended in 1 mM EDTA, 0.1% BSA, and
10 mM Tris-HCl, pH 7.5, containing 0.8 M sucrose, layered on top of a
continuous sucrose gradient from 1 to 2 M sucrose in the same buffer
and centrifuged at 80,000 × g for 2 h.
Mitochondria were collected and diluted with 2 vol of 1 mM EDTA, 10 mM
Tris-HCl, pH 7.4 and pelleted at 16,000 × g for 15 min. The purified mitochondrial pellet was stored at
80°C.
Isolation and Characterization of mtDNA Nucleoids
We modified a published isolation procedure for mtDNA nucleoids
from yeast (Newman et al., 1996
). Briefly, purified
mitochondria were thawed on ice, resuspended in NE2 buffer (0.25 M
sucrose, 20 mM Tris-HCl, pH 7.6, 2 mM EDTA, 7 mM
-mercaptoethanol),
and diluted with equal volume of 0.5× NE2 buffer to a final
concentration of 5-7 mg mitochondrial protein/ml. Spermidine (1.0 M)
was added to a final concentration of 3 mM, and mitochondria were lysed by adding 20% NP40 to a final concentration of 0.5%. After 15 min
with gentle stirring, the lysate was fractionated at 12,000 × g for 20 min into supernatant (S0) and pellet (P0)
fractions. The pellet fraction was resuspended as above.
Next, supernatant and pellet fractions were layered on top of step
gradients comprised of 3.5 ml 20%/2.5 ml 40%/1.8 ml 60%/0.9 ml 75%
sucrose in gradient buffer (20 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM
spermidine, 7 mM
-mercaptoethanol, 1 mM PMSF) and centrifuged at
111,000 × g for 75 min. Gradients were fractioned and
analyzed for distribution of mtDNA and protein. mtDNA containing samples derived from the S and P fractions from an initial NP40 extraction are hereafter referred to as S-1 and P-1,
respectively. P-1 sample was collected, diluted with 2 vol
ice cold gradient buffer, treated again with 0.5% NP40 for 15 min, and
centrifuged through a second step gradient at 49,000 × g for 3 h, to yield S-2 and P-2.
Sucrose gradient samples were dialyzed at 4°C for several hours against NE2 buffer in order to reduce the sucrose concentration before analysis by SDS-PAGE
Nucleoid Analyses
mtDNA distribution in gradients was determined by PCR. After
proteinase K treatment mtDNA was extracted by ethanol precipitation and
amplified with specific primers FR6 5' GGTGCAGCCGCTATTAAAGGTCG 3' and
FR7 5' CCGATCAGGGCGTAGTTTG 3', amplifying a 685-base pair fragment of
human mtDNA corresponding to base pairs 3013-3698 of the Cambridge
Reference Sequence (as described, Spelbrink et al., 2000
).
Protein distribution was analyzed by SDS-PAGE on 10% or 14%
polyacrylamide gels according to Laemmli (1970)
or according
Schägger and Von Jagow (1987)
. PAGE markers were from Bio-Rad
(Hercules, CA). Before loading all samples were heated at 95°C for 5 min in SDS sample buffer (50 mM Tris-HCl, pH 6.8, 12% glycerol, 4% SDS, 0.01% Serva Blue G, 0.1 M DTT). After electrophoresis, gels were
stained with 0.1% Coomassie Brilliant Blue in 40% methanol, 10%
acetic acid for 30 min. Destaining was carried out in 40% methanol,
10% acetic acid followed by 10% methanol, 10% acetic acid.
Coomassie-stained gels were next silver-stained (Morrissey, 1981
).
Immunoblot analysis was essentially done as described
(Spelbrink et al., 2000
). Primary antibodies and dilutions
used were as follows: mouse anti-c-Myc mAb 9E10 (Roche) 1:15,000;
mouse anti-COXII and mouse anti-COXIV monoclonal (kind gift of Dr R. Capaldi) 1:10,000; rabbit anti-human TFAM 1:10,000; rabbit anti-mtSSB
1:5000; rabbit anti-POLG (Santa Cruz, sc-5930) 1:2000; rabbit
anti-POLG2 1:10,000; mouse monoclonal anti-EF-Tu (kind gift of Dr. F. Henkler) 1:500; and goat antihistone H2A (Santa Cruz, sc-8648) 1:500.
The POLG blocking peptide (Santa Cruz, sc-5930p) was used at 10 times
excess of the antibody. Blots were further processed as previously
described (Spelbrink et al., 2000
). For larger 13-cm gels as
shown in Figure 4, C and D, all samples were run on the same gel, but
because of gel size it was sliced in two, each half being blotted to a separate membrane. Both membranes were always incubated with antibody together.
| |
RESULTS |
|---|
|
|
|---|
Although mtDNA-protein complexes were isolated from mammalian
cells many years ago (see e.g., Albring et al., 1977
), these complexes remain poorly characterized. Twinkle, a protein with similarity to the phage T7 gene 4 protein (T7 gp4), is the first protein that was found to specifically colocalize in vivo with mtDNA in
mammalian cells (Spelbrink et al., 2001
), thus corroborating the existence of highly organized nucleoids in mammals. A punctate submitochondrial localization had until then only been observed for
proteins of the mitochondrial fusion and fission apparatus such as dynamin-related protein 1 (Drp1; Smirnova et
al., 2001
), although these proteins so far have not been shown to
colocalize with mtDNA. Other proteins, such as the mitochondrial
transcription factor TFAM and the mitochondrial polymerase POLG seem to
be uniformly distributed within mitochondria (Spelbrink et
al., 2000
, and unpublished observations), but these results are
based only on GFP reporter assays.
Endogenous TFAM and mtSSB, But Not POLG and POLG2 Specifically Colocalize with Twinkle in Nucleoids in Human Mitochondria
As a first approach to further determine nucleoid protein
composition we examined the in vivo localization of various endogenous mitochondrial proteins with a known function in mtDNA maintenance. To
this end we used immunocytochemistry (ICC) with antibodies against
TFAM, the mitochondrial single-stranded DNA-binding protein mtSSB, POLG
and its accessory subunit POLG2 (also known as the beta subunit). Both
untransfected cells or cells transiently transfected with a Twinkle-GFP
construct were studied. All antibodies, except the POLG antibody, have
been shown to be highly specific and show little background staining on
Western blots with isolated mitochondria (see Spelbrink et
al., 2000
, and unpublished data).
Figure 1 shows that both endogenous TFAM
and mtSSB have a punctate mitochondrial staining pattern, untypical for
the overall mitochondrial network structure in these cells seen with
counterstaining with Mitotracker Red. The combined images (Figure 1, C
and F) show that both TFAM and mtSSB are concentrated in defined foci within mitochondria, reminiscent to those observed with Twinkle-GFP. This was true for various human cell lines such as osteosarcoma and
lung carcinoma cells as well as primary or transformed fibroblasts and
was also observed in mouse 3T3 cells (unpublished data) and COS7 cells
(see below). Especially TFAM, though concentrated in punctate
structures, also showed weak, more uniform mitochondrial fluorescence,
revealing the mitochondrial network as observed after Mitotracker
staining (see also Figure 2A).
|
|
In contrast to TFAM and mtSSB, endogenous POLG and POLG2 showed an almost uniform mitochondrial fluorescence very similar to the Mitotracker staining. POLG2 did show some apparent foci with higher concentrations inside mitochondria (see Figure 2 and below). It was difficult to detect possible foci with higher concentrations of POLG because the antibody gave only weak mitochondrial fluorescence with some background in ICC (unpublished data).
As an additional approach to study nucleoid protein composition and to localize nucleoids at higher resolution, we used immunoelectron microscopy. After staining with the TFAM antibody, immunogold label was often found concentrated at regions within the mitochondrial matrix (Figure 1, G and H). Most mitochondria showed patches with several gold particles close together and long stretches devoid of label. On several occasions gold particles in cristae-free areas were associated with filamentous structures possibly containing nucleic acid (unpublished data).
To establish more precisely the localization of TFAM and mtSSB, we transfected osteosarcoma cells with Twinkle-GFP and subjected the cells to ICC 2 d after transfection. The results show a clear colocalization of Twinkle-GFP both with TFAM and with mtSSB (Figure 2, A-F) strongly suggesting that endogenous TFAM and SSB are preferentially present in mitochondrial nucleoids. Foci with apparent highest concentrations of POLG2 appeared also to colocalize with Twinkle-GFP (Figure 2, G-I, indicated by arrows).
We had previously used ethidium bromide staining to look for
colocalization of Twinkle with mtDNA (Spelbrink et al.,
2001
), but this staining was not as discrete as the Twinkle
localization, possibly because of costaining of mitochondrial RNA. We
now used BrdU metabolic labeling of mtDNA, followed by immunodetection of denatured DNA containing BrdU, and ICC for mtSSB or ICC for cotransfected Twinkle with a MycHis epitope tag. BrdU is a thymidine analog that can be specifically incorporated in DNA once it has become
phosphorylated by thymidine kinase. In cells that are deficient in
their cytoplasmic thymidine kinase (TK
) while retaining the mitochondrial isozyme, specific mtDNA staining can be easily detected (see Davis and Clayton, 1996
and references therein). However, a
disadvantage of BrdU labeling could be that incorporation of this
analog in mtDNA was previously shown to mainly take place in
perinuclear mitochondria, suggestive of a spatial regulation of mtDNA
replication (Davis and Clayton, 1996
). This was hypothesized to be the
result of a limitation in one or several factors encoded by the nucleus
that needed to be imported by the mitochondria. To test BrdU labeling
in 143B(TK
) cells, we labeled cells for 2 and 24 h and detected
BrdU incorporation using a monoclonal BrdU-specific antibody. We found
that BrdU incorporation was very efficient, even after a 2-h labeling
period, with labeling of mtDNA more or less uniform throughout the cell
(see also Figure 3). This meant that BrdU
labeling could be used as a highly specific DNA "stain" to
demonstrate specific incorporation in foci that we have so far
tentatively termed nucleoids. The results of these experiments are
shown in Figure 3. In this particular experiment, mtSSB ICC showed
somewhat more uniform mitochondrial fluorescence, but foci could still
be spotted easily. This more uniform staining was within the normal
range of variation that we observed with this antibody (unpublished
data). There was, nevertheless, very good colocalization of mtSSB and
of Twinkle-MycHis with sites of BrdU incorporation, unequivocally
demonstrating that Twinkle and mtSSB colocalize with mtDNA. Similar
results were obtained for Tfam (unpublished data). Because labeling
with BrdU is metabolic, it is not surprising that some foci stain
positive for Twinkle or mtSSB but not for BrdU. The number of foci that
were positive for mtSSB or Twinkle and negative for BrdU after 24 h of labeling was generally smaller than after 2 h of labeling.
Nevertheless, even after 2 h most mtSSB or Twinkle-positive foci
were already BrdU positive in a considerable proportion of cells of the
culture. An example of this is shown in Figure 3, D-F, for
Twinkle-transfected cells. No BrdU incorporation was observed in
rho-zero cells (unpublished data). Because also after a 24-h labeling
period most BrdU incorporation sites still colocalized with mtSSB or
Twinkle, the results strongly suggest that nucleoid associated proteins
are not merely DNA synthesis/repair factories that dissociate after
replication and/or repair. Further BrdU labeling studies under well
controlled experimental conditions could prove very useful to unravel
dynamics of mtDNA synthesis and the maintenance machinery.
|
Nucleoid Proteins No Longer Form Nucleoid-like Structures in rho-zero Cells
Nucleoids can be expected to be held together both by
protein-protein and protein-DNA interactions. In cells without mtDNA (rho-zero cells) one might therefore expect a disruption of nucleoid structure. The various proteins tested by ICC gave different results as
a consequence of the absence of mtDNA (Figure
4). TFAM levels appeared severely reduced
(Figure 4, A and C, compare rho+ and rho-zero cells of the same genetic
background), although the remaining staining did appear somewhat
punctate. It did not strictly colocalize with Twinkle-GFP (unpublished
data), even though most remaining TFAM staining was mitochondrial.
Mitochondrial SSB was easily detectable by ICC. The staining in
rho-zero cells (compare Figure 4, B and D), in sharp contrast with
staining in rho+ cells, showed a much more uniform mitochondrial
fluorescence revealing a mitochondrial network similar to that observed
after Mitotracker staining (unpublished data). Both POLG and POLG2
showed uniform mitochondrial fluorescence and did not appear to be
down- or upregulated compared with cells with mtDNA (unpublished data).
|
Biochemical Purification of Nucleoids from Cultured Human Cells Demonstrates Partial Copurification of TFAM, mtSSB, POLG, and POLG2 with mtDNA
The ICC results have defined some of the proteins that should be
present in purified mitochondrial nucleoids. To biochemically purify
nucleoids we used isopycnic-gradient purified mitochondria followed by
two sequential NP40 lysis and sucrose-density gradient centrifugation
steps (see Figure 5A). Initial
purification steps and gradient fractions were monitored using PCR
amplification for mtDNA, and TFAM served as a nucleoid-protein marker
on Western blots. Cytochrome c oxidase subunit II (COXII) and IV
(COXIV) were used as markers for possible inner membrane contamination. A typical result from the first lysis step onward showing most sucrose
gradient fractions is shown in Figure 5B. More extensive subsequent
analysis by Western blotting and total protein staining was done, using
representative sucrose gradient fractions only, on large SDS-PAGE
Schägger-von Jagow gels. Apart from TFAM and COXII, we checked
for purification of mtSSB, POLG, POLG2, and mitochondrial elongation
factor Tu (mtEF-Tu) as another negative control because it is involved
in translation and as far as we know not in mtDNA replication or
repair. It was therefore not surprising to find mtEF-Tu mainly in the
S1 fraction, which also nicely illustrated the differential enrichment
we observed for the various proteins. As previously shown for yeast
nucleoid isolation procedures from which our procedure was adapted, the
sucrose gradient fractions containing most mtDNA and copurifying
proteins are derived from the insoluble pellet fraction after lysis of
mitochondria using 0.5% NP40. The soluble NP40 fractions that
contained mtDNA consistently purified in the gradient at lower density.
Also, as observed for yeast nucleoids, the first NP40 pellet gradient still showed a considerable amount of COXII and COXIV copurifying with
mtDNA and TFAM, suggesting contamination with membrane protein complexes. After a second NP40 treatment of these mtDNA-containing fractions and a second sucrose-density gradient of the resulting NP40
pellet, very little or no COXII and COXIV was left in the mtDNA
fractions but were now detected in the soluble fraction. In addition,
various proteins such as what we assume is an adenine nucleotide
translocator isoform (ANT) are still present at high concentrations in
the first "pellet"-gradient P1 (Figure 5D). These were no longer
detectable after the second lysis and gradient step, consistent with a
further purification of the nucleoids and loss of nonspecific proteins.
In sharp contrast, hardly any TFAM was lost from the nucleoid fraction
by the second NP40 lysis step (Figure 5, C and D), showing that this
protein in contrast to COXII, ANT, and other proteins was strongly
associated with mtDNA and specifically retained.
|
The TFAM antibody that we used recognized two TFAM species, the lower of the two being partially degraded because it was hardly detected when we included a cocktail of protease inhibitors during the purification procedure (unpublished data). In addition, TFAM copurifying with mtDNA was mostly full length, in contrast to TFAM found in some of the other fractions. DNAseI treatment of mitochondrial lysates resulted in increased sensitivity of TFAM to degradation and furthermore resulted in the formation of an additional lower molecular weight species (unpublished data). MtSSB was mostly lost from the nucleoid fraction after the second lysis and gradient step.
Despite the ICC findings, the results also showed that not only TFAM copurifies with mtDNA nucleoids to the very last step but also small amounts of POLG2. Interestingly, POLG almost exclusively copurified with nucleoids contradicting the ICC results for this protein. However, the commercial POLG antibody appeared to cross-react with several other proteins that were present in our mitochondrial fractions at much higher concentrations than POLG (see Figure 5C). Nevertheless, recognition of only one protein with the expected size could be specifically inhibited on Western blots by the POLG peptide used for immunization (unpublished data), making it possible to positively identify POLG (indicated by an arrow in Figure 5C, see also figure legend).
Finally, as a control for the purity of our nucleoid preparations we examined the possibility of contamination with nuclear chromatin proteins. Using a commercial polyclonal antibody we could not detect any human histone protein 2A (H2A) in our mitochondrial preparations, whereas the protein was clearly detected in a nuclear extract (unpublished data). Second, a mitochondrial preparation that we fixed after the isopycnic gradient purification showed DAPI-stained intramitochondrial spots, supposedly nucleoids, but not any extramitochondrial DNA material that would indicate the presence of chromatin.
Nucleoid Dynamics in Live Cells
Being able for the first time to visualize mammalian nucleoids
using GFP-tagged Twinkle, we tried to address basic questions of
nucleoid dynamics in living cells by performing time-lapse fluorescence
microscopy. The time-lapse results first show that Twinkle-GFP punctae
are not static but mobile, following the mitochondrial dynamics. When
observed at room temperature, most mitochondria (93%) exhibited short
oscillatory movement. This movement was not confined to a single
direction, but rather consisted of multiple trajectories. It also
manifested itself as a change of mitochondrial shape and/or stretching
and contraction of some of its parts. The calculated velocity of
mitochondrial displacement in any direction in our experimental system
was 0.01 ± 0.0007 µm/s (7 mitochondria, 149 time points). A
small fraction (7 ± 0.8%) of mitochondria moved faster than 0.05 µm/s, mostly in saltatory unidirectional movements. There were
~2.3 ± 0.4 Twinkle-GFP spots per mitochondrion (n = 58).
Their movements were similar to those of mitochondria both
quantitatively and qualitatively. Both nondividing and dividing Twinkle-GFP foci oscillated within the mitochondrion, and the velocity
of their displacement was 0.01 ± 0.0008 µm/s (5 Twinkle-GFP spots, 110 time points), similar to the overall mitochondrial velocity.
These results strongly suggest a membrane association of nucleoids,
consistent with previous suggestions of membrane association of mtDNA
via the D-loop region (see also Albring et al., 1977
). With
Twinkle-GFP and ICC, we also observed what appears to be a minimum size
for Twinkle, TFAM, and mtSSB containing spots of ~0.1-0.3 µm in
diameter. The largest Twinkle containing spots were typically up to
0.8-1.0 µm in diameter and were often asymmetrical. Most
importantly, these larger sized structures were on several occasions
observed to break up in several smaller sized Twinkle containing spots
(indicated by solid arrows in Figure 6A),
suggesting nucleoid division events. Although we did on occasion see
smaller spots apparently join to form larger spots, this usually was an apparent rejoining of nucleoid elements that had been together in a
larger assembly before (see also Figure 6A). A third observation was
that nucleoid division can take place without division of mitochondria
(see also solid arrows Figure 6A). Nevertheless, in 67% of the
dividing mitochondria, nucleoids appear to be positioned at or near a
site of mitochondrial division and could show apparent concomitant
division or redistribution to a daughter mitochondrion (open arrow in
Figure 6A). Alternatively, at the cell periphery we did observe clear
mitochondrial fission events without division of the nucleoids that
were distributed over the entire length of the mitochondrion so that
each daughter mitochondrion would have one or more nucleoids (Figure
6B, arrows indicate fission events). The combined results show that
upon mitochondrial fusion or fission, mtDNA is distributed or
redistributed to ensure proper inheritance. Even though the cells that
we used for the time-lapse imaging are effectively two-dimensional at
the cell periphery (L.G. and A.M.vdB., unpublished data), we tried to
further examine nucleoid positioning to possible sites of mitochondrial
fission by covisualization of one of the components of the
mitochondrial division machinery, Drp1, with mtSSB. In this case we
used GFP-Drp1, whereas mtSSB was visualized using ICC. This experiment,
shown in Figure 7, clearly demonstrated
there is essentially no colocalization of mtSSB-nucleoid foci with
Drp1. Drp1-GFP could be observed at sites of what appear to be
constrictions of mitochondria with mtSSB foci at either site of the
constriction (indicated with a solid arrow in the enlargement of a
section from Figure 7C). In addition, Drp1 was also frequently observed
at tips of mitochondria of what appear as sites of recent fission
events (an example is indicated with open arrows), very similar to the
results reported for Drp1 in C. elegans (Labrousse et
al., 1999
). The same observations were made using cotransfection
of GFP-Drp1 and Twinkle with a c-Myc epitope tag that could be detected
by ICC and with Tfam ICC and by transfection of Twinkle-GFP combined
with detection of endogenous Drp1 using a polyclonal Drp1-specific
antibody (unpublished results). Time-lapse experiments using different
fluorescently labeled Drp1 and Twinkle should shed light on the exact
sequence of events of nucleoid and mitochondrial division.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The results presented in this article provide many valuable insights into the organization and dynamics of mtDNA nucleoids in cultured human cells. It is for the first time clearly shown, both by in situ cell biological methods and biochemical methods, that nucleoids in mammalian cells are stable assemblies of multiple mitochondrial proteins with mtDNA. Furthermore, the results show that nucleoids are dynamic structures that divide and follow the dynamics of the mitochondrial network, presumably to ensure the transmission of mtDNA to daughter mitochondria during mitochondrial growth and division. MtSSB did not colocalize with Drp1, which is often found concentrated at sites of past or future mitochondrial fission. In addition to basic considerations of mtDNA organization in mammals, the study of nucleoid structure and dynamics should also help us to better understand important aspects of mtDNA maintenance, such as mtDNA segregation and complementation, in human mitochondrial disease.
Mitochondrial Nucleoids in Human Cells Are Assemblies of Multiple Proteins with mtDNA
The first suggestions that nucleoids are discrete
structures containing mtDNA and proteins has come from studies mostly
involving the yeast S. cerevisiae. Evidence for a similar
organization in mammalian cells had until recently only been suggested
by DAPI staining (Satoh and Kuroiwa, 1991
). Twinkle was the first
protein to be positively identified as a human mitochondrial protein
associated with mtDNA nucleoids in vivo (Spelbrink et al.,
2001
).
On the basis of localization studies of human mitochondrial replication
proteins such as POLG, POLG2, and TFAM using GFP tagging, we previously
concluded that none of these proteins specifically colocalize with
mtDNA (Spelbrink et al., 2000
, and J.N.S., unpublished observations). However, we questioned especially the result for TFAM
for various reasons. First, the GFP methodology usually highly overexpresses the protein of interest, whereas the GFP tag could mask
regions of the protein involved in specific nucleoid interaction or
interfere with proper protein folding. Second, the yeast TFAM orthologue Abf2p has convincingly been demonstrated to be a yeast mitochondrial nucleoid protein (Newman et al., 1996
; Kaufman
et al., 2000
). Third, both yeast Abf2p and human TFAM have
low binding specificity for DNA but high binding affinity and have
similarity with the bacterial histone like protein HU and eukaryotic
high mobility group proteins (Diffley and Stillman, 1991
, 1992
; Fisher et al., 1992
; Newman et al., 1996
), suggesting a
function in DNA packaging similar to nuclear histone proteins. Fourth,
TFAM protein levels in mammalian mitochondria have been recently
suggested to be much higher than previously believed, being sufficient
to fully wrap mtDNA assuming TFAM binding at intervals of 30 base pairs
(Takamatsu et al., 2002
). Finally, two related mammalian mitochondrial transcription factors, similar to the S. cerevisiae mitochondrial RNA polymerase specificity factor, Mtf1p,
were recently identified and shown to greatly stimulate TFAM-dependent
transcription activation in in vitro assays (McCulloch et
al., 2002
; Falkenberg et al., 2002
). It was shown that
the novel transcription factors interact with the mitochondrial RNA
polymerase, and further experiments suggested them to be important for
transcription initiation (Falkenberg et al., 2002
), similar
to Mtf1p (Karlok et al., 2002
). These findings for the first
time show the apparent necessity of transcription factors other then
TFAM in mammalian mtDNA transcription. However, also packaging of mtDNA
by TFAM is likely to be important for transcription and replication,
similar to the regulation of nuclear genes by histones, which are
themselves regulated by protein modification (see e.g., Marmorstein,
2001
).
Thus, we demonstrate for the first time colocalization of endogenous
TFAM and mtSSB with Twinkle in intramitochondrial foci, which also
contain mtDNA. Both TFAM and mtSSB are also concentrated in foci in the
absence of transgenically expressed Twinkle-EGFP suggesting they are
intrinsically part of nucleoids. This is also compatible with the
concentrated localization of TFAM shown by our immunoelectron
microscopy results. Furthermore, the size of the immunolabeled area in
the mitochondria fits the reported size of nucleoids in yeast (Miyakawa
et al., 1987
).
Both TFAM and SSB are well characterized as DNA-binding proteins (see
above for TFAM and, e.g., Curth et al., 1994
) and copurify, albeit to varying extend, with mtDNA in our nucleoid preparations. TFAM
was specifically retained in both the first and the second gradient
purification step, whereas other proteins that we have considered
contaminations were lost in the second purification step. SSB was less
well retained and was hardly detectable in our final nucleoid prep.
Because mtSSB is a binding protein with specificity for single-stranded
DNA, its in situ presence in nucleoids is likely to be a consequence of
single-stranded DNA regions such as the D-loop (Zeviani et
al., 1995
). Loss of mtSSB might be a consequence of the partial
loss of these single-stranded structures during the purification. It is
interesting to note that based on ICC most, if not all, nucleoids
contain both TFAM, mtSSB and Twinkle, suggesting that all three
proteins are structural components of nucleoids, presumably also
stabilizing and protecting mtDNA.
The results for POLG and POLG2 were somewhat less straightforward.
POLG2 ICC showed mostly uniform fluorescence, but also some foci with
apparently higher POLG2 concentrations. Most but not all of these foci
also contained Twinkle. An attractive hypothesis is that the POLG2 foci
represent actively replicating mitochondrial genomes. The ICC results
in this case are consistent with the biochemical purification data that
suggest that most of POLG2 is not present within the nucleoid fraction.
In contrast, POLG ICC showed uniform mitochondrial fluorescence,
whereas the biochemical purification showed significant POLG enrichment
in the nucleoid fractions. This inconsistency could be explained by
low-affinity nonspecific binding of the POLG antibody, presumably
recognizing at least one nonnucleoid mitochondrial protein also during
the ICC. Despite the enrichment in nucleoids, POLG concentration is probably low because a protein of the correct size could not clearly be
distinguished in the total-protein stain after SDS-PAGE of nucleoid
fractions. These data could point to POLG, like POLG2, being present
mainly at sites of ongoing DNA synthesis or repair. Because POLG and
POLG2 have been shown to physically interact and usually copurify (Wang
et al., 1997
), the results also point to a large excess of
POLG2. This could be a safeguarding mechanism to assure that POLG
always finds its partner that has been shown to increase the fidelity
and processivity of the polymerase enzyme (Carrodeguas et
al., 1999
; Lim et al., 1999
). It might also suggest an
additional function for POLG2 inside mitochondria, apart from its role
as a processivity factor. Although it should be no surprise that POLG
and POLG2 at least partially copurify with mtDNA because they have been
clearly implicated in mtDNA maintenance (Foury, 1989
; Iyengar et
al., 1999
, 2002
; Spelbrink et al., 2000
), the data we
present here do not support the hypothesis that these are structural
nucleoid proteins.
In the absence of mtDNA, nucleoid integrity is lost, showing that the
interaction of Twinkle, TFAM, and SSB with mtDNA is essential for their
colocalization in discrete foci within mitochondria. The most clear
demonstration of this comes from the almost uniform mitochondrial
distribution of mtSSB in rho-zero cells. TFAM levels, in contrast with
mtSSB or POLG and POLG2 levels, were severely reduced. This agrees with
previous studies showing a strong correlation between TFAM protein
levels and mtDNA levels, using rho-zero cell lines, cell lines
partially depleted by dideoxycytidine treatment, material from patients
suffering from mtDNA depletion and heterozygous TFAM knockout mice
(Larsson et al., 1994
; Poulton et al., 1994
; Larsson et al., 1998
). This strongly suggested that TFAM
protein stability and turnover depends on its interaction with mtDNA
and is supported by our observation of an apparent dependence of the occurrence of TFAM degradation products on a lack of DNA binding.
Nucleoid Dynamics
In yeast mitochondrial genetics, it has been demonstrated that the number of segregating units is clearly less than the number of mtDNA molecules, but more or less equal to the number of mtDNA-nucleoid structures as observed by DAPI staining. This not only demonstrated that nucleoids contain more than one mtDNA molecule, but clearly implicated nucleoids as the units of mtDNA inheritance.
Here we show in vivo behavior and distribution of Twinkle-GFP suggesting that Twinkle containing elements in human mitochondria, which we here showed to contain mtDNA, are the heritable elements of mtDNA. Most of the mitochondria contain multiple Twinkle-GFP punctae that appeared to be distributed among the "daughter" mitochondria upon division.
It is tempting to speculate that the minimal size nucleoids we observed
are protein-DNA structures containing single copies of mtDNA.
Interestingly, it was recently concluded based on mtDNA-specific FISH
experiments that multiple copies of mtDNA are often clustered inside
the mitochondrial network (Margineantu et al., 2002
). Also in this case, single small spots possibly consisting of individual mtDNA molecules could be seen. Nevertheless, at this point neither the
previously published results nor our results can exclude the possibility that the minimum visible structures are actually the most
minimal size of nucleoids but still containing multiple mtDNA copies.
As observed with the FISH experiments and also visible in our previous
published pictures (Spelbrink et al., 2001
; Margineantu et al., 2002
), mtDNA nucleoids are frequently localized at
or near the tips or constriction sites on the mitochondria, suggesting a possible association with Drp1. Drp1 cycles on and off mitochondria, but when on the mitochondrial outer membrane, it localizes at the spots
where past and future scissions occur (van der Bliek, 2000
). We did not
notice any significant colocalization between SSB (or Twinkle) and
Drp1. This indicates that nucleoid proteins are not active participants
of the division machinery. Nevertheless, Twinkle follows mitochondrial
dynamics and could play an important role in the active segregation of mtDNA.
| |
ACKNOWLEDGMENTS |
|---|
J.N.S. thanks Howy Jacobs, Ian Holt, and Anu Wartiovaara for many useful comments and discussions. This work was supported in part by The Academy of Finland Center of Excellence program, the Academy of Finland Life2000 program, and the Academy of Finland grants 80939 and 80936 to J.N.S., by a grant from the Sigrid Jusélius Foundation to J.W., and by a postdoctoral fellowship by the American Heart Association to L.G.
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: hans.spelbrink{at}uta.fi.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-07-0399. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-07-0399.
| |
ABBREVIATIONS |
|---|
Abbreviations used: Drp1, dynamin-related protein 1; BrdU, 5-bromo-2-deoxy-uridine; (E)GFP, (enhanced) green fluorescent protein; ICC, immunocytochemistry; MtSSB/SSB, mitochondrial single-stranded DNA-binding protein; POLG, polymerase gamma; POLG2, accessory subunit of POLG; TFAM, transcription factor A of mitochondria.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Liesa, M. Palacin, and A. Zorzano Mitochondrial Dynamics in Mammalian Health and Disease Physiol Rev, July 1, 2009; 89(3): 799 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kienhofer, D. J. F. Haussler, F. Ruckelshausen, E. Muessig, K. Weber, D. Pimentel, V. Ullrich, A. Burkle, and M. M. Bachschmid Association of mitochondrial antioxidant enzymes with mitochondrial DNA as integral nucleoid constituents FASEB J, July 1, 2009; 23(7): 2034 - 2044. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goffart, H. M. Cooper, H. Tyynismaa, S. Wanrooij, A. Suomalainen, and J. N. Spelbrink Twinkle mutations associated with autosomal dominant progressive external ophthalmoplegia lead to impaired helicase function and in vivo mtDNA replication stalling Hum. Mol. Genet., January 15, 2009; 18(2): 328 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Hakonen, S. Goffart, S. Marjavaara, A. Paetau, H. Cooper, K. Mattila, M. Lampinen, A. Sajantila, T. Lonnqvist, J. N. Spelbrink, et al. Infantile-onset spinocerebellar ataxia and mitochondrial recessive ataxia syndrome are associated with neuronal complex I defect and mtDNA depletion Hum. Mol. Genet., December 1, 2008; 17(23): 3822 - 3835. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Wenzel, S. Schuhmacher, J. Kienhofer, J. Muller, M. Hortmann, M. Oelze, E. Schulz, N. Treiber, T. Kawamoto, K. Scharffetter-Kochanek, et al. Manganese superoxide dismutase and aldehyde dehydrogenase deficiency increase mitochondrial oxidative stress and aggravate age-dependent vascular dysfunction Cardiovasc Res, November 1, 2008; 80(2): 280 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Gilkerson, E. A. Schon, E. Hernandez, and M. M. Davidson Mitochondrial nucleoids maintain genetic autonomy but allow for functional complementation J. Cell Biol., October 22, 2008; 181(7): 1117 - 1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Minczuk, M. A. Papworth, J. C. Miller, M. P. Murphy, and A. Klug Development of a single-chain, quasi-dimeric zinc-finger nuclease for the selective degradation of mutated human mitochondrial DNA Nucleic Acids Res., July 1, 2008; 36(12): 3926 - 3938. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kucej, B. Kucejova, R. Subramanian, X. J. Chen, and R. A. Butow Mitochondrial nucleoids undergo remodeling in response to metabolic cues J. Cell Sci., June 1, 2008; 121(11): 1861 - 1868. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gancedo and C.-L. Flores Moonlighting Proteins in Yeasts Microbiol. Mol. Biol. Rev., March 1, 2008; 72(1): 197 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Bogenhagen, D. Rousseau, and S. Burke The Layered Structure of Human Mitochondrial DNA Nucleoids J. Biol. Chem., February 8, 2008; 283(6): 3665 - 3675. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hudson, P. Amati-Bonneau, E. L. Blakely, J. D. Stewart, L. He, A. M. Schaefer, P. G. Griffiths, K. Ahlqvist, A. Suomalainen, P. Reynier, et al. Mutation of OPA1 causes dominant optic atrophy with external ophthalmoplegia, ataxia, deafness and multiple mitochondrial DNA deletions: a novel disorder of mtDNA maintenance Brain, February 1, 2008; 131(2): 329 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Kaufman, N. Durisic, J. M. Mativetsky, S. Costantino, M. A. Hancock, P. Grutter, and E. A. Shoubridge The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures Mol. Biol. Cell, September 1, 2007; 18(9): 3225 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. J. Chen, X. Wang, and R. A. Butow Yeast aconitase binds and provides metabolically coupled protection to mitochondrial DNA PNAS, August 21, 2007; 104(34): 13738 - 13743. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lu, S. Yadav, P. G. Shah, T. Liu, B. Tian, S. Pukszta, N. Villaluna, E. Kutejova, C. S. Newlon, J. H. Santos, et al. Roles for the Human ATP-dependent Lon Protease in Mitochondrial DNA Maintenance J. Biol. Chem., June 15, 2007; 282(24): 17363 - 17374. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wanrooij, S. Goffart, J. L.O. Pohjoismaki, T. Yasukawa, and J. N. Spelbrink Expression of catalytic mutants of the mtDNA helicase Twinkle and polymerase POLG causes distinct replication stalling phenotypes Nucleic Acids Res., May 11, 2007; 35(10): 3238 - 3251. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. He, C.-C. Mao, A. Reyes, H. Sembongi, M. Di Re, C. Granycome, A. B. Clippingdale, I. M. Fearnley, M. Harbour, A. J. Robinson, et al. The AAA+ protein ATAD3 has displacement loop binding properties and is involved in mitochondrial nucleoid organization J. Cell Biol., January 16, 2007; 176(2): 141 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Minczuk, M. A. Papworth, P. Kolasinska, M. P. Murphy, and A. Klug Sequence-specific modification of mitochondrial DNA using a chimeric zinc finger methylase PNAS, December 26, 2006; 103(52): 19689 - 19694. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. O. Pohjoismaki, S. Wanrooij, A. K. Hyvarinen, S. Goffart, I. J. Holt, J. N. Spelbrink, and H. T. Jacobs Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells Nucleic Acids Res., November 6, 2006; 34(20): 5815 - 5828. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang and D. F. Bogenhagen Human Mitochondrial DNA Nucleoids Are Linked to Protein Folding Machinery and Metabolic Enzymes at the Mitochondrial Inner Membrane J. Biol. Chem., September 1, 2006; 281(35): 25791 - 25802. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lu, N. Garrido, J. N. Spelbrink, and C. K. Suzuki Tid1 Isoforms Are Mitochondrial DnaJ-like Chaperones with Unique Carboxyl Termini That Determine Cytosolic Fate J. Biol. Chem., May 12, 2006; 281(19): 13150 - 13158. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Piantadosi and H. B. Suliman Mitochondrial Transcription Factor A Induction by Redox Activation of Nuclear Respiratory Factor 1 J. Biol. Chem., January 6, 2006; 281(1): 324 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Bayona-Bafaluy, B. Blits, B. J. Battersby, E. A. Shoubridge, and C. T. Moraes Rapid directional shift of mitochondrial DNA heteroplasmy in animal tissues by a mitochondrially targeted restriction endonuclease PNAS, October 4, 2005; 102(40): 14392 - 14397. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Dai, Y.-S. Lo, A. Litvinchuk, Y.-T. Wang, W.-N. Jane, L.-J. Hsiao, and K.-S. Chiang Structural and functional characterizations of mung bean mitochondrial nucleoids Nucleic Acids Res., August 22, 2005; 33(15): 4725 - 4739. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsushima, C. Adan, R. Garesse, and L. S. Kaguni Drosophila Mitochondrial Transcription Factor B1 Modulates Mitochondrial Translation but Not Transcription or DNA Copy Number in Schneider Cells J. Biol. Chem., April 29, 2005; 280(17): 16815 - 16820. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tyynismaa, H. Sembongi, M. Bokori-Brown, C. Granycome, N. Ashley, J. Poulton, A. Jalanko, J. N. Spelbrink, I. J. Holt, and A. Suomalainen Twinkle helicase is essential for mtDNA maintenance and regulates mtDNA copy number Hum. Mol. Genet., December 15, 2004; 13(24): 3219 - 3227. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsushima, R. Garesse, and L. S. Kaguni Drosophila Mitochondrial Transcription Factor B2 Regulates Mitochondrial DNA Copy Number and Transcription in Schneider Cells J. Biol. Chem., June 25, 2004; 279(26): 26900 - 26905. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wanrooij, P. Luoma, G. van Goethem, C. van Broeckhoven, A. Suomalainen, and J. N. Spelbrink Twinkle and POLG defects enhance age-dependent accumulation of mutations in the control region of mtDNA Nucleic Acids Res., June 4, 2004; 32(10): 3053 - 3064. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Legros, F. Malka, P. Frachon, A. Lombes, and M. Rojo Organization and dynamics of human mitochondrial DNA J. Cell Sci., June 1, 2004; 117(13): 2653 - 2662. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Ekstrand, M. Falkenberg, A. Rantanen, C. B. Park, M. Gaspari, K. Hultenby, P. Rustin, C. M. Gustafsson, and N.-G. Larsson Mitochondrial transcription factor A regulates mtDNA copy number in mammals Hum. Mol. Genet., May 1, 2004; 13(9): 935 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Liu, B. Lu, I. Lee, G. Ondrovicova, E. Kutejova, and C. K. Suzuki DNA and RNA Binding by the Mitochondrial Lon Protease Is Regulated by Nucleotide and Protein Substrate J. Biol. Chem., April 2, 2004; 279(14): 13902 - 13910. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||