![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, Issue 5, 1941-1952, May 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Pediatrics and
Department of Medicine, Renal Division, University of Colorado Health Sciences Center, Denver, Colorado 80262; and
Commonwealth Scientific and Industrial Research Organization, Molecular
Science, North Ryde, NSW 1670, Australia
Submitted August 15, 2002;
Revised December 17, 2002;
Accepted December 27, 2002
Monitoring Editor: Richard Assoian
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
; Cook et al.,
1994; Weiser-Evans et
al., 2000). In the absence of vascular trauma, however, the
mature blood vessel remains a highly quiescent tissue, and SMCs are resistant
to stimulation by most mitogens, suggesting the existence of active
growth-suppressive mechanisms (Lindner
et al., 1990; Weiser
et al., 1995). Individual SMCs within the medial layer of
mature arteries are surrounded by an extracellular basement membrane matrix
consisting predominantly of laminin (LN), collagen type IV (IV), fibronectin
(FN), and perlecan (PN) heparan sulfate
(Heickendorff, 1989). This
basement membrane envelopes the SMCs, providing a barrier between the cell and
its local microenvironment, and influences the general biological function of
the cell. Previous data indicate that fully assembled basement membranes
promote SMC differentiation and are nonpermissive to mitogen-induced SMC
growth (Li et al.,
1994; Weiser et al.,
1997; Hedin et al.,
1999). Perlecan is the dominant effector of this
growth-suppressive response, and the HS chains of perlecan contribute to SMC
growth inhibition (Weiser et al.,
1997). In contrast, other basement membrane proteins appear to
facilitate mitogen-induced SMC replication
(Hedin et al., 1988;
Thyberg and Hultgardh-Nilsson,
1994).
Perlecan is present in a variety of basement membranes, including those
surrounding vascular SMCs (Hassell et
al., 1980; Kleinman
et al., 1986;
Couchman, 1987;
Murdoch et al.,1994).
Perlecan is essential for the assembly and maintenance of a functionally
complete basement membrane
(Arikawa-Hirasawa et al.,
1999; Mercedes et
al., 1999) and plays a major role in the regulation of a wide
variety of cellular processes, including migration, proliferation, adhesion,
and regulation of growth factor activities
(Iozzo et al., 1994).
Homozygous perlecan-null mice die in utero, at least in part because of severe
cardiovascular abnormalities. Pertinent to the present study, hyperplasia of
SMC-specific 
-actin–positive mesenchymal cells was noted
(Costell et al.,
2002). In addition, a number of studies have clearly demonstrated
that perlecan is an important molecule in the control of SMC replication.
Available evidence indicates that significant amounts of perlecan are produced
by SMCs and that perlecan exists normally within the SMC basement membrane and
functions as an endogenous suppressor of SMC replication
(Fritze et al., 1985;
Weiser et al., 1996,
1997;
Bingley et al., 1998;
Nugent et al., 2000).
However, the intracellular signaling events underlying perlecan-induced SMC
growth inhibition are unknown.
Our previous data and studies by others suggest that the assembly of a
perlecan-rich SMC basement membrane actively prevents SMCs from replicating in
the absence of matrix injury. We showed that growth inhibition by the
extracellular basement membrane is driven by perlecan HS compared with
chondroitin sulfate–rich proteoglycans and other basement membrane
proteins. We therefore sought to determine the mechanism that mediates the
effect of perlecan on SMC growth. The proliferation of most nontransformed
cells is mediated through the cooperation between extracellular matrix
(ECM)–integrin receptor interactions and growth factor signaling
pathways (Assoian, 1997;
Jones et al., 1997;
Howe et al., 1998).
Focal adhesion kinase (FAK) integrates integrin and growth factor receptor
signaling pathways and transduces such signals to the downstream ERK1/2
pathway (Howe et al.,
1998; Renshaw et al.,
1999), making FAK important for cell growth
(Schaller and Parsons, 1994;
Gilmore and Romer, 1996;
Sieg et al., 2000).
Focal adhesion kinase-related nonkinase (FRNK) is a critical regulator of FAK
activity, its expression is highly restricted to vascular SMC lineages, and
its in vivo expression patterns are similar to those reported for perlecan and
inversely correlated to SMC growth (Taylor
et al., 2001). In the present study, we hypothesized that
perlecan actively suppresses SMC proliferation via the up-regulation of FRNK.
Collectively, we hypothesized that perlecan-induced up-regulation of FRNK
mediates the SMC-specific growth-inhibitory effects of perlecan via the active
inhibition of FAK-induced, ERK1/2-dependent cell cycle progression.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). Briefly, conditioned media were collected, purified by DEAE
chromatography followed by anti-perlecan immunoaffinity chromatography using
perlecan domain 1–specific antibodies (specific for the perlecan core
protein), and characterized using enzyme-linked immunosorbent assays.
Bromodeoxyuridine (BrdU), myelin basic protein (MBP), heparin lyase I and II,
chondroitin ABC lyase, HS, and monoclonal human-specific anti-myc (clone 9E10)
antibody were from Sigma Chemicals (St. Louis, MO). Monoclonal anti-perlecan
antibody was from Zymed Laboratories (South San Francisco, CA). Polyclonal
anti–FAK-748–1053C, monoclonal
anti–FAK-1–423N, and human-specific monoclonal
anti-IL2R antibodies were from Upstate Biotechnology (Lake Placid, NY).
Polyclonal anti–phospho-p42/p44 ERK and anti–total p42/p44 ERK
antibodies were from New England Biolabs, Inc. (Beverly, MA). Polyclonal
anti–phospho-FAK (Y397) antibody was from Biosource
International (Camarillo, CA). Monoclonal anti-paxillin antibody was from
Transduction Laboratories (Lexington, KY). Monoclonal anti-BrdU and
FITC-conjugated anti-BrdU were from Becton Dickinson (Franklin Lakes, NJ).
Rhodamine-labeled phalloidin was from Molecular Probes (Eugene, OR), and Cy3-
and FITC-conjugated antibodies to mouse and rabbit IgGs were from Jackson
Immunoresearch Laboratories (West Grove, PA). Enhanced chemiluminescence
Western blotting detection reagents were from Amersham Life Science, Inc.
(Arlington Heights, IL). All tissue culture supplies were from Life
Technologies (Gaithersburg, MD). [
-32P]ATP was from
Dupont-New England Nuclear (Boston, MA). The Bradford protein assay kit was
from Bio-Rad (Richmond, CA).
Cell Culture and Growth Assays
The aortic media from adult Sprague Dawley rats was aseptically dissected,
and SMCs were obtained by explant technique as previously described
(Weiser-Evans et al.,
2000). The rat thoracic aorta SMC cell line, A10 SMC, was obtained
from American Type Culture Collection (Rockville, MD; ATCC CRL 1476) and used
for transfection studies. Glass coverslips or bacteriological plastic (Pl) was
precoated with 10 µg/ml FN, LN, or IV or 5 µg/ml PN overnight at 4°C
and then blocked with 10 mg/ml BSA for 1 h at 37°C. Cell culture flasks
were coated with 50 ml/cm2 Matrigel before cell plating. SMC
replication was analyzed by BrdU immunocytochemistry as described previously
(Weiser-Evans et al.,
2000).
Plasmids and Transfections
A cytomegalovirus (CMV) promoter–based plasmid containing wild-type
myc-tagged FRNK was a kind gift from Dr. J.T. Parsons (Department of
Microbiology, Health Sciences Center, University of Virginia, Charlottesville,
VA). CMV promoter–based plasmids containing wild-type IL2R-tagged,
constitutively activated FAK and dominant negative, kinase inactive
IL2R-tagged FAKY397F were kind gifts from Dr. K.M. Yamada
(Craniofacial Developmental Biology and Regeneration Branch, National
Institute of Dental and Craniofacial Research, National Institutes of Health
[NIH], Bethesda, MD). A10 SMCs were transfected by use of the Effectene
transfection reagent (Qiagen, Valencia, CA). Using this protocol, equal
transfection efficiencies of myc-FRNK, IL2R-FAKwt, and
IL2R-FAKY397F were obtained (30–40%). For luciferase assays,
a 2482–base pair fragment spanning nucleotides –1989
and +403 of the FRNK genomic sequence
(Nolan et al., 1999)
was amplified using RT-PCR, chicken genomic DNA as template, and the following
primer sets: 5': GGATCCAAGCTTCTTCATCAG CCTTATGGC and 3':
GGTACCTTGGAGGAGGGAGCTGCCAATT. The PCR product was subcloned into the
BamHI and KpnI sites of the pXP2 luciferase reporter vector
(Nordeen, 1988). Proper
orientation and sequence were confirmed by sequence analysis. A10 SMCs were
plated in complete growth medium the day before transfection. Test DNA (1
µg) plus 0.5 µg of CMV-
Gal reporter vector were cotransfected
overnight by the Effectene method, and the cells were allowed to recover for
48 h. Cells were then replated on dishes precoated with FN, PN, or Matrigel
and lysed 4 h after replating in reporter lysis buffer (Promega, Madison, WI).
Luciferase activity for all lysates was quantified in a luminometer using
Promega's luciferase assay system. -Galactosidase activity of each
lysate was measured by standard procedures. Luciferase activity measured for
each lysate was normalized to the relative -galactosidase activity of
the sample to give relative light units.
Preparation of Cell Lysates and Immunoblotting
Total cell proteins were isolated from SMC cultures, and equal amounts of
protein were subjected to SDS-PAGE (4–12% gradient gels; NOVEX system,
Invitrogen, Carlsbad, CA) followed by Western blotting as described previously
(Weiser-Evans et al.,
2000). Ligand–antibody complexes were visualized using
enhanced chemiluminescence detection kits and Hyperfilm x-ray film.
Densitometry readings of phospho-FAK or total FRNK signals were obtained and
normalized to total FAK signals (performed using the public domain NIH Image
program; developed at the U.S. NIH and available at
http://rsb.info.nih.gov/nih-image/).
ERK 1/2 Activity Assay
SMCs were growth-arrested in serum-free medium (SFM) for 48 h and then
replated on specific matrix proteins in the presence or absence of 10% newborn
calf serum for 4 h at 37°C. ERK1 and ERK2 immunocomplexes were obtained
from 100 µg of total protein, and ERK 1/2 activity was determined as
described previously (Li et al.,
1994). ERK 1/2 activity was expressed as picomoles of
32P utilized per minute per milligram protein.
Immunofluorescence Microscopy
SMCs were trypsinized, replated on matrix-coated coverslips, and fixed at 4
h (for phosphorylated FAK and phalloidin) or 24 h (for BrdU) with 4%
paraformaldehyde for 20 min. To analyze cell replication, SMCs were replated
in the presence of 10 mM BrdU. Cells were permeabilized with 0.5% Triton X-100
in PBS for 5 min and incubated with primary antibodies followed by Cy3- or
FITC-conjugated secondary antibodies to visualize antigen–antibody
complexes. Rhodamine-conjugated phalloidin was used to detect stress fiber
formation, and FITC-conjugated anti-BrdU antibodies were used to detect
replicating SMCs. Cells were coverslipped with a DAPI mounting medium (to
detect all cells; Vector Laboratories, Burlingame, CA) and were analyzed using
fluorescent microscopy.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). Plating SMCs on PN but not on FN, LN, or IV mimics the
morphological and gene expression alterations that occur in SMCs plated on
intact basement membranes. To verify that PN is the dominant
growth-suppressive component of basement membranes, rat aortic SMCs were
plated in the presence of 10% NCS on tissue culture Pl or on individual
matrices of FN, LN, IV, or PN and analyzed for their ability to replicate DNA
(using BrdU immunocytochemistry). To examine the effects of basement membrane
glycosaminoglycan side chains on SMC growth, HS or a CSPG mixture was added to
SMCs plated on Pl. Although the CSPG mixture contains large, extracellular
CSPGs, it was added to adhered SMCs because these proteoglycans are
antiadhesive to SMCs (in contrast to PN, which supports adhesion of SMCs; our
unpublished observations). Compared with SMCs plated on Pl, FN, LN, and IV,
DNA synthesis in response to serum stimulation effectively ceased in SMCs
plated on PN (Figure 1A). In
addition, compared with PN, HS or CSPG had little effect on serum-stimulated
growth.
|
There was no loss of cell number or viability when SMCs were plated on PN or basement membranes. SMCs replated from growth-inhibitory matrices to growth-promoting matrices, such as FN, regained the ability to replicate in response to serum stimulation (our unpublished results). All experiments, unless otherwise noted, were conducted in the presence of serum to provide SMCs the necessary requirements for maximal growth on individual matrices. Even under these conditions, perlecan and intact basement membranes retained growth-inhibitory properties.
SMCs cultured on Pl produce abundant amounts of basement membrane
materials, including PN, although assembly of a mature SMC basement membrane
does not occur and these cells remain in a mitogen-responsive state. To
determine whether endogenously produced perlecan attenuates cell growth under
normal culture conditions, SMCs were plated on Pl for 5 d in 10% NCS medium in
the presence or absence of 10 µg/ml anti-perlecan neutralizing antibody.
This antibody neutralizes the SMC growth–inhibitory properties of
perlecan (Paka et al.,
1999). A nonspecific IgG was used as a negative control. There was
a 3.5- to 4-fold increase in cell number in response to serum stimulation in
untreated or nonspecific IgG–treated cultures
(Figure 1B). In contrast, there
was a 7.5-fold increase in cell number in response to serum stimulation in
perlecan antibody-treated cultures, suggesting that endogenously produced
perlecan attenuates mitogen-induced replication of cultured SMCs.
Intact Basement Membranes and Perlecan Suppress SMC ERK1/2
Activation
Adhesion-dependent growth requires the integration of integrin- and growth
factor–mediated signaling events, both of which converge at the level of
ERK1/2. We therefore hypothesized that fully assembled basement membranes, and
PN in particular, suppress SMC growth by actively inhibiting ERK1/2 signaling
events. We first examined ERK1/2 kinase activity after adhesion of SMCs to Pl,
to individual matrices of FN, LN, and IV, and to intact basement membranes.
Using a kinase assay for total MAPK activity (ERK1 and ERK2), we found that
serum-stimulated total MAPK activity was significantly increased in SMCs
plated on Pl and on FN, LN, and IV matrices
(Figure 2A). In contrast,
plating SMCs on basement membranes resulted in suppression of serum-stimulated
total MAPK activation.
|
We next looked at the direct effect of PN on ERK1/2 activation. For these experiments, SMCs were replated on PN or FN matrices in the presence of 10% NCS. Four hours after replating, whole-cell lysates were collected and analyzed by SDS-PAGE for phospho-ERK1/2 and for total ERK1/2. As shown in Figure 2B, SMCs replated on FN showed very high levels of phospho-ERK1/2, whereas SMCs replated on PN showed very low levels of phospho-ERK1/2.
Perlecan Suppresses FAK Activation and Down-modulates Cytoskeletal
Organization and Focal Adhesion Complex Formation
Because FAK integrates integrin and growth factor receptor signaling
pathways and activates downstream ERK1/2-dependent growth pathways, we
examined the effects of basement membranes and PN, compared with Pl and other
basement membrane components, on suppressing FAK activation. SMCs were
maintained in suspension in medium containing serum as a control for
adhesion-mediated FAK activity. Using Western analysis and a total
FAK-specific antibody, we found that equal amounts of total FAK protein were
expressed by SMCs in all conditions (Figure
3A). Although all matrices supported adhesion of SMCs, tyrosine
phosphorylation of FAK (using a Y397 phospho-FAK–specific
antibody) was suppressed in SMCs plated on PN and intact basement membranes
(Figure 3A). Likewise, FAK
phosphorylation was minimal in suspended SMCs. Moreover, FAK phosphorylation
was markedly reduced in cell lysates isolated from the adult uninjured aortic
media, corresponding to very low SMC growth rates in vivo
(Figure 3A; in vivo). These
data suggest that perlecan contributes to SMC growth suppression at least in
part by suppressing FAK-mediated growth signals.
|
Cell adhesion via integrins is associated with cytoskeletal organization and the formation of focal adhesion complexes, resulting in the generation of intracellular signals involved in cell cycle control. We therefore examined the effects of individual basement membrane proteins on SMC spreading and actin microfilament and focal adhesion formation. SMCs were plated on PN, FN, LN, or IV matrices, allowed to attach for 4 h, and were fixed and stained with rhodamine-labeled phalloidin. As shown in Figure 3B, fully developed stress fibers were assembled after adhesion to FN. This pattern of staining was also observed in SMCs plated on LN and IV (our unpublished results). In contrast, after adhesion to PN, cell spreading was reduced and SMCs exhibited poorly assembled stress fibers. Our unpublished results also showed that, although adhesion to FN resulted in the formation of numerous focal adhesions containing paxillin and phosphorylated FAK, adhesion to PN was associated with reduced focal adhesions with little if any phosphorylated FAK present.
Activation of FAK Reverses Perlecan-mediated SMC Growth
Suppression
We next determined whether inhibition of FAK signaling was essential for
the growth-inhibitory effects of perlecan. For these experiments, we tested
whether overexpression of constitutively active FAK could rescue the SMC
growth–inhibitory effects of perlecan. A10 SMCs were transiently
transfected with plasmids containing IL2R-FAK wild-type fusion protein or
IL2R-FAKY397F kinase dead fusion protein. When expressed, the
IL2R-FAK wild-type construct retains constitutive FAK activity, whereas the
IL2R-FAKY397F mutant encodes a dominant negative FAK protein
lacking kinase activity (Tamura et
al., 1999). Transfected SMCs were replated in the presence of
10% NCS and BrdU on coverslips precoated with PN or FN, fixed 24 h later, and
immunofluorescently stained for BrdU and for IL2R (human-specific epitope to
identify transfected SMCs). IL2R-FAK wild-type transfected SMCs demonstrated
high rates of DNA synthesis when plated on PN (comparable to levels observed
on FN; Figure 4A), suggesting
that overexpression of constitutively active FAK could rescue the SMC
growth–inhibitory effects of PN. In contrast, serum-stimulated growth
was significantly suppressed when nontransfected SMCs and dominant negative
IL2R-FAKY397F overexpressing SMCs were plated on PN
(Figure 4A). In our unpublished
results, we also found that SMCs exhibiting high levels of constitutively
active ERK1/2 demonstrated significant increases in cell growth when plated on
perlecan-rich matrices.
|
IL2R-FAK wild-type transfected SMCs showed high rates of DNA synthesis when plated on FN (comparable to or slightly higher than nontransfected controls; Figure 4B). In contrast, growth was significantly decreased in dominant negative IL2R-FAKY397F-overexpressing SMCs. Collectively, these data strongly suggest that suppression of FAK activation is central to perlecan-mediated SMC growth inhibition.
FAK Activity Is Essential for FN-dependent SMC Growth
To verify that FAK is essential for SMC growth, A10 SMCs were transiently
transfected with plasmids containing wild-type, myc-tagged FRNK, a dominant
negative regulator of FAK activity
(Richardson and Parsons,
1996). Transfected SMCs were replated in the presence of 10% NCS
and BrdU on coverslips precoated with FN, fixed 24 h later, and
immunofluorescently stained for BrdU and myc. Nontransfected SMCs exhibited
high rates of DNA synthesis when plated on FN. In contrast, SMC growth was
significantly decreased in FRNK-overexpressing SMCs
(Figure 5A), consistent with a
previous report (Taylor et al.,
2001).
|
Parallel cultures were fixed for immunofluorescence analysis of pFAKY397, or whole-cell lysates were collected for Western analysis of pERK1/2 1 h after replating to determine whether FRNK overexpression alters FAK and ERK1/2 signaling. Nontransfected SMCs were used as controls for Western analysis. As shown in Figure 5B, after 1 h of adhesion, nontransfected SMCs (myc-negative) formed numerous focal adhesions containing phosphorylated FAK. In contrast, although FRNK-overexpressing SMCs (mycpositive) attached and formed focal adhesions on FN, very little, if any, phosphorylated FAK was present. In addition, ERK1/2 activation was significantly suppressed in FRNK-transfected SMCs (Figure 5C). Combined with the IL2R-FAK data (Figure 4), these data confirm that FAK activation is essential for SMC growth. These data also suggest that ERK1/2 acts downstream of FAK in SMCs.
Perlecan–SMC Interactions Suppress FAK Activation through the
Up-regulation of FRNK
FAK activity is modulated by FRNK, a 42-kDa SMC-specific protein consisting
of the carboxyl-terminal noncatalytic domain of FAK
(Richardson and Parsons,
1996). FRNK is transcribed independently by an alternative
promoter within an intron of the FAK gene, 3' of the FAK kinase domain
and 5' of the focal adhesion targeting domain
(Nolan et al., 1999).
FRNK is expressed selectively in vascular SMCs, and its in vivo expression
patterns correlate inversely to high rates of SMC replication during vascular
development and after injury to the adult artery
(Taylor et al.,
2001). These in vivo expression patterns are similar to those
reported for perlecan (Weiser et
al., 1996; Weiser-Evans
and Stenmark, 1999). We therefore examined whether
perlecan–SMC interactions result in the up-regulation of FRNK, which
subsequently suppresses FAK activation. SMCs were plated in the presence of
10% NCS on FN, PN, or basement membrane matrices for 4 h, and whole-cell
lysates were analyzed for total FAK and total FRNK expression using an
anti–FAK carboxyl terminal antibody or for activated FAK using an
anti-pFAKY397 antibody. Equal amounts of total FAK protein were
expressed by SMCs under all conditions
(Figure 6A). Low but detectable
levels of FRNK were expressed by SMCs plated on FN (similar to levels in SMCs
plated on tissue culture Pl; our unpublished results). In contrast, SMCs
plated on basement membranes or on PN matrices exhibited very high levels of
FRNK. Correspondingly, whereas SMCs plated on FN exhibited high levels of
phosphorylated FAK, FAK phosphorylation was suppressed in SMCs plated on
basement membranes or perlecan (Figure
6A). Because perlecan–SMC interactions result in reduced SMC
spreading, as a control for cell-shape changes, we also examined the
expression of FRNK in suspended SMCs. In contrast to the effects mediated by
perlecan, FRNK levels remained low in SMCs maintained in suspension (similar
to levels observed in SMCs plated on FN)
(Figure 6A), suggesting that
perlecan-induced up-regulation of FRNK is independent of cell-shape changes.
The endogenous levels of FRNK up-regulated by basement membranes or PN were
similar to exogenous, overexpressed levels needed to suppress FAK
phosphorylation and growth in SMCs plated on FN
(Figure 6A).
|
We next examined the role of extracellular glycosaminoglycan chains in mediating this effect. In Figure 1, we showed that soluble HS and CSPG were not as effective growth inhibitors as perlecan, suggesting that perlecan core protein–SMC interactions are essential for growth inhibition. To determine whether glycosaminoglycan chains are involved in the up-regulation of FRNK, basement membranes were treated with heparin lyase I/II or chondroitin ABC lyase. SMCs were then plated on untreated or digested membranes in the presence of 10% NCS. In contrast to SMCs plated on untreated or chondroitinase-treated membranes, SMCs plated on heparinase-treated basement membranes exhibited lower levels of FRNK and higher levels of phosphorylated FAK (Figure 6B). However, the decrease in FRNK (and increase in phosphorylated FAK) was considerably less than that observed in SMCs plated on FN matrices.
To determine whether FRNK protein expression correlates to FRNK
transcriptional activity, a 2482-base pair fragment representing the FRNK
promoter (Nolan et al.,
1999) was cloned into the pXP2 luciferase reporter vector
(Nordeen, 1988). This
construct was tested for the ability to drive luciferase expression after
transfection into SMCs. Transfected SMCs were replated in the presence of 10%
NCS on dishes precoated with FN, PN, or basement membranes. As shown in
Figure 7A, SMCs transfected
with the FRNK-LUC construct and replated on FN showed a 10-fold increase in
luciferase activity compared with SMCs transfected with a promoterless control
construct. This suggests that SMCs exhibit basal FRNK promoter activity, most
likely representing SMC-selective expression of FRNK. However, SMCs
transfected with the FRNK-LUC construct and replated on PN or basement
membranes showed 17- and 25-fold increases in luciferase activity,
respectively (Figure 7A),
suggesting that SMC interactions with PN or basement membrane matrices can
actively increase expression of FRNK above basal SMC levels.
|
Previous studies suggest that FAK activity may also be regulated by
calpain-mediated cleavage of FAK (Carragher
et al., 1999). To verify that the 42-kDa protein is FRNK
and not a cleavage product of FAK, SMCs were growth-arrested under serum-free
conditions for 72 h, then replated on FN in SFM or 10% NCS. Western analysis
and anti–FAK carboxyl-terminal and amino-terminal antibodies were used
to detect total FAK, total FRNK, and FAK cleavage products. Replating SMCs on
FN in serum-free conditions induced FAK cleavage, resulting in a significant
reduction in native p125FAK and p41FRNK. Using the C-terminal antibody, this
reduction in FAK and FRNK was accompanied by an increase in a 35-kDa fragment,
consistent with a calpain-sensitive cleavage site in the carboxyl end of FAK
(and in FRNK) (Figure 7B)
(Carragher et al.,
1999). Using the N-terminal antibody, a reduction in FAK was
detected along with an accompanying increase in predominantly a 90-kDa
fragment but also 50-, 42-, and 40-kDa fragments, consistent with several
calpain-sensitive cleavage sites within native FAK
(Figure 7B)
(Carragher et al.,
1999). SMCs replated on FN in serum-rich conditions showed only
native p125FAK and p41FRNK.
The above experiments demonstrated that FRNK is up-regulated when SMCs are plated on nonproliferative compared with proliferative substrates. To determine whether loss of perlecan–SMC interactions results in the rapid degradation of FRNK, SMCs were plated on basement membranes for 24 h (to induce high levels of FRNK), gently removed with dispase digestion, and replated on FN matrices. SMCs were harvested at incremental times after replating and analyzed for total FAK and FRNK. As shown in Figure 7C, within 4 h of replating SMCs on FN, FRNK protein levels decreased significantly to levels comparable to those observed in SMCs plated on FN for 24 h. Collectively, these data suggest that SMC interactions with PN result in selective, active, and continuous up-regulation of FRNK rather than in cleavage of FAK.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
; Aplin and
Juliano, 1999; Giancotti and
Ruoslahti, 1999; Sieg et
al., 2000). However, little is known about how the process of
adhesion-mediated, FAK-dependent cell replication is down-regulated. A fully
assembled, perlecan-rich SMC basement membrane actively suppresses vascular
SMC growth. In the present study, we explored the signaling events underlying
basement membrane– and perlecan-mediated SMC growth suppression. We
showed that SMC interactions with both intact basement membranes and
individual matrices of perlecan result in the active up-regulation of FRNK.
Increased levels of FRNK at least in part contribute to SMC growth inhibition
via the suppression of FAK- and ERK1/2-dependent growth signals. The effects
of perlecan appear to be cell shape independent and unique among the basement
membrane components studied, including FN, IV, LN, and extracellular CSPGs.
The growth-inhibitory effects of perlecan are overridden by constitutively
activating FAK, and by overexpressing FRNK or a kinase-inactivated mutant FAK
construct, we verified that FAK signaling plays an integral role in
ECM-mediated SMC growth. Taken together, we propose that the deposition of
perlecan into the SMC basement membrane acts as an endogenous inhibitor of SMC
growth at least in part by increasing FRNK protein levels, which in turn
down-modulate FAK-dependent growth signals.
We previously demonstrated that, in the absence of vascular trauma or
injury, SMCs in the mature artery remain highly quiescent in large part
because of the incorporation of perlecan HS into the basement membrane (Weiser
et al., 1996,
1997). Injury-induced removal
or proteolysis of perlecan results in increased replicative potential, thus
activating SMCs to respond to mitogenic stimuli
(Weiser et al.,
1997). We proposed that activation of SMCs is mediated through
increased ECM–integrin interactions and subsequent integrin-mediated
intracellular signaling, and perlecan actively inhibits this process through a
previously undefined mechanism. We show here that perlecan–SMC
interactions actively up-regulate FRNK expression. Loss of such interactions
is associated with rapid degradation of FRNK, further strengthening the
hypothesis that active inhibitory and stimulatory mechanisms coordinately
regulate SMC growth.
Interestingly, Taylor et al.
(2001) reported that FRNK is
selectively expressed by SMCs. Vascular SMC expression of FRNK is minimal
during embryonic development; is up-regulated significantly in the early
postnatal vessel, a time point at which SMCs demonstrate significant decreases
in replication (Cook et al.,
1994); and continues to be expressed at low but detectable levels
in the adult vessel. Similar expression patterns are observed after injury to
the adult vessel. These in vivo patterns of expression are similar to those
reported for perlecan (Weiser et
al., 1996; Weiser-Evans
and Stenmark, 1999). The present data suggest that promoter
sequences within the intronic region of the FAK/FRNK gene representing the
FRNK promoter contain perlecan-responsive regulatory elements that are
responsive to changes in SMC adhesive events. Although we have yet to describe
the specific promoter regions responsible for the up-regulation of FRNK,
identification of these regulatory elements will yield important information
on the role of active processes regulating SMC quiescence.
The mechanism mediating perlecan-induced up-regulation of FRNK is not
known. Perlecan gene knockout studies support the hypothesis that interaction
of the perlecan core protein with other basement membrane components
contributes to the assembly and structural integrity of a functionally
complete basement membrane
(Arikawa-Hirasawa et al.,
1999; Mercedes et
al., 1999). Perlecan is known to interact directly with
various ECM proteins, including FN, collagens I, III, IV, and V, and LN
(Whitelock et al.,
1999). Therefore, one possible mechanism is that perlecan prevents
integrins from interacting with basement membrane ligands thus inducing a
passive up-regulation of FRNK through the loss of integrin-mediated
suppression of FRNK gene transcription. In support of this, Lundmark et
al. (2001) demonstrated
that a combined substrate of perlecan and FN significantly reduces SMC
adhesion as well as FAK phosphorylation and SMC growth (our unpublished
results) compared with FN alone. However, unpublished data from our laboratory
suggest that inhibition of integrin function has no effect on FRNK expression,
arguing against a role for integrins in the regulation of FRNK. We are
currently vigorously pursuing the potential role of integrins in the control
of FRNK regulation.
In addition, although perlecan supports adhesion of SMCs, it also
significantly reduces cell spreading compared with other ECM proteins.
Cell-shape changes are associated with cell replication, with cell rounding
usually inducing growth arrest (Assoian,
1997). Therefore, perlecan-mediated inhibition of cell spreading
could result in a passive up-regulation of FRNK and subsequent cell-cycle
arrest. However, whereas adhesion of SMCs to perlecan induced increases in
FRNK, there were no significant changes in FRNK levels in suspended SMCs,
suggesting that up-regulation of FRNK is dependent on perlecan–SMC
interactions but not on cell-shape changes. As in the present study, Motamed
et al. (2002)
reported that the SMC antiproliferative effect of SPARC, a matricellular
glycoprotein, is independent of changes in cell shape.
Alternatively, all of the cellular processes shown to be regulated by
perlecan could be mediated via a cell surface receptor. Our unpublished work,
showing that perlecan interacts directly with the SMC surface, is highly
suggestive of the existence of perlecan-binding proteins. Although a
perlecan-specific receptor has yet to be identified, it remains possible that
these effects occur through a receptor-based mechanism. One report describes a
nonintegrin perlecan-specific binding protein present in membrane extracts of
a variety of cells (Clement et
al., 1989), although further identification of this protein
or a function were not discussed. In addition, two neural-derived CSPGs
inhibit neurite outgrowth, presumably through a receptor-mediated mechanism
that actively inhibits cell attachment to growth-promoting ECM and subsequent
integrin-induced growth (Condic et
al., 1999; Li et
al., 2000). Therefore, it is possible that regulation of FRNK
expression by perlecan is direct, through the interaction with a SMC
membrane–bound receptor. Clearly, identification of a perlecan binding
protein/receptor on the SMC surface will help determine the mechanism of
growth arrest induced by perlecan.
In addition, arterial SMCs synthesize perlecan with highly sulfated HS
chains, and removal increases the adhesion of SMCs to perlecan
(Fritze et al., 1985;
Whitelock et al.,
1999). The present data and our previous work
(Weiser et al., 1997)
indicate that at least some of the activity of perlecan resides in its HS side
chains, consistent with a large body of evidence implicating heparin-like
molecules in the regulation of various SMC functions
(Clowes and Karnovsky, 1977;
Castellot et al.,
1981; Campbell et al.,
1992). However, we showed that addition of soluble HS to cultured
SMCs does not elicit the same degree of growth inhibition
(Figure 1) or changes in FRNK
expression (our unpublished results) as observed with perlecan matrices. Also,
although removal of basement membrane HS chains before plating of SMCs
resulted in reduced FRNK levels, they were not reduced to the low levels
observed in SMCs plated on FN. In addition, the effect of basement membrane
perlecan seems to be unique among extracellular proteoglycans, because
extracellular chondroitin sulfate and/or basement membrane chondroitin sulfate
chains had little effect on SMC growth and FRNK expression. Therefore,
heparin/HS, although a strong inhibitor of SMC growth, is much less potent
than fully sulfated perlecan, suggesting that the efficacy of perlecan on SMC
functions may derive from the coordinate binding of the core protein and the
HS side chains to the SMC surface.
The uncontrolled replication of SMCs is a major contributor to the vessel remodeling observed in a variety of vascular pathological conditions. Despite major advances in vascular biology, the mechanisms regulating continual SMC replication remain unknown, thus adding to the largely unsuccessful treatment and poor clinical outcome. Therefore, an understanding of the normal growth-suppressive mechanisms operative in the mature blood vessel could lead to clinical applications targeted to specific endogenous signaling pathways. The results presented here indicate that the interaction of a fully assembled basement membrane or perlecan HS with individual SMCs results in the active up-regulation of FRNK in a cell shape–independent manner. Our results are consistent with an increasing amount of information supporting a role for perlecan in the inhibition of SMC growth and lesion formation. Because the size and complexity of perlecan realistically limits its potential for therapeutic use, studies are ongoing to define the signaling events mediating these effects.
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
Footnotes |
|---|
Corresponding author. E-mail address:
Mary.Weiser{at}uchsc.edu.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Arikawa-Hirasawa, E., Watanabe, H., Takami, H., Hassell, J.R., and Yamada, Y. (1999). Perlecan is essential for cartilage and cephalic development. Nat. Genet. 23, 354–358.[CrossRef][Medline]
Assoian, R.K. (1997). Anchorage-dependent cell cycle
progression. J. Cell Biol. 136,
1–4.
Bingley, J.A., Hayward, I.P., Campbell, J.H., and Campbell, G.R. (1998). Arterial heparan sulfate proteoglycans inhibit vascular smooth muscle cell proliferation and phenotype change in vitro and neointimal formation in vivo. J. Vasc. Surg. 28, 308–318.[CrossRef][Medline]
Campbell, J.H., Rennick, R.E., Kalevitch, S.G., and Campbell, G.R. (1992). Heparan sulfate-degrading enzymes induce modulation of smooth muscle phenotype. Exp. Cell. Res. 200, 156–167.[CrossRef][Medline]
Carragher, N.O., Levkau, B., Ross, R., and Raines, E.W.
(1999). Degraded collagen fragments promote rapid disassembly of
smooth muscle focal adhesions that correlate with cleavage of
pp125FAK, paxillin, and talin. J. Cell Biol.
147,
619–629.
Castellot, J.J., Addonizio, M.L., Rosenberg, R.D., and Karnovsky,
M.J. (1981). Cultured endothelial cells produce a heparinlike
inhibitor of smooth muscle cell growth. J. Cell. Biol.
90,
372–379.
Clark, E.A., and Brugge, J.S. (1995). Integrins and
signal transduction pathways: the road taken. Science
268,
233–239.
Clement, B., Bartolome, S.R., Hassell, J.R., Martin, G.R., and
Yamada, Y. (1989). Identification of a cell surface-binding
protein for the core protein of basement membrane proteoglycan. J.
Biol. Chem. 264,
12467–12471.
Clowes, A.W., and Karnovsky, M.J. (1977). Suppression by heparin of smooth muscle cell proliferation in injured arteries. Nature 265, 625–626.[CrossRef][Medline]
Clowes, A.W., Reidy, M.A., and Clowes, M.M. (1983). Mechanisms of stenosis after arterial injury. Lab. Invest. 49, 208–215.[Medline]
Condic, M.L., Snow, D.M., and Letourneau, P.C. (1999).
Embryonic neurons adapt to the inhibitory proteoglycan aggrecan by increasing
integrin expression. J. Neurosci.
19,
10036–10043.
Cook, C.L., Weiser, M.C.M., Schwartz, P.E., Jones, C.L., and
Majack, R.A. (1994). Developmentally timed expression of an
embryonic growth phenotype in vascular smooth muscle cells. Circ.
Res. 74,
189–196.
Costell, M., Carmona, R., Gustafsson, E., Gonzalez-Iriarte, M.,
Fassler, R., and Munoz-Chapuli, R. (2002). Hyperplastic
conotruncal endocardial cushions and transposition of great arteries in
perlecan-null mice. Circ. Res.
91,
158–64.
Couchman, J.R. (1987). Heterogenous distribution of a
basement membrane heparan sulfate proteoglycan in rat tissues. J. Cell.
Biol. 105,
1901–1916.
Fritze, L.M., Reilly, C.F., and Rosenberg, R.D.
(1985). An antiproliferative heparan sulfate species produced by
postconfluent smooth muscle cells. J. Cell. Biol.
100,
1041–1049.
Giancotti, F.G., and Ruoslahti, E. (1999). Integrin
signaling. Science 285,
1028–1032.
Gilmore, A.P., and Romer, L.H. (1996). Inhibition of focal adhesion kinase (FAK) signaling in focal adhesions decreases cell motility and proliferation. Mol. Biol. Cell 7, 1209–1224.[Abstract]
Hassell, J.R., Robey, P.G., Barrach, H.J., Wilczek, J., Rennard,
S.I., and Martin, G.R. (1980). Isolation of a heparan
sulfate-containing proteoglycan from basement membrane. Proc. Natl.
Acad. Sci. USA 77,
4494–4498.
Hedin, U., Bottger, B.A., Forsberg, E., Johansson, S., and Thyberg,
J. (1988). Diverse effects of fibronectin and laminin on
phenotypic modulation of cultured arterial smooth muscle cells. J. Cell
Biol. 107,
307–319.
Hedin, U., Roy, J., Tran, P.K., Lundmark, K., and Rahman, A. (1999). Control of smooth muscle cell proliferation: the role of the basement membrane. Thromb. Hemost. 82(S1), 23–26.
Heickendorff, L. (1989). The basement membrane of arterial smooth muscle cells. APMIS S9, 97:1–32.
Howe, A., Aplin, A.E., Alahari, S.K., and Juliano, R.L. (1998). Integrin signaling and cell growth control. Curr. Opin. Cell Biol. 10, 220–231.[CrossRef][Medline]
Iozzo, R.V., Cohen, I.R., Grassel, S., and Murdoch, A.D. (1994). The biology of perlecan: the multifaceted heparan sulfate proteoglycan of basement membranes and pericellular matrices. Biochem. J. 302, 625–639.
Jones, P.L., Crack, J., and Rabinovitch, M. (1997).
Regulation of tenascin-C, a vascular smooth muscle cell survival factor that
interacts with the alpha v beta 3 integrin to promote epidermal growth factor
receptor phosphorylation and growth. J. Cell. Biol.
139,
279–293.
Kleinman, H.K., McGarvey, M.L., Hassell, M.L., Jr., Star, V.L., Cannon, F.B., Laurie, G.W., and Martin, G.R. (1986). Basement membrane complexes with biological activity. Biochemistry 25, 312–318.[CrossRef][Medline]
Li, H., Leung, T.C., Hoffman, S., Balsamo, J., and Lilien, J.
(2000). Coordinate regulation of cadherin and integrin function
by the chondroitin sulfate proteoglycan neurocan. J. Cell.
Biol. 149,
1275–1288.
Li, X., Tsai, P., Weider, E.D., Kribben, A., VanPutten, V.,
Schrier, R.W., and Nemenoff, R.A. (1994). Vascular smooth muscle
cells grown on Matrigel: a model of the contractile phenotype with decreased
activation of mitogen-activated protein kinase. J. Biol. Chem.
269,
19653–19658.
Lindner, V., Majack, R.A., and Reidy, M.A. (1990). Basic fibroblast growth factor stimulates endothelial regrowth in denuded arteries in vivo. J. Clin. Invest. 85, 2004–2008.
Lundmark, K., Tran, P.K., Kinsella, M.G., Clowes, A.W., Wight, T.N., and Hedin, U. (2001). Perlecan inhibits smooth muscle cell adhesion to fibronectin: role of heparan sulfate. J. Cell. Physiol. 188, 67–74.[CrossRef][Medline]
Mercedes, C., Gustafsson, E., Aszodi, A., Morgelin, M., Bloch, W.,
Hunziker, E., Addicks, K., Timpl, R., and Fassler, R. (1999).
Perlecan maintains the integrity of cartilage and some basement membranes.
J. Cell. Biol. 147,
1109–1122.
Motamed, K., Funk, S.E., Koyama, H., Ross, R., Raines, E.W., and Sage, E.H. (2002). Inhibition of PDGF-stimulated and matrix-mediated proliferation of human vascular smooth muscle cells by SPARC is independent of changes in cell shape or cyclin-dependent kinase inhibitors. J. Cell. Biochem. 84, 759–771.[CrossRef][Medline]
Murdoch, A.D., Liu, B., Schwarting, R., Tuan, R.S., and Iozzo, R.V. (1994). Widespread expression of perlecan proteoglycan in basement membranes and extracellular matrices of human tissues as detected by a novel monoclonal antibody against domain III and by in situ hybridization. J. Histochem. Cytochem. 42, 239–249.[Abstract]
Nolan, K.J., Lacoste, J., and Parsons, J.T. (1999).
Regulated expression of focal adhesion kinase-related nonkinase, the
autonomously expressed c-terminal domain of focal adhesion kinase. Mol.
Cell. Biol. 19,
6120–6129.
Nordeen, S.K. (1988). Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6, 454–458.[Medline]
Nugent, M.A., Nugent, H.M., Iozzo, R.V., Sanchack, K., and Edelman,
E.R. (2000). Perlecan is required to inhibit thrombosis after
deep vascular injury and contributes to endothelial cell-mediated inhibition
of intimal hyperplasia. Proc. Natl. Acad. Sci. USA
97,
6722–6727.
Paka, L., Goldberg, I.J., Obunike, J.C., Choi, S., Saxena, U.,
Goldberg, I.D., and Pillarisetti, S. (1999). Perlecan mediates
the antiproliferative effect of apolipoprotein E on smooth muscle cells.
J. Biol. Chem. 274,
1–6.
Renshaw, M.W., Price, L.S., and Schwartz, M.A. (1999).
Focal adhesion kinase mediates the integrin signaling requirement for growth
factor activation of MAP kinase. J. Cell. Biol.
147,
611–618.
Richardson, A., and Parsons, J.T. (1996). A mechanism for regulation of the adhesion-associated protein tyrosine kinase pp125FAK. Nature 380, 538–540.[CrossRef][Medline]
Schaller, M.D., and Parsons, J.T. (1994). Focal adhesion kinase and associated proteins. Curr. Opin. Cell Biol. 6, 705–710.[CrossRef][Medline]
Sieg, D.J., Hauck, C.R., Ilic, D., Klingbeil, C.K., Schaefer, E., Damsky, C.H., and Schlaepfer, D.D. (2000). FAK integrates growth factor and integrin signals to promote cell migration. Nat. Cell Biol. 275, 14729–14735.
Tamura, M., Gu, J., Damen, E.H., Takino, T., Miyamoto, S., and
Yamada, K.M. (1999). PTEN interactions with focal adhesion kinase
and suppression of the extracellular matrix-dependent
phosphatidylinositol-3-kinase/Akt cell survival pathway. J. Biol.
Chem. 274,
20693–20703.
Taylor, J.M., Mack, C.P., Nolan, K., Regan, C.P., Owens, G.K., and
Parsons, J.T. (2001). Selective expression of an endogenous
inhibitor of FAK regulates proliferation and migration of vascular smooth
muscle cells. Mol. Cell. Biol.
21,
1565–1572.
Thyberg, J., and Hultgardh-Nilsson, A. (1994). Fibronectin and the basement membrane components laminin and collagen type IV influence the phenotypic properties of subcultured rat aortic smooth muscle cell differently. Cell Tissue Res. 276, 263–271.[Medline]
Weiser, M.C.M., Belknap, J.K., Grieshaber, S.S., Kinsella, M.G., and Majack, R.A. (1996). Developmental regulation of perlecan gene expression in aortic smooth muscle cells. Matrix Biol. 15, 331–340.[CrossRef][Medline]
Weiser, M.C.M., Majack, R.A., Tucker, A., and Orton, E.C. (1995). Static tension is associated with increased smooth muscle cell DNA synthesis in rat pulmonary arteries. Am. J. Physiol. 268, H1133–H1138.
Weiser, M.C.M., Schwartz, P.E., Grieshaber, N.A., and Majack, R.A. (1997). Perlecan regulates Oct-1 gene expression in vascular smooth muscle cells. Mol. Biol. Cell 8, 999–1011.[Abstract]
Weiser-Evans, M.C.M., Quinn, B.E., Burkard, M.R., and Stenmark, K.R. (2000). Transient reexpression of an embryonic autonomous growth phenotype by adult carotid artery SMC following vascular injury. J. Cell. Physiol. 182, 12–23.[CrossRef][Medline]
Weiser-Evans, M.C.M., and Stenmark, K.R. (1999). Perlecan heparan sulfates in the control of vascular smooth muscle cell proliferation. In: The Fetal and Neonatal Pulmonary Circulation, eds. E.K. Weir, S.L. Archer, and J.T. Reeves, Armonk, NY: Futura.
Whitelock, J.M. (2000). Purification of perlecan from endothelial cells. In Methods in Molecular Biology, Vol. 171, Proteoglycan Protocols, ed. R.V. Iozzo, Totowa, NJ: Humana Press.
Whitelock, J.M., Graham, L.D., Melrose, J., Murdoch, A.D., Iozzo, R.V., and Underwood, P.A. (1999). Human perlecan immunopurified from different endothelial cell sources has different adhesive properties for vascular cells. Matrix Biol. 18, 163–178.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  A. C. Newby Matrix metalloproteinases regulate migration, proliferation, and death of vascular smooth muscle cells by degrading matrix and non-matrix substrates Cardiovasc Res, February 15, 2006; 69(3): 614 - 624. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Hakuno, T. Takahashi, J. Lammerding, and R. T. Lee Focal Adhesion Kinase Signaling Regulates Cardiogenesis of Embryonic Stem Cells J. Biol. Chem., November 25, 2005; 280(47): 39534 - 39544. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Bix, J. Fu, E. M. Gonzalez, L. Macro, A. Barker, S. Campbell, M. M. Zutter, S. A. Santoro, J. K. Kim, M. Hook, et al. Endorepellin causes endothelial cell disassembly of actin cytoskeleton and focal adhesions through {alpha}2{beta}1 integrin J. Cell Biol., July 5, 2004; 166(1): 97 - 109. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wu, W. Sheng, L. Chen, H. Dong, V. Lee, F. Lu, C. S. Wong, W.-Y. Lu, and B. B. Yang Versican V1 Isoform Induces Neuronal Differentiation and Promotes Neurite Outgrowth Mol. Biol. Cell, May 1, 2004; 15(5): 2093 - 2104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Garl, J. M. Wenzlau, H. A. Walker, J. M. Whitelock, M. Costell, and M. C.M. Weiser-Evans Perlecan-Induced Suppression of Smooth Muscle Cell Proliferation Is Mediated Through Increased Activity of the Tumor Suppressor PTEN Circ. Res., February 6, 2004; 94(2): 175 - 183. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
