![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vol. 14, Issue 4, 1652-1663, April 2003




and
Institut für Biochemie,
Universität Stuttgart, 70569 Stuttgart, Germany;
Czech Academy of Sciences, Institute of
Physiology, 14220 Prague, Czech Republic; and
§Institut für Mikrobiologie, Johann
Wolfgang Goethe-Universität Frankfurt, 60439 Frankfurt, Germany
| |
ABSTRACT |
|---|
|
|
|---|
Metabolic adaptation of Saccharomyces cerevisiae cells from a nonfermentable carbon source to glucose induces selective, rapid breakdown of the gluconeogenetic key enzyme fructose-1,6-bisphosphatase (FBPase), a process called catabolite degradation. Herein, we identify eight novel GID genes required for proteasome-dependent catabolite degradation of FBPase. Four yeast proteins contain the CTLH domain of unknown function. All of them are Gid proteins. The site of catabolite degradation has been controversial until now. Two FBPase degradation pathways have been described, one dependent on the cytosolic ubiquitin-proteasome machinery, and the other dependent on vacuolar proteolysis. Interestingly, three of the novel Gid proteins involved in ubiquitin-proteasome-dependent degradation have also been reported by others to affect the vacuolar degradation pathway. As shown herein, additional genes suggested to be essential for vacuolar degradation are unnecessary for proteasome-dependent degradation. These data raise the question as to whether two FBPase degradation pathways exist that share components. Detailed characterization of Gid2p demonstrates that it is part of a soluble, cytosolic protein complex of at least 600 kDa. Gid2p is necessary for FBPase ubiquitination. Our studies have not revealed any involvement of vesicular intermediates in proteasome-dependent FBPase degradation. The influence of Ubp14p, a deubiquitinating enzyme, on proteasome-dependent catabolite degradation was further uncovered.
| |
INTRODUCTION |
|---|
|
|
|---|
Life depends on the ability of cells to adapt to environmental
changes. The presence of glucose is vital to all cells, and as such it
is the most important nutrient and signal trigger of cellular
metabolism. When Saccharomyces cerevisiae cells are
cultivated in media containing a nonfermentable carbon source, glucose
is synthesized via the gluconeogenic pathway. Shifting these cells to
glucose-containing media leads to a rapid switch from gluconeogenesis to glycolysis. During this metabolic adaptation, the key regulatory gluconeogenetic enzyme, fructose-1,6-bisphosphatase (FBPase), is
rapidly inactivated and then degraded (half-life ~20-30 min) in a
process called catabolite inactivation (Gancedo, 1971
; Holzer, 1976
;
Funayama et al., 1980
). This inactivation process consists of two separate steps: 1) phosphorylation of the enzyme and 2) degradation of the protein. Degradation of the enzyme blocks
gluconeogenesis; this prevents an otherwise ongoing futile cycle of ATP
hydrolysis between the glycolytic phosphofructokinase and the
gluconeogenic FBPase reactions.
The site of FBPase degradation is the subject of an ongoing debate
(Schork et al., 1994a
,b
). The import of FBPase into
Vid-vesicles with a diameter of 30-40 nm and its subsequent vacuolar
degradation have been reported (Chiang and Schekman, 1991
; Huang and
Chiang, 1997
). This vacuolar catabolite degradation process has been
analyzed genetically by isolating and characterizing so-called
vid-mutants (Hoffman and Chiang, 1996
). Proteinase
yscA-dependent catabolite degradation of FBPase has been shown to
require, besides other factors, Vid22p, Cpr1p, and Vid24p (Chiang and
Chiang, 1998
; Brown et al., 2001
, 2002
). Vid24p has been
reported to be peripherally attached to Vid-vesicles, and its absence
leads to accumulation of FBPase trapped in these vesicles (Chiang and
Chiang, 1998
).
Our laboratory has found that catabolite degradation of FBPase occurs
independent of vacuolar proteolysis (Wolf and Ehmann, 1979
; Mechler and
Wolf, 1981
; Teichert et al., 1989
). Instead, we find that
the breakdown of FBPase, depends on polyubiquitination and the activity
of the cytosolic 26S proteasome (Schork et al., 1994a
,b
,
1995
). The linkage of polyubiquitin chains onto proteins via an enzyme
cascade consisting of an ubiquitin activating enzyme (E1), ubiquitin
conjugating enzymes (E2), and ubiquitin-protein ligases (E3) marks
these proteins for degradation via the cytoplasmic and nuclear
proteolytic nanocompartment, the proteasome (Hilt and Wolf, 1996
,
2000
; Baumeister et al., 1998
). We furthermore showed that
FBPase degradation is independent of the phosphorylation of the protein
(Hämmerle et al., 1998
). In a genetic approach isolating mutants defective in the
glucose-induced degradation process of
FBPase (gid-mutants) (Hämmerle et al.,
1998
; Schüle et al., 2000
), we uncovered the essential
function of the ubiquitin-conjugating enzyme Ubc8p (Gid3p) for
glucose-induced proteasome-dependent degradation of FBPase
(Schüle et al., 2000
).
Herein, we report the identification of the GID1 and GID2 genes by complementation of the previously isolated point mutants with a yeast genomic library. We further characterize the localization and function of Gid2p. In addition, we present a reverse genomic approach identifying six additional novel GID genes involved in proteasome-dependent catabolite degradation of FBPase. We also report on overlapping functions of some GID gene products in vacuolar and proteasome-dependent FBPase degradation. Furthermore, we discuss new and reported findings in the context of the existence of two independent catabolite degradation pathways of FBPase.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction and Growth Conditions of Strains
Previously described standard methods were used in media
preparation and for genetic and molecular biological techniques
(Guthrie and Fink, 1991
; Ausubel et al., 1992
). The S. cerevisiae strains used in this study are summarized in Table
1. Yeast strains were grown at
30°C.
|
Identification of GID Genes
gid1-3 and gid2-1 mutant cells were each
transformed with a YCp50-based genomic library (Rose et al.,
1987
) and grown for 3 d at 30°C on selective plates containing
2% glucose. Transformants were replica plated and grown on selective
plates with 2% ethanol as the sole carbon source. Thereafter, colonies
were transferred onto nitrocellulose sheets and soaked with YPD for
2-2.5 h at 30°C. Cells were then lysed by incubating with 0.1% SDS,
0.2 M NaOH, 0.5%
-mercaptoethanol for 30 min and washed off the
membrane. Nitrocellulose sheets were incubated with 10% milk in 20 mM
Tris-HCl pH 7.6, 137 mM NaCl, 0.1% Tween 20 overnight at 4°C
and then probed with FBPase antibody in 20 mM Tris-HCl pH 7.6, 137 mM
NaCl, 0.1% Tween 20 for 1 h. After several washes, filters were
incubated with peroxidase-coupled goat anti-rabbit antibody (Medac,
Hamburg, Germany), and peroxidase activity was detected using the
enhanced chemiluminescence system (Amersham Biosciences, Braunschweig, Germany).
The 5000 strains of the yeast deletion collection (EUROSCARF, Frankfurt, Germany) were grown in 96-well microtiter plates in YPD for 5.5 h to screen for strains deficient in the catabolite degradation of FBPase. Then, they were dropped onto YPEthanol plates and grown overnight. After transfer onto nitrocellulose membranes, strains were processed as described above.
Chromosomal Deletion of GID2
A DNA fragment was created by polymerase chain reaction (PCR)
with oligonucleotides TS1
(TCTTCAAGAGAGATGCAGCACTGAGTAGGGAACCAAGAAACGCAGCTGAAGCTTCGTACGC) and TS2
(AAAAAAAAAAAAAAAAAACCTATGCAAAAATTTCAGAGCATAGGCCACTAGTGGATCTG) and plasmid pUG6 (Güldener et al., 1996
). This PCR
fragment was used to chromosomally replace chromosomal GID2
with a LoxP-KANR-LoxP cassette
in the W303-1B strain background (Chiang and Schekman, 1991
), yielding
the strain YTS1 (Mat
ade2 leu2-3, 112 his3 trp1 ura3
gid2
::KANR). Southern blotting
confirmed correct gene replacement (our unpublished data).
Construction of Hemagglutinin (Ha)-tagged Gid2p (Gid2-Ha3)
Strain YTS3 (Mat
ade2 leu2-3, 112 his3 trp1 ura3
GID2-HA3::HIS5) was
constructed by chromosomal integration of a PCR fragment consisting of
a triple Ha-tag and a Schizosaccharomyces pombe HIS5 marker
(Cottarel, 1995
) in W303-1B cells. The PCR fragment was generated using
oligonucleotides TS9
(CCGTAAATACTTCAATGAGCAGTACAAAAAAGGTTCGTTTTGTTATGCTTGGAGCAGG-GGCGGGTGC) and TS10
(TTATCGCTTCCAATAAAAAAAAAAAAAAAAAACCTATGCAAAAATTTCAGGAGGTCGA-CGGTATCGATAAG) and plasmid p3xHA HIS5 (S. Munro, MRC Laboratory of Molecular Biology, Cambridge, UK). Correct integration was confirmed by Southern
analysis (our unpublished data).
Sucrose Density Gradient Fractionation
Subcellular fractionation was done as described previously
(Schüle et al., 2000
). Cells were grown in YPD (2%
glucose) medium to an optical density of 5-6, resuspended in YPEthanol
(2% ethanol) at an OD600 of 0.2, and grown for
16 h at 30°C to derepress FBPase. Then, 2% glucose was added
and 1000 OD600 cells were harvested at 0 and 30 min. Cells were then spheroplasted and proteinase inhibitors (Complete;
Roche Diagnostics, Mannheim, Germany) were added. After homogenization,
cell debris was removed by centrifugation (2000 × g,
10 min at 4°C), and the supernatant was loaded onto a 18-54%
sucrose gradient (10 ml). The gradient was then centrifuged at
100,000 × g for 3 h at 4°C and 0.6-ml fractions
were collected from the top to bottom and analyzed by
immunoblotting. Guanosine diphosphatase activity was
determined according to Abeijon et al. (1989)
.
Cell Fractionation and Proteinase K Digestion
This method was adopted from Schüle et al.
(2000)
. Cells were grown in YPD containing 2% glucose to an optical
density of 5-6, harvested, and resuspended at an
OD600 of 0.2/ml in YPEthanol medium (2%
ethanol). After 16 h of growth at 30°C, glucose was added to a
final concentration of 2%, and aliquots (60 OD600) were withdrawn at 0 and 30 min after
glucose addition. Cells were then converted to spheroplasts and lysed
hypotonically. A 300 × g centrifugation step removed
nonlysed cells. Centrifugation for 20 min at 6000 × g
yielded an S6 supernatant and a
P6 pellet fraction. The S6
fraction was further centrifuged at 100,000 × g for
3 h yielding an S1 supernatant and a
P1 pellet fraction. After
immunoblotting, samples were analyzed with antibodies
against phosphoglycerate kinase (PGK), carboxypeptidase yscY (CPY)
(Molecular Probes, Leiden, The Netherlands), Kar2p (R. Scheckman, Howard Hughes Medical Institute and Department of
Molecular and Cell Biology, University of California, Berkeley, CA),
and aminopeptidase I (API) (Barth and Thumm, 2001
).
Peroxidase-coupled secondary antibodies were from Medac (goat
anti-rabbit) and Dianova (Hamburg, Germany) (goat anti-mouse),
respectively. Peroxidase activity was monitored with the enhanced
chemiluminescence system (Amersham Biosciences).
For proteinase K digestion, total cell lysates were generated as described above and incubated with 50 µg/ml proteinase K or 50 µg/ml proteinase K plus 0.2% Triton X-100, respectively, for 30 min on ice. Digestion was stopped by addition of 10% trichloroacetic acid, and samples were processed for immunoblotting.
Pulse-Chase Analysis and Western Blotting
Pulse-chase experiments were done as described in Schork
et al. (1995)
. For quantification a PhosphorImager (Amersham
Biosciences, Sunnyvale, CA) was used. Immunodetection of
Ha-tagged proteins, and ubiquitin conjugates were described in
Schüle et al. (2000)
. Antibodies directed against the
Ha-tag were from Babco (Richmond, CA) (clone 16B12). Pulse-chase
analysis of the N-end rule substrate Arg-
-gal was done according to
Schüle et al. (2000)
.
Glycerol Density Gradient Fractionation
Cells were grown for 16 h in YPEthanol and 50 OD600 cells were shifted to YPD medium for 25 min. The cells were then harvested, resuspended in 0.1 M KH2PO4, pH 7.0, in the presence of Complete (protease inhibitor cocktail tablets; Roche Diagnostics) and 10 mM phenylmethylsulfonyl fluoride, lysed with glass beads, and centrifuged at 10,000 × g for 15 min. Then, 200-µl aliquots of the resulting cell extract were layered on top of a glycerol step gradient (450 µl each of 50, 40, 30, and 20% of glycerol in 20 mM PIPES buffer, pH 6.8) and centrifuged for 4 h at 55,000 rpm and 15°C in a TLS-55 rotor (Beckman Coulter, Fullerton, CA). Thereafter, 200-µl fractions were collected and processed for immunoblotting.
| |
RESULTS |
|---|
|
|
|---|
Identification of GID1 and GID2 Genes
Using a fusion protein consisting of the amino-terminal part of
FBPase fused to the marker
-galactosidase, we previously isolated
three mutants defective in the GID1, GID2, and
GID3 genes (gid1-3, gid2-1, and
gid3-1) necessary for glucose-induced degradation of FBPase
(Hämmerle et al., 1998
). We uncovered GID3
as the gene encoding the ubiquitin-conjugating enzyme Ubc8p as a
crucial component involved in catabolite degradation of FBPase
(Schüle et al., 2000
).
Applying the immunological colony screen with FBPase antibody and
peroxidase-coupled goat anti-rabbit antibody (Schüle et al., 2000
) to the gid1-3 and gid2-1 mutants,
we now identified the respective GID1 and GID2
wild-type genes. As shown in Figures 1A
and 2A, noncomplemented gid-mutant colonies look dark, due to a high FBPase level, whereas cells carrying a complementing plasmid
can breakdown FBPase after a shift to glucose and therefore look white.
As controls, wild-type colonies were included on each nitrocellulose
sheet (Figures 1A and 2A, arrowheads). One positive clone was detected
out of the 45,000 gid2-1 colonies screened (Figure 1A,
arrow). The rescued plasmid contained an ~5.7-kb genomic fragment
from chromosome IV (Figure 1B). Subcloning identified YDR255c as the complementing open reading frame (ORF)
(Figure 1B). To construct a YDR255c deleted strain, we
integrated a PCR-generated kanamycin resistance cassette into the
respective locus of wild-type cells (see MATERIALS AND METHODS for
details). Correct gene replacement was confirmed by Southern blotting
(our unpublished data). As expected, pulse-chase analysis of
YDR255c-deleted cells showed a defect in degradation of
FBPase after glucose addition (Figure 1, C and D). Analysis of
gid2-1 ydr255c
diploid cells confirmed the identity of
YDR255c as GID2 (our unpublished data).
|
In a similar approach using gid1-3 mutant cells, a
complementing plasmid carrying a fragment from chromosome VII was
isolated (Figure 2A). YGL227w
was identified as the complementing ORF encoding a protein of 108 kDa.
Deletion of YGL227w also showed a significant defect in
glucose-induced degradation of FBPase in pulse-chase measurements
(Figure 2, B and C). The defect of gid1-3 ygl227w
diploid
cells in breakdown of FBPase after glucose addition confirmed the
identity of GID1 with YGL227w (our unpublished
data).
|
Features of Gid1p and Gid2p
Based on unpublished results presented in the
Saccharomyces genome database (SGD;
http://genome-www.stanford.edu/saccharomyces/) and Incyte Genomics
(http://www.incyte.com/proteome/YPDsearch-quick.html), we
identified Gid1p as Vid30p, a protein that is proposed to be involved
in glucose-induced degradation of FBPase in the vacuole. A function of
Vid30p in the regulation of nitrogen metabolism has also been suggested
(van der Merwe et al., 2001
). A search for amino acid motifs
identified a LisH and a CTLH motif within Gid1p/Vid30p. According to
the SMART database, the LisH domain might be involved in regulation of
microtubule dynamics, and the CTLH domain of unknown function is
typically found C-terminal to the LisH motif. Interestingly, Gid2p also
contains a CTLH motif. Furthermore, a putative transmembrane domain is
found in Gid2p located between amino acids 301-323. The occurrence of
these domains, however, does not suggest any function for Gid1p or
Gid2p. Herein, we focus on the functional characterization of Gid2p.
Gid2p Is Essential for Glucose-induced Ubiquitination of FBPase
Our previous work demonstrated that glucose-induced degradation of
FBPase depends on ubiquitination of the enzyme via the ubiquitin-conjugating enzymes Ubc1p, Ubc4p, Ubc5p, and Ubc8p followed by proteolysis dependent on the activity of the proteasome (Schork et al., 1995
; Schüle et al., 2000
). By
using these standard conditions, FBPase degradation is impaired in
mutants defective in subunits of the 20S core and the 19S cap of the
proteasome, whereas wild-type-like proteolysis occurred in cells devoid
of vacuolar proteinase yscA (Schork et al., 1994a
,b
, 1995
).
To learn more about the function of Gid2p in the proteasome-dependent
degradation of FBPase, we measured glucose-induced ubiquitination of
FBPase in gid2
cells under our standard conditions of
catabolite degradation. In contrast to wild-type cells, no
FBPase-ubiquitin conjugates were detectable in gid2
cells
overexpressing Ha-tagged ubiquitin (Ellison and Hochstrasser, 1991
)
under conditions of catabolite degradation (Figure
3A) (Schork et al., 1995
).
This suggests that Gid2p has an essential function in glucose-induced
ubiquitination of FBPase.
|
N-End Rule Pathway Is Not Affected in gid2
Cells
Short-lived N-end rule substrates such as the
Arg-
-galactosidase fusion protein (Arg-
-gal) are known to be
rapidly degraded via the ubiquitin proteasome pathway (Bachmair
et al., 1986
; Richter-Ruoff et al., 1992
; Seufert
and Jentsch, 1992
). Previous experiments suggested an increased level
of Arg-
-gal in gid2-1 mutant cells compared with wild
type (Hämmerle et al., 1998
). Following the fate of
Arg-
-gal in gid2
cells via pulse-chase measurements did not uncover an altered degradation of the substrate (Figure 3B).
This finding rules out a function of Gid2p in the N-end rule pathway.
Gid2p Is Part of a Soluble Protein Complex
Using a PCR fragment consisting of a triple Ha-tag and a
selectable marker (see MATERIAL AND METHODS), we generated a
chromosomally integrated, carboxy-terminally tagged version of Gid2p
expressed from its native promoter. Correct integration at the
GID2 locus was confirmed by Southern analysis (our
unpublished data). Wild-type-like degradation of FBPase,
monitored by pulse-chase analysis (Figure 4, A and B), confirmed biological
activity of the Ha-tagged Gid2p-version Gid2-Ha3.
Consistent with its role in glucose-induced degradation of FBPase, only
minor amounts of Gid2-Ha3 were detectable in
cells grown in the presence of glucose (log-phase cells) (Figure 4C). Most interestingly, the level of Gid2-Ha3
significantly increased, when the cells were grown in ethanol medium
(Figure 4C). After addition of glucose to ethanol-derepressed cells
Gid2-Ha3 is relatively stable, consistent with
its important function during the metabolic switch from gluconeogenesis
to glycolysis.
|
The localization of Gid2-Ha3 was analyzed on
sucrose density gradients. We used cells grown on ethanol medium and
cells grown on ethanol and thereafter incubated for 30 min in medium
containing glucose, conditions that induce catabolite degradation.
Under both conditions FBPase cosedimented with the cytosolic marker enzyme PGK and the soluble vacuolar carboxypeptidase yscY (CPY) (Figure
5, A and B). In the same gradient
Gid2-Ha3 moves somewhat further into higher
density fractions (Figure 5, A and B), in which large, soluble protein
complexes such as fatty acid synthase (Fas, molecular mass ~2.4 MDa;
Egner et al., 1993
) and API (molecular mass 600 kDa; Kim
et al., 1997
) are also located. Because the calculated
molecular mass of Gid2p is 49 kDa, this suggests that Gid2-Ha3 may either be part of a large protein
complex or may be associated with a low-density membrane fraction. To
distinguish between these possibilities and to check whether
Gid2-Ha3 is localized in the vacuole or in the
cytosol, we performed an additional cell fractionation experiment
(Schüle et al., 2000
). Cells taken 30 min after shift
to glucose medium were spheroplasted, hypotonically lysed (without
affecting the integrity of the vacuole), and centrifuged at 6000 × g. The centrifugation yields a S6
supernatant and a P6 pellet fraction. The
P6 fraction was enriched with the endoplasmic reticulum (ER) and the vacuole as shown by the appearance of Kar2p (BiP), a lumenal ER chaperone, and the soluble vacuolar CPY
(Figure 6A). FBPase and
Gid2-Ha3 were almost completely absent from the P6 fraction (Figure 6A). The 6000 × g supernatant (S6) was subjected to a
high-speed centrifugation at 100,000 × g, yielding a
P1 pellet and a S1
supernatant fraction. Both FBPase and Gid2-Ha3
were found almost exclusively in the S1 fraction
together with the cytosolic marker enzyme PGK (Figure 6A), suggesting
that they are soluble, cytosolic proteins. This finding is compatible
with localization studies performed using indirect immunofluorescence
where Gid2-Ha3 is seen in the cytosol (our
unpublished data).
|
|
To further analyze whether Gid2-Ha3 is part of a protein complex, we examined the sedimentation behavior of the protein in a glycerol density gradient with extracts from cells taken 30 min after onset of glucose-triggered inactivation (Figure 6B). Gid2-Ha3 sedimented mainly in fractions 6 and 7, where the maximum of aminopeptidase I with an approximate mass of 600 kDa was also found (Figure 6B). Fatty acid synthase was detected in fractions 8-10. To check whether the sedimentation of Gid2-Ha3 is due to membrane association, we repeated the glycerol gradient fractionation in the presence of 0.2% (our unpublished data) and 1% Triton X-100 (Figure 6C). A similar sedimentation pattern of Gid2-Ha3 in the presence of detergent argues against membrane association as the reason for the high Mr sedimentation pattern of Gid2-Ha3. Together, these results suggest that Gid2-Ha3 is part of a cytosolic protein complex with a molecular mass of at least 600 kDa.
The site of catabolite degradation of FBPase is a matter of an ongoing
debate (Schork et al., 1994b
). Although we find a cytosolic, ubiquitin-proteasome-dependent catabolite degradation of FBPase (Schork et al., 1994a
,b
, 1995
; Hämmerle et
al., 1998
; Schüle et al., 2000
), vacuolar
degradation of FBPase (Chiang and Schekman, 1991
) and the involvement
of vesicular intermediates in this process has also been suggested
(Huang and Chiang, 1997
; Chiang and Chiang, 1998
). We therefore were
interested in whether some FBPase became membrane protected during the
catabolite degradation process in gid2
cells. To test
this, ethanol grown cells were taken before and after a 30-min shift to
glucose medium, spheroplasted, and hypotonically lysed. Aliquots of the
lysed spheroplasts were incubated with proteinase K and, as a control,
with proteinase K and Triton X-100. As shown in Figure
7A, no proteinase-protected FBPase
protein was detectable under the conditions used. In a similar
experiment, we tested for membrane trapped Gid2p in wild-type cells
expressing Gid2-Ha3 from the chromosome. No
proteinase-protected Gid2-Ha3 was detectable
before or after shifting the cells for 30 min to glucose medium (Figure
7B). Together, our data suggest that under our testing conditions,
Gid2-Ha3 is part of a cytosolic, soluble protein
complex and that FBPase is not engulfed into vesicles in
gid2
cells during glucose-induced degradation.
|
Identification of Six Additional GID Genes, Essential for Proteasome-dependent FBPase Catabolite Degradation
Because Gid2-Ha3 is part of a protein
complex with a molecular mass of at least 600 kDa, it is highly
probable that the complex contained additional gene products involved
in the catabolite degradation of FBPase. Because our initial screen
identified only three complementation groups (Hämmerle et
al., 1998
), we developed an alternative genomic approach to
identify further GID genes. The "yeast gene deletion
project" created about 5000 yeast strains, each deleted for an
individual gene (EUROSCARF). This yeast deletion strain collection
represents all nonessential genes and covers ~85% of the yeast
genome. The deletion strains, supplied in 96-well microtiter plates,
were grown in rich medium containing glucose, and then each strain was
dropped onto YPEthanol plates and grown for 1 d to derepress
FBPase. Subsequently, cells were transferred onto nitrocellulose
sheets, incubated with glucose medium to induce degradation of FBPase,
and the remaining amount of FBPase was detected using specific
antibodies (for details, see MATERIALS AND METHODS). Putative
gid-mutants were identified on the basis of their darker
immunostaining compared with wild-type cells. Candidate colonies were
picked and catabolite degradation of FBPase was examined by
immunoblotting (our unpublished data) and
pulse-chase analysis (Figure 8, A-E). In
this way, besides GID1, GID2, and GID3, we identified six novel GID genes (Table
2). All cells deleted in GID
genes grow normally on rich media containing either glucose or ethanol
as carbon source (our unpublished data).
|
|
Among these six new proteins, Gid7p (Figure 8A), Gid8p (Figure 8A), and
Gid9p (Figure 8B) are of unknown function. Ubp14p/Gid6p (Figure 8C), a
deubiquitinating enzyme was also found to affect proteasome-dependent
catabolite degradation of FBPase. Ubp14p is proposed to prevent
inhibition of proteasomal degradation by removing ubiquitin chains,
which may otherwise compete with substrate molecules binding to the
proteasome (Amerik et al., 1997
). Pulse-chase analysis
showed a threefold decreased rate in catabolite degradation of FBPase
in cells lacking Ubp14p/Gid6p (Figure 8C). Pulse-chase experiments
using cells lacking GID9 and also GID5/VID28
showed a somewhat smaller amount of labeled FBPase. This could be
overcome by extending the labeling time from 3.5 h to 16 h.
These conditions lead to a slightly delayed degradation kinetics of
FBPase in wild-type cells (half-life ~60 min).
Most interestingly, our genomic screen also identified Vid24p/Gid4p
(Figure 8D) and Vid28p/Gid5p (Figure 8E) as components essential for
proteasome-dependent catabolite degradation of FBPase. This was
surprising because Vid24p had been previously described as a peripheral
membrane protein located at Vid-vesicles implicated in transport of
FBPase to the vacuole during glucose-induced vacuolar degradation
(Chiang and Chiang, 1998
). Because these researchers reported that in
the absence of Vid24p FBPase accumulated trapped inside Vid-vesicles,
Vid24p had been proposed to function in vacuolar targeting of
FBPase-containing vesicles (Chiang and Chiang, 1998
).
Only a Subset of Vid-Proteins Affect Proteasome-dependent Catabolite Degradation of FBPase
Based on database entries, Vid30p/Gid1p and Vid28p/Gid5p also
should be implicated in glucose-induced vacuolar degradation of FBPase,
but so far the respective data have not been published. The finding
that three gene products, Vid30p/Gid1p, Vid24p/Gid4p, Vid28p/Gid5p,
which were reported to affect vacuolar FBPase degradation, also act in
proteasome-dependent FBPase degradation raised the question whether
there may be a general overlap between these two sets of genes,
GID and VID, in FBPase degradation. We therefore additionally analyzed Vid22p and Cpr1p, cyclophilin A, a mediator of
Vid22p function, which were both shown to affect vacuolar FBPase degradation (Brown et al., 2001
, 2002
), for their
involvement in proteasome-dependent degradation of FBPase. We also
included cells devoid of Vid27p in our analysis. Involvement of Vid27p in vacuolar catabolite inactivation of FBPase is not published but is
mentioned in the SGD and the Incyte Genomics YPD database. Under our
standard conditions, pulse-chase analysis demonstrates that in cells
lacking either Vid22p, Cpr1p, or Vid27p proteasome-dependent degradation of FBPase is not affected (Figure
9, A and B). Together, our data suggest
the existence of two glucose-induced degradation pathways for FBPase
exhibiting a partial, but not complete overlap.
|
GID Genes Are Not Involved in Catabolite Degradation of Galactose Permease (Gal2p)
Not only cytoplasmic FBPase undergoes glucose-induced catabolite
degradation. The plasma membrane bound sugar transporter galactose
permease (Gal2p) is also a target of this mechanism. In contrast to
ubiquitin-proteasome-mediated degradation of FBPase, Gal2p undergoes
ubiquitin-linked endocytosis followed by degradation in the vacuole
(Horak and Wolf, 1997
, 2001
). Interestingly, both proteolytic pathways
are induced by the same components of glucose signaling (Horak et
al., 2002
). We therefore tested whether the Gid-proteins
identified herein to be involved in FBPase degradation, play any role
in the catabolite degradation of Gal2p. We did not find an alteration
of Gal2p degradation (our unpublished data) in any of the nine
mutants defective in a single GID gene (gid1
to gid9
), indicating the specificity of these gene
products in ubiquitin-proteasome-dependent degradation of FBPase.
Also, deletions in VID22 and VID27, suggested to
be involved in vacuolar FBPase degradation (Brown et al.,
2001
, 2002
; database entry) did not affect the glucose-induced Gal2p
breakdown (our unpublished data).
| |
DISCUSSION |
|---|
|
|
|---|
As a result of two independent screens, we identified eight novel
GID genes involved in glucose-induced proteasome-dependent catabolite degradation of FBPase. In an initial screen using chemical mutagenesis, we isolated gid-mutant cells defective in the
degradation of a FBPase-
-galactosidase fusion protein. By
complementation of the FBPase degradation phenotype of
gid1-3 and gid2-1 mutant cells with a yeast
genomic library, we identified the respective genes as
YGL227w/GID1 and
YDR255c/GID2. In addition, we started a novel
reverse genomic approach by using a yeast deletion collection consisting of ~5000 individual clones, each lacking a nonessential gene. The collection covers ~85% of the total genome. This approach was possible because a defective degradation of FBPase is not lethal.
When using this mutant collection, identification of a deletion strain
is synonymous with the identification of the respective gene. The
screen detected the known genes GID1/VID30, GID2, and the
previously identified UBC8/GID3 gene (Schüle et
al., 2000
) as expected. In addition, six novel genes involved in
proteasome-dependent catabolite inactivation of FBPase were discovered:
GID4/VID24, GID5/VID28, GID6/UBP14,
GID7, GID8, and GID9.
Lack of Ubp14p/Gid6p resulted in a threefold decrease of FBPase
breakdown (Figure 8C). Ubp14p is thought to act as a "helper" enzyme during proteasomal breakdown of ubiquitinated proteins (Amerik
et al., 1997
). It disassembles free ubiquitin chains, which
would otherwise compete with binding of ubiquitinated proteins to the
proteasome. Ubp14p thus accelerates proteasomal breakdown of
ubiquitinated proteins. Under our conditions used previously for
measuring catabolite degradation (Schork et al., 1994a
,b
; Hämmerle et al., 1998
; Schüle et al.,
2000
; this article), breakdown of FBPase was only dependent on the
activity of the cytosolic ubiquitin-proteasome system. Consistent with
this finding, we demonstrated an essential function of ubiquitin
conjugation (Schork et al., 1995
) and of the
ubiquitin-conjugating enzyme Ubc8p (Schüle et al.,
2000
). Retardation of FBPase degradation in ubp14
cells further supports our view that proteasomal degradation rather than
ubiquitination alone is an essential step of catabolite inactivation.
Most interestingly, with Gid4p/Vid24p, Gid1p/Vid30p, and Gid5p/Vid28p
we also detected some VID gene products in our genomic screen. A functional study is only reported for Vid24p (Chiang and
Chiang, 1998
). The involvement of Vid30p and Vid28p in vacuolar catabolite degradation is solely based on database entries (SGD and
Incyte Genomics YPD database). Identification of Vid-proteins necessary
for proteasomal degradation of FBPase was unexpected because the
vacuolar catabolite degradation of the enzyme is supposed to start with
the sequestration of FBPase into so-called Vid-vesicles in response to
glucose addition to cells. These vesicles are thought to deliver FBPase
to the vacuolar lumen, where proteinase yscA-dependent degradation
should occur. Vid24p has been localized as a peripheral membrane
protein to the cytosolic surface of the Vid-vesicles. Because lack of
Vid24p leads to accumulation of FBPase in these vesicles, a targeting
function had been attributed to Vid24p (Chiang and Chiang, 1998
). In
this context, the function of some Vid proteins and especially of
Vid24p for proteasome-dependent FBPase degradation is an enigma.
We therefore examined whether some other VID genes might be
essential for proteasome-dependent catabolite inactivation. We analyzed
the involvement of Vid22p and Cpr1p in this process, which have been
shown to affect vacuolar FBPase degradation (Brown et al.,
2001
, 2002
) and Vid27p. The participation of Vid27p in vacuolar FBPase
degradation is based on a database entry. Our pulse-chase analysis of
FBPase degradation under conditions allowing proteasome-dependent
inactivation showed wild-type-like kinetics of FBPase breakdown in
vid22
, vid27
, and cpr1
cells
(Figure 9). Also a deletion of Ssa2p, which was shown to affect
vacuolar FBPase degradation (Brown et al., 2000
), did not
alter proteasome-dependent degradation of FBPase (our unpublished
data). This suggests, that catabolite inactivation of FBPase
might be mediated by two distinct pathways, which share some components
such as Gid1p/Vid30p, Gid4p/Vid24p, and Gid5p/Vid28p. In contrast to
Chiang et al. we were unable to find glucose triggered
vacuolar degradation of FBPase (Wolf and Ehmann, 1979
; Mechler and
Wolf, 1981
; Teichert et al., 1989
; Schork et al.,
1994a
;b
; Schüle et al., 2000
). Because we discovered the participation of some VID-genes in proteasome-linked
degradation of FBPase, we repeated catabolite degradation studies of
the enzyme in mutants defective in VID22 under our
conditions and under conditions used by the laboratories of Chiang
(Hoffman and Chiang, 1996
) and Broach (Jiang et al., 1998
).
No stabilization of FBPase was observed under both conditions in the
vid22 mutant (our unpublished data; Figure 9B). These
negative results prevented us from determining the influence of
Gid-proteins on vacuolar-dependent FBPase degradation. It is therefore
still unclear under which conditions the cells activate the
vacuolar-dependent FBPase degradation pathway. The glucose signaling
mechanisms for the vacuolar and the proteasomal catabolite degradation
pathways of FBPase must be different. In fact, although vacuolar
degradation of FBPase was reported to be dependent on the known
cAMP-triggered protein kinase A cascade and FBPase phosphorylation
(Jiang et al., 1998
), the proteasome-dependent degradation
pathway of FBPase is not (Hämmerle et al., 1998
; Horak
et al., 2002
). Instead, other signal transduction components such as Grr1p and Reg1p are necessary for proteasomal FBPase
degradation (Horak et al., 2002
). These same signaling
components are also necessary for endocytotic internalization and
vacuolar catabolite degradation of the plasma membrane localized
galactose transporter Gal2p (Horak et al., 2002
). We
therefore tested whether the GID genes are also involved in
Gal2p proteolysis. Following the fate of Gal2p via
immunoblotting in all gid-mutants, we
observed wild-type-like degradation (our unpublished data).
These data suggest a specific involvement of Gid-proteins in the
catabolite inactivation of FBPase.
Our experiments (Figures 5-7) suggest that biologically active Gid2-Ha3 expressed from the chromosome with its native promoter is part of a soluble, cytosolic protein complex with a molecular mass of at least 600 kDa. We did not find any indication for membrane association of Gid2-Ha3, even though the sequence of Gid2p suggests the presence of a putative transmembrane domain. Gid2p is a necessary component for ubiquitination of FBPase to occur. Under the conditions used to induce proteasome-dependent catabolite inactivation of FBPase, we did not find any hint for the involvement of vesicular intermediates in the process so far.
Our genetic analysis for proteasome-dependent catabolite degradation of
FBPase identified eight novel proteins required for this process. These
novel Gid proteins are good candidates for being components of the
high-molecular-mass complex in which Gid2p resides (Figures 5 and 6).
Indeed, during the preparation of this article, a systematic mass
spectrometry search for protein complexes by using Gid7p and Ybl049wp
as bait proteins revealed that Gid2p may be part of a larger protein
complex (Ho et al., 2002
). Proteins interacting with both
Gid7p and Ybl049wp were Gid1p/Vid30p, Gid2p, Gid5p/Vid28p, Gid7p,
Gid8p, and Gid9p (Ho et al., 2002
); furthermore, Vid24p/Gid4p was detected as an interactor of Gid7p. No function for
most of these proteins has yet been suggested. The findings could imply
the existence of a protein complex consisting of eight individual
proteins, seven of which we have identified to be essential for
proteasome-dependent catabolite degradation of FBPase. Because the
study of Ho et al. (2002)
also identified Ybl049wp as a
putative member of this protein complex, we tested the fate of FBPase
in YBL049w-deleted cells by pulse-chase analysis (Figure
8B). Surprisingly, under our conditions wild-type-like degradation of
FBPase occurred. This might indicate that, with interchanging
components, the "Gid-protein complex" may also be involved in
functions distinct from proteasome-dependent catabolite degradation of FBPase.
A motif search identified the presence of six WD40 repeats in Gid7p
(between amino acids 316-351, 363-399, 448-487, 608-643, 651-687,
and 693-741). No common function is attributed to WD40 repeat
proteins. Rather, it is thought that their common
-propeller fold
formed by the WD40 repeats acts as a platform, allowing sequential and
simultaneous interactions with several proteins (Smith et al., 1999
). One might therefore speculate that Gid7p plays such a
role in the proposed Gid-protein complex.
Interestingly, the previously mentioned LisH domain is present in Gid1p
and in Gid8p. The occurrence of this motif is thought to be linked to
regulation of microtubule dynamics (Smith et al., 2000
), but
no clear function can actually be deduced from its presence. C-terminal
to the LisH domain the
-helical CTLH domain of unknown function is
also present in some proteins. Most interestingly, in the yeast genome
the CTLH domain is present only in four proteins: Gid1p, Gid2p, Gid8p,
and Gid9p. Our study attributes function of these CTLH
domain-containing proteins in proteasome-dependent glucose-induced
catabolite degradation of FBPase. This is especially interesting
because >90 proteins from different organisms ranging from
Arabidopsis to human are known to also contain this domain. None of our newly discovered Gid proteins contain a signature sequence
found in ubiquitin-protein ligases (E3s). Whether one of the Gid
proteins or part of the complex represents a new type of E3 is unknown.
Further studies will be necessary to determine the precise molecular composition, the topology and the dynamics of the putative "Gid-protein complex." Finally, the function(s) of the entire complex will have to be elucidated.
| |
ACKNOWLEDGMENTS |
|---|
We thank Michael N. Hall for providing yeast strains. The expert help of E. Tosta with preparation of this article is acknowledged. This work was supported by the "Deutsche Forschungsgemeinschaft", SFB 495, and the "Fonds der Chemischen Industrie". J.H. was supported by grants 204/01/0272 and 204/02/1240 from the grant agency of the Czech Republic and by Institutional Research Concept No. AVOZ 5011922.
| |
FOOTNOTES |
|---|
* These authors contributed equally to this work.
Corresponding author. E-mail address:
dieter.wolf{at}po.uni-stuttgart.de.
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-08-0456. Article and publication date are at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-08-0456.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. R. Brown, A. B. Wolfe, D. Cui, and H.-L. Chiang The Vacuolar Import and Degradation Pathway Merges with the Endocytic Pathway to Deliver Fructose-1,6-bisphosphatase to the Vacuole for Degradation J. Biol. Chem., September 19, 2008; 283(38): 26116 - 26127. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Santt, T. Pfirrmann, B. Braun, J. Juretschke, P. Kimmig, H. Scheel, K. Hofmann, M. Thumm, and D. H. Wolf The Yeast GID Complex, a Novel Ubiquitin Ligase (E3) Involved in the Regulation of Carbohydrate Metabolism Mol. Biol. Cell, August 1, 2008; 19(8): 3323 - 3333. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Soontorngun, M. Larochelle, S. Drouin, F. Robert, and B. Turcotte Regulation of Gluconeogenesis in Saccharomyces cerevisiae Is Mediated by Activator and Repressor Functions of Rds2 Mol. Cell. Biol., November 15, 2007; 27(22): 7895 - 7905. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Santangelo Glucose Signaling in Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., March 1, 2006; 70(1): 253 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Scholtens, M. Vidal, and R. Gentleman Local modeling of global interactome networks Bioinformatics, September 1, 2005; 21(17): 3548 - 3557. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pathak, L. M. Bogomolnaya, J. Guo, and M. Polymenis Gid8p (Dcr1p) and Dcr2p Function in a Common Pathway To Promote START Completion in Saccharomyces cerevisiae Eukaryot. Cell, December 1, 2004; 3(6): 1627 - 1638. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-C. Hung, C. R. Brown, A. B. Wolfe, J. Liu, and H.-L. Chiang Degradation of the Gluconeogenic Enzymes Fructose-1,6-bisphosphatase and Malate Dehydrogenase Is Mediated by Distinct Proteolytic Pathways and Signaling Events J. Biol. Chem., November 19, 2004; 279(47): 49138 - 49150. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sato, H. Imanaka, N. Rashid, T. Fukui, H. Atomi, and T. Imanaka Genetic Evidence Identifying the True Gluconeogenic Fructose-1,6-Bisphosphatase in Thermococcus kodakaraensis and Other Hyperthermophiles J. Bacteriol., September 1, 2004; 186(17): 5799 - 5807. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||