![]() |
|
|
Vol. 14, Issue 5, 1978-1992, May 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

||
¶

* Department of Dermatology, University Hospital, Geneva, Switzerland
CH-1211;
Departments of Pathology and Dermatology and the R.H. Lurie Cancer Center,
Northwestern University Feinberg School of Medicine, Chicago, IL 60611; and
Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam 1066 CX,
The Netherlands
Submitted August 30, 2002;
Revised December 11, 2002;
Accepted December 27, 2002
Monitoring Editor: Mary Beckerle
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The NH2-terminal domain of plakins determines their localization
at specialized sites of the membrane or their association with the
microfilament system. For instance, DP, with its unique
NH2-terminal sequence, is associated with adhesion complexes called
desmosomes (Stappenbeck et al.,
1993
; Kowalczyk et
al., 1997
; Smith and
Fuchs, 1998
), whereas the epithelial isoform of BP230 is a
specific constituent of junctional anchoring structures called hemidesmosomes
(Borradori and Sonnenberg,
1999
; Hopkinson and Jones,
2000
). Finally, PL, the most versatile cytolinker, is found in
desmosomes, hemidesmosomes, and focal contacts
(Steinbock and Wiche,
1999
).
Plakins bind to the IF cytoskeleton by their COOH terminus
(Ruhrberg and Watt, 1997
).
Specifically, transfection studies have demonstrated that the COOH-terminal
domain of BP230 is coaligned with keratin IFs
(Yang et al., 1996
;
Leung et al., 1999
).
In analogy, the DP tail is also codistributed with and can bind to various
keratins and vimentin in vitro
(Stappenbeck et al.,
1993
; Kouklis et al.,
1994
; Meng et al.,
1997
). The COOH terminus of PL has been shown to bind to keratins,
desmin, neurofilaments, glial fibrillary acidic protein, and vimentin in vitro
(Foisner et al.,
1988
; Wiche et al.,
1993
; Nikolic et al.,
1996
; Steinbock et
al., 2000
). Finally, gene-targeted elimination of BP230, DP,
or PL in mice has demonstrated the critical role of these proteins for the
integrity of the architecture of the cytoskeleton in stratified epithelia and
striated muscles (Guo et al.,
1995
; Andrä et
al., 1997
; Gallicano et al.,
1998
,
2001
).
IFs consist of filaments 10-nm thick found ubiquitously in multicellular
eukaryotes. All IFs have the intrinsic ability to self-assemble into
filaments. Keratins are the main group of IF proteins
(Fuchs and Weber, 1994
;
Parry and Steinert, 1999
). The
epithelial type I keratins form heterodimeric proteins with their type II
partners and together assemble into IFs. Cytokeratins are expressed
differentially in most epithelial cells, depending on development and
differentiation stages. K5/K14 is the major pair in stratified squamous
epithelia, whereas the K8/K18 pair is expressed in simple epithelia. Unlike
keratins, type III IF proteins, such as vimentin, are homopolymer-forming.
Nevertheless, they also appear to form heteropolymers with IF proteins of the
same or other classes, such as nestin
(Steinert et al.,
1999
). The ability to form such "mixed" IF networks
probably enables vimentin to exert additional cell typespecific
functions (Herrmann and Aebi,
2000
).
Thus far, attempts to identify the binding site(s) for IFs on DP, PL, and
BP230 have not delivered a unifying picture, despite the presence in their
COOH extremity of homologous domains comprising a series of 38-residue repeats
(Wiche et al., 1991
;
Green et al., 1992
).
These repetitive elements are organized into subdomains, denoted A, B, and C
in DP (Figure 1A). PL has five
B subdomains, whereas BP230 and DP have only one
(Green et al., 1992
).
Despite the complexity of the COOH extremity of PL, its binding to various IFs
appears to rely primarily on a small stretch of basic residues located in the
linker between the fifth B subdomain (B5) and the C subdomain of the protein
(Figure 1B)
(Nikolic et al.,
1996
). In contrast, the interaction of DP to IFs appears to be
complex. Although a region of DP encompassing the rod domain, the A and B
subdomains, and the downstream basic residues homologous to the B5 subdomain
of PL seemed to be sufficient for the coalignment of DP with vimentin, the C
subdomain was indispensable but not sufficient for its codistribution with
K5/K14 and K8/K18 IFs (Stappenbeck et
al., 1993
). Moreover, DP interacts with the head domain of
the single epidermal keratins K1 and K5 but only with heterodimeric K8/K18
independently of the head (Kouklis et
al., 1994
; Meng et
al., 1997
). Notably, recent crystallographic studies have
shown that the B and C subdomains of DP have globular structure and exhibit a
conserved basic groove, the features of which seem to be suitable for an
interaction with the rod of vimentin (Choi
et al., 2002
).
|
Finally, the ability of the BP230 tail to bind to vimentin and various IF
proteins in the nervous system, in which neuronal isoforms of BP230 are
expressed, is debated (Yang et
al., 1996
; Leung et
al., 1999
). New evidence has uncovered the existence of at
least four structurally distinct isoforms encoded by the BPAG1/dystonin gene,
BPAG1-e/BP230, BPAG1-n, BPAG1-a, and BPAG1-b, of which the latter harbors a
region similar to the A subdomain of DP, but it remains to be established
whether it can interact with IFs (Brown
et al., 1995
; Yang
et al., 1996
; Dowling
et al., 1997
; Leung
et al., 2001a
).
The identification of the sequences conferring binding specificities is the key for interpreting the interactions of IFs with the cell membrane and might increase our understanding of plakin- and IF-related human diseases. Hence, in this study, we investigated the ability of the tail of BP230 and DP to bind to the specific IF keratins K5/K14, K8/K18, and vimentin and characterized the sequences required and sufficient for their interaction with these IFs by using the yeast-three-hybrid system, cell transfection studies, and biochemical assays.
| MATERIALS AND METHODS |
|---|
|
|
|---|
4
subunit transgene cDNA (PA-JEB/
4 keratinocytes)
(Sterk et al., 2000
For transfection, cells were plated at 4060% confluence on glass
coverslips in six-well tissue culture plates. The PA-JEB/
4 keratinocytes
and PtK2 cells were transiently transfected with 1.5 and 4 µg,
respectively, of plasmid DNA using 2 µl of Lipofectamine 2000 (Invitrogen)
according to the manufacturer's procedure. COS-7 cells were transfected using
the DEAE-dextran method. Two days after transfection, cells were processed for
confocal microscopy as previously described
(Favre et al., 2001
)
and viewed under a Zeiss LSM410 confocal inverted laser scanning microscope
(Zeiss, Oberkochen, Germany). The following immunoreagents were used: rabbit
polyclonal antigreen fluorescent protein (GFP) (Santa Cruz
Biotechnology, Santa Cruz, CA), mouse monoclonal antibody (mAb) anti-K14
(Sigma, St. Louis, MO), mouse mAb anti-K8 Cam5.2 (Becton Dickinson, Mountain
View, CA), mouse mAb antivimentin (Immunotech, Marseille, France), Alexa-488
conjugated goat anti-rabbit IgG (Molecular Probes Inc., Eugene, OR), and Texas
Red-labeled sheep anti-mouse IgG (Amersham Biosciences, Arlington Heights,
IL).
Western Blot Analysis
The following antibodies were used: the rabbit polyclonal anti-GFP
(Santa-Cruz Biotechnology), an affinity-purified rabbit polyclonal NW 6
directed against the carboxyl-terminus of DP
(Angst et al., 1990
),
the human mAb 5E that recognizes the carboxyl-terminus of BP230
(Hashimoto et al.,
1993
), the mouse mAb and rabbit polyclonal antibody
antiGal4-AD or Gal4-BD (Santa Cruz), peroxidase-coupled
anti-rabbit IgG (Bio-Rad, Hercules, CA), or antihuman IgG (Jackson
ImmunoResearch, West Grove, PA).
Lysates of transfected COS-7 cells were prepared in SDS sample buffer and
heated for 5 min at 95°C. Protein extracts were analyzed by SDS-PAGE
followed by Western blotting as previously described
(Favre et al.,
2001
).
Immunoblot analysis of transfected cell extracts showed that the expression
levels of the various recombinant proteins of BP230 and DP were comparable.
The apparent molecular weight was uniformly lower than that predicted on the
basis of the cDNA as previously described
(Skaria et al., 2000
)
(not shown).
Yeast Two- and Three-Hybrid Assays
Generation of pACT2-URA The cDNA sequence encoding LEU2 in
the yeast vector pACT2 (Clontech, Palo Alto, CA) was replaced by a sequence
encoding the gene URA3 as described below. First, a pACT2 vector deleted of
its LEU2 sequence was generated by PCR with Pfu DNA polymerase (Promega,
Madison, WI) using a 5' primer that contained the ClaI
restriction site (italicized) and nucleotides corresponding to sequence
35723598 of pACT2 (GCTTAAATCGATTCTCTTTTTTTATGATATTTGTAC) and a
3' primer that also contained the ClaI restriction site and
nucleotides corresponding to sequence 24432466 of pACT2
(GCTAATCGATGACATTAGAATGGTATATCCTTGA). Second, the URA3 fragment was
generated by PCR using pGBDUC (James
et al., 1996
) as template, a 5' primer containing
the ClaI restriction site, and the initiation starting codon of the
URA3 sequence (TCGAATCGATAATGTCGAAAGCTACATATAAG), and a 3'
primer that contained the ClaI restriction site and the stop codon
(bold) of the URA3 sequence (CACTATCGATTTAGTTTTGCTGGCCGCATC).
These two fragments were digested with ClaI and ligated. The
resulting vector was sequenced and named pACT2-URA.
Yeast Strain, Transformation, and Interaction Analysis The
Saccharomyces cerevisiae strain PJ694A (a gift from Dr. P.
James, Department of Biomolecular Chemistry, University of Wisconsin, Madison,
WI), which contains the genetic markers trp1901, leu23112,
ura352, his3200, gal4
, gal80
, LYS2::GAL1-HIS3,
GAL2-ADE2, and met2::GAL7-lacZ (James
et al., 1996
), was used for all assays. It contains two
regulated and selectable reporter genes, HIS3 and ADE2, each driven by a
different promoter under the control of GAL4 transcriptional factor. Cells
were cotransformed with two or three defined constructs in pAS21, pACT2
(Clontech), or pACT2-URA according to the manufacturer's procedure. Double and
triple transformants were selected on agar synthetic complete (SC) medium
lacking leucine and tryptophan or leucine, tryptophan, and uracil,
respectively (SC-LW or SC-LWUra). For each transformation, eight colonies were
arrayed in 96-well microtiter plates and then transferred onto agar SC-LW(Ura)
(positive control), SC-LW(Ura) without adenine, and SC-LW(Ura) without
histidine and supplemented with 2 mM 3-amino 1,2,3-triazole. Growth was
determined after 5 d of incubation at 30°C. Transactivation controls were
systematically performed for each construct with the opposite vector without
insert.
To ascertain that the transformed yeast expressed the various recombinant
proteins, cell extracts were prepared by the trichloroacetic acid method
(Clontech Protocol Handbook) and subjected to immunoblotting (see above) with
antibodies directed to the GAL4-AD or GAL4-BD. The apparent molecular weight
of the various recombinant proteins was uniformly lower than that predicted on
the basis of the cDNA, whereas their expression levels was comparable
(Skaria et al., 2000
)
(not shown).
Immunoprecipitation and Dephosphorylation Assay
Yeast protein extracts prepared as described above were diluted 1/20 in
buffer A (50 mM Tris-HCl, pH 8, 150 mM NaCl, 0.5% vol/vol Triton X-100, 2 mM
EDTA) and used for immunoprecipitation using 150 µl of 10% wt/vol protein A
Sepharose 4B (Amersham) and 3 µg of rabbit anti-Gal 4 BD. Immobilized
immunocomplexes were then resuspended in calf intestine alkaline phosphatase
(CIAP) buffer (Promega) and dephosphorylated by 1 U of CIAP for 30 min at
30°C. Immunocomplexes were then washed twice with ice-cold buffer A and
solubilized in SDS sample buffer previously analyzed by SDS-PAGE and Western
blot.
cDNA Constructs
The various plakin deletion mutants were cloned into the yeast Gal4 DNA-BD
vector pAS21 (Clontech) and into the eukaryotic expression vector
pEGFP-C3 (Clontech) and pcDNA3-myc. IF proteins were cloned into the yeast
GAL4-AD vector pACT2 or pACT2-URA or the prokaryotic expression vector pET15b
(Novagen, Madison, WI). All cDNA constructs were generated using primers that
added appropriate start or stop codons along with restriction sites allowing
subcloning in a PCR reaction with proofreading Pfu polymerase (Promega). The
keratin constructs used were as follows: K8 consists of residues 1488,
K18 consists of residues 1430, K5 consists of residues 1590, K5
headless (HL) encompasses residues 169590, K5 tailless (TL) encompasses
residues 1477, K14 consists of residues 1472, K14 HL encompasses
residues 115472, K14 TL encompasses residues 1421. The chimeric
constructs generated were as follows: (1) BP(B)DP(L) consists of
residues 20772321 of BP230 in fusion with residues 24452627 of
DP followed by residues 24572462 of BP230; (2) BP(BC)DP(L)
encompasses residues 20772321 of BP230 fused to residues
24452627 of DP followed by residues 24572649 of BP230; and (3)
BP(BC)DP(Ct) consists of residues 20772649 of BP230 fused to
residues 28212871 of DP with or without the S2849G mutation. The
correctness of all constructs was verified by sequence analysis. The strategy
used for cloning in pET15b vector leads to the replacement of the serine at
position 2 by alanine in K8 and K18.
Expression of Keratins in Escherichia coli and
Purification
The E. coli strain BL21 (DE3) (F-, ompT, gal [dcm],
[lon], hsdSB, DE3
prophage [T7 RNA polymerase]) (Novagen)
was transformed with recombinant IF expression plasmids, and the colonies
obtained were used to inoculate Luria-Bertani medium containing 100 µg/ml
ampicillin. Overnight cultures were then diluted 1:20 in fresh medium, grown
to an OD600 nm of 0.7 at 30°C, and induced by the addition of
isopropyl
-D-thiogalactopyranoside for 16 h. Bacteria were
harvested by centrifugation at 4000 x g and frozen at
-20°C.
Purification of keratins from total extracts of bacteria was achieved in
two steps. First, a keratin-rich fraction was prepared as follows. Frozen
bacteria were lysed by sonification in low-salt buffer (50 mM Tris-HCl, pH
6.7, 10 mM EDTA, 50 mM NaCl, 1% vol/vol Triton X-100) until complete
disruption of the pellet. After centrifugation at 3000 x g for
20 min, the pellet was washed 5 times with the same buffer using cycles of
resuspension and centrifugation as above. The pellet was then washed three
times in high-salt buffer (50 mM Tris-HCl, pH 7.2, 2 mM EDTA, 1 M NaCl, 0.5 M
KCl, 0.5% vol/vol Triton X-100) as described above. The final pellet was
solubilized in urea buffer (50 mM Tris-HCl, pH 8, 8 M urea, 2 mM
-mercaptoethanol), and the proteins were extracted for 16 h at 4°C.
After an additional centrifugation at 12,000 x g, the
supernatant was collected and further purified using anion exchange
chromatography. Keratin fractions were passaged through a 1-ml mono Q column.
Keratins were eluted with a 50-ml gradient of 0200 mM guanidine-HCl.
Fractions (1 ml) were collected and analyzed by SDS-PAGE and Coomassie blue
staining. For K5 purification, the pH of the urea buffer and of the keratin
fraction was adjusted to 10 to ensure a strong binding of the protein to the
column. Peak fractions that contained keratins at 8090% purity were
pooled and dialyzed against urea buffer to remove guanidine-HCl. A second
round of anion exchange chromatography was performed as described above, and
peak fractions containing keratins at nearly 100% purity were pooled, dialyzed
against urea buffer, and concentrated to 2 mg/ml using Ultrafree
4Biomax 10 K filters (Millipore, Bedford, MA), then stored at
-20°C. Recombinant human K14 was kindly provided by Dr. H. Herrmann (DKFZ,
Heidelberg). Vimentin was from Progen (Heidelberg, Germany).
Metabolic Labeling of c-myctagged Proteins
[35S]methionine/cysteinelabeled recombinant forms of
BP230 and DP were generated by coupled in vitro transcription/translation of
pcDNA3-myc constructs using the Quick TNT coupled reticulocyte lysate system
(Promega). Nonincorporated amino acids were removed from the in vitro
translation mixture (50 µl) using Ultrafree 0.5Biomax 5 K
(Millipore) filters. The translation mixture was diluted into 4 ml of binding
buffer (20 mM HEPES, 10 mM PIPES, pH 7.2, 0.2 mM CaCl2, 2 mM
MgCl2, 50 mM KCl) supplemented with 0.1% (wt/vol) of
heat-inactivated BSA and 2 mM
-mercaptoethanol.
Overlay Assays
Purified IF proteins were polymerized into filaments by stepwise dialysis
as described previously (Coulombe and
Fuchs, 1990
). The quality of the filaments was verified by
electron microscopy after negative staining with uranyl acetate. The
polymerization mixture was spotted onto a nitrocellulose sheet using a
Dot-Blot apparatus (Bio-Rad). Immobilized monomers of keratins were obtained
by spotting purified polypeptides solubilized in urea buffer onto
nitrocellulose membranes. Membranes were subsequently washed three times in
binding buffer and incubated overnight at 4°C in blocking buffer (binding
buffer supplemented with 2% wt/vol of heat-inactivated BSA). Nitrocellulose
strips were then incubated overnight at 4°C with
[35S]methionine/cysteinelabeled proteins prepared as
described above. After five washes with binding buffer, nitrocellulose strips
were air-dried and bound proteins were visualized by autoradiography.
| RESULTS |
|---|
|
|
|---|
Selective Binding of BP230 with Dimeric Epidermal K5/K14 Requires
Both the COOH-Terminal B and C Subdomains
The complete tail of human BP230 (residues 18812649) was shown to be
codistributed with the epidermal K5/K14 IF network in transfected SCC-13
keratinocytes (Yang et al.,
1996
). To define the ability of human BP230 to associate with
keratins and vimentin, we first used the yeast three-hybrid system. Initially,
two large BP230 constructs, encompassing either the entire globular COOH tail
domain (residues 18812649) or a shortened version (residues
19462649), respectively, produced GAL4-AD fusion proteins, which caused
autotransactivation of reporter genes, precluding yeast three-hybrid analysis.
By contrast, a BP230 fragment encompassing the B and C subdomains, BP230-BC
residues 20772648 (Figure
1), did not cause autotransactivation and specifically interacted
with the K5/K14 heterodimer in yeast three-hybrid assays
(Figure 2). This interaction
appeared to be weak, because yeast growth was sustained only on plates lacking
histidine, not on plates lacking adenine. Indeed, it is known that in the
PJ694A strain, the ADE2 reporter gene requires more GAL4 activity than
the HIS3 reporter gene (Cagney et
al., 2000
).
|
Neither the single keratins K5, K14, K8, and K18 nor the heterodimeric keratin K8/K18 or vimentin, all fused to the GAL4-AD, bound to BP230-BC (Figure 2). To further map the sequences essential for binding to K5/K14, we tested a series of deletion mutants of BP230. A construct encompassing the B subdomain and the linker, BP230-BL, or the B subdomain, BP230-B, did not interact with any of the IF proteins tested (Figure 2). In contrast, the C subdomain, BP230-C, did bind to monomeric K5 and K14 but neither to K8 or K18 nor to dimeric K5/K14, K8/K18, or vimentin (see below). Finally, we deleted a motif situated at the extremity of BP230 2641GXXSXYXXS2649 (where X is not defined), which is also conserved in DP and PL (Figure 1B). Removal of these last eight residues of BP230 from previously active deletion mutants completely abrogated their binding to IF proteins, indicating that the COOH extremity of BP230 is crucial for binding (Figure 2).
The B and C Subdomains of the BP230 Tail Are Essential for Its
Selective Coalignment with K5/K14 IFs
To further investigate whether specific sequences of BP230 are responsible
for its association with various types of IFs, we generated expression vectors
encoding deletion mutants of the BP230 tail GFP-tagged at the
NH2-terminus. These hybrid proteins, like other members of the
plakin family, were found to be more stable and easier to analyze than
c-myctagged deletion mutants (not shown)
(Smith and Fuchs, 1998
). To
determine whether deletion mutants of BP230 coaligned with different IF
networks, we transiently transfected the above constructs into various cell
lines, including PA-JEB/
4 keratinocytes, which contain a K5/K14 keratin
network, PtK2 cells containing K8/K18 IFs, and COS-7 cells for vimentin
IFs.
Immunofluorescence microscopy studies of transfected PA-JEB/
4
keratinocytes demonstrated that BP23018812649, encompassing
the entire tail, decorated the epidermal K5/K14 IF network (not shown, and
Figure 3). In up to 10% of the
transfected keratinocytes, the epidermal keratin network had partially
collapsed. In contrast, when expressed in PtK2 cells, the BP230 tail was not
codistributed with the K8/K18 network but rather remained diffusely
distributed in the cytoplasm. The same distribution pattern was observed in
transfected COS-7 cells, in which no obvious colocalization with vimentin was
seen (not shown, and Figure 3).
The deletion mutant BP230-BC also coaligned with and, rarely, disrupted the
K5/K14 networks of transfected PA-JEB/
4 cells (Figures
3 and
4). BP230-BC was not
codistributed with either K8/K18 or vimentin IFs but rather was found
primarily diffusely distributed in the cytoplasm of PtK2 and COS-7 cells,
respectively (not shown, and Figure
3). The deletion of the ultimate eight residues from the COOH
terminus of BP230-BC abrogated the coalignment of the recombinant
BP230-BC
8 with K5/K14 in transfected PA-JEB/
4 cells (Figures
3 and
4). Finally, in all transfected
cell lines, BP230-C was present in small cytoplasmic aggregates, which were
not coaligned with and did not disrupt the K5/K14, K8/K18, and vimentin IF
networks (Figure 3). When
expressed by itself in the various cell lines tested, GFP was found either
diffusely distributed over the cytoplasm or in the nucleus without obvious
staining of the IF network (not shown).
|
|
Consistent with the results in yeast, the transfection studies indicate that (1) the BP230 tail contains sequences conferring binding specificity for the epidermal K5 and K14 keratins and (2) a region of BP230 encompassing the B and C subdomains, including the intervening linker region, as well as the COOH-terminal extremity is essential for its interaction with K5/K14 filaments. Finally, (3) the observation that BP230-C is unable to become colocalized with the K5/K14 IF network correlates with its failure to interact with dimeric K5/K14 in yeast, suggesting that its binding activity with monomeric K5 and K14 is artificial, most likely as a result of the exposure of cryptic binding sites by the N-terminal truncation.
The Interaction of the DP Tail with IFs Depends on the
Heterodimerization of Type I and Type II Keratins in Yeast and Is Regulated by
Ser 2849
Because previous studies have demonstrated that the DP tail associates with
epidermal and nonepidermal keratins
(Stappenbeck et al.,
1993
; Kouklis et al.,
1994
; Meng et al.,
1997
), we investigated the ability of two DP constructs containing
its entire tail or the B and C regions, DP-AC and DP-BC, respectively, to bind
to monomeric or dimeric keratins K5, K14, K8, K18, or vimentin in yeast.
Surprisingly, there was no binding with any of the keratins tested, and only
DP-BC bound weakly to vimentin (Figure
5). It has been observed that only DP mutants carrying the amino
acid substitution S2849G were coaligned with keratin IF networks in certain
cell lines and showed increased binding activity with vimentin and K8/K18 in
yeast (Stappenbeck et al.,
1994
; Meng et al.,
1997
). Therefore, we next assessed the effect of a mutated DP
construct in which Ser 2849 was substituted by Gly (S2849G), thereby
disrupting a potential protein kinase A consensus phosphorylation site. As
shown in Figure 5,
DP-ACS2849G and DP-BCS2849G bound to dimeric K5/K14,
K8/K18, and vimentin in yeast, whereas there was no interaction with monomeric
K5, K14, K8, or K18.
|
Because Western blot analysis of yeast protein extracts showed that the
electrophoretic mobility of DP-C was lower than that of DP-CS2849G,
we tested the possibility that phosphorylation of Ser 2849 in the DP tail was
responsible for this mobility change. Therefore, the DP-C and
DP-CS2849G recombinant proteins were immunoprecipitated from yeast
extracts, subjected to dephosphorylation by calf intestine alkaline
phosphatase (CIAP), and immunoblotted. As shown in
Figure 6, phosphatase treatment
results in a shift in the electrophoretic mobility of DP-C, making it
indistinguishable from that of DP-CS2849G. Consistent with previous
reports that Ser 2849 is phosphorylated in mammalian cells
(Stappenbeck et al.,
1994
), these findings suggest that Ser 2849 is phosphorylated in
yeast as well. In this context, we tested the possibility that phosphorylation
of Ser 2849 modulates the folding of DP tail by regulating intramolecular
interactions within this region. However, no evidence was found for a direct
association between the extremity of the COOH terminus and the B and C
subdomains or between the C and B subdomains in yeast (not shown).
|
These results (1) imply that the presence of either K5/K14 or K8/K18 in the form of a heterodimer made an interaction of DP with these keratins possible and (2) suggest that phosphorylation of Ser 2849 in yeast negatively affects the ability of DP to interact with keratins. Nevertheless, the binding activity of the DP constructs, in which this Ser residue was replaced by Asp to try mimicking phosphorylated Ser (DP-ACS2849D and DP-BCS2849D), was unaffected (not shown).
Identification of Sequences within the DP Tail Interacting
Specifically with Various IF Proteins
Next, we assessed the requirement of specific sequences within the DP tail
important for its binding to various types of IFs using yeast three-hybrid
analysis. A construct encompassing the C subdomain and the COOH terminus of DP
with the S2849G substitution, DP-CS2849G, was able to bind to
K5/K14 and K8/K18 but no longer interacted with vimentin
(Figure 5). Deletion of an
additional stretch of 51 residues, comprising the GSRS/T repeats
(DP-C
51), abolished the interaction with K5/K14 and K8/K18. In
contrast, deletion of the same 51 residues from the construct DP-BC
(DP-BC
51) did not prevent binding to any of the dimeric IF proteins,
including keratins. However, the interaction appeared to be weaker than that
of DP-BC, as inferred from the delayed growth of yeast cells on medium without
adenine. This finding suggested that the COOH-terminal extremity of DP
contains residues that contribute to IF binding
(Figure 5). Consistent with
this idea, we found that a recombinant protein encompassing the last 79
residues of DP, DP-CtS2849G, showed some binding activity with both
K5/K14 and K8/K18.
In contrast, a construct encompassing the B subdomain and a large portion
of the linker, DP-BL, did not interact with K5 and K14 either as single or
heterodimeric proteins but did interact with K8 and heterodimeric K8/K18 and
vimentin. To better define which portion of DP-BL is implicated in binding, we
tested a construct containing either the linker region of DP, DP-L, or the B
subdomain, DP-B. DP-L was sufficient to mediate binding to K8, K8/K18, and
vimentin but not to K18 or to K5 and K14 as either single or heterodimeric
proteins. By contrast, DP-B was unable to interact with any of the IF proteins
tested. These results indicate that (1) a region of DP encompassing the C
subdomain is essential but not sufficient for binding to the epidermal K5/K14
keratin pairs, because sequences contained within either the B and the linker
region or the 51 COOH-terminal have an impact on the ability of the C
subdomain to interact with K5/K14 (see DP-BC
51 and DP-C
51); (2)
the linker region of DP contains recognition sites for simple epithelial
keratins and vimentin; and (3) the COOH extremity displays binding activity
with both simple and epidermal keratins.
Distinct Regions within the DP Tail Are Required for Its Coalignment
with Various IF Networks
We next performed transfection studies using expression vectors encoding
fusion proteins encompassing portions of the DP tail linked to GFP at the
NH2-terminus. To ensure the best codistribution potential of these
hybrid proteins with various IF networks
(Stappenbeck et al.,
1994
), we used DP mutants in which Ser 2849 was replaced by Gly.
We first tested the behavior in transfected cells of two deletion mutants,
which encompassed the entire tail of DP or the tail domain without the A
subdomain, DP-ACS2849G and DP-BCS2849G, respectively.
When expressed in PA-JEB/
4 keratinocytes, PtK2 cells, and COS-7 cells,
these DP mutants were able to decorate epidermal K5/K14 and simple K8/K18
keratins and vimentin IF networks, respectively (Figures
3 and
7, AC). In addition,
partial disruption and collapse of these networks was observed occasionally,
particularly in cells with high DP fusion protein expression levels (not
shown). Additional deletion of 51-amino-acid residues from the COOH-terminal,
DP-BC
51, had no effect on the codistribution of DP with IFs
(Figure 3). The deletion mutant
DP-CS2849G coaligned with epidermal and simple keratin IF networks,
although occasionally, it was also distributed in the cytoplasm in cells with
high levels of expression (Figures
3,
7, and
8, DF). This DP mutant
protein did not decorate the vimentin network in transfected COS-7 cells but
remained diffusely distributed over the cytoplasm
(Figure 3). Notably, the mutant
DP-C
51 did not become codistributed with any of the IF networks but
instead was diffusely distributed over the cytoplasm (Figures
3,
7, and
8, GI). In contrast, a
DP mutant containing the B subdomain and the linker, DP-BL, became colocalized
with both the simple keratin and vimentin networks (Figures
3 and
8, AC) but not with
epidermal keratins (Figure 3).
Finally, a DP-L recombinant protein encompassing the linker alone also
exhibited this codistribution potential but was more frequently diffusely
distributed in the cytoplasm than the recombinant protein DP-BL and even more
than DP-BC, which contain one and two modules, respectively
(Figure 3). In agreement with
the results in yeast and in extension to results of previous studies, our
findings clearly indicate that (1) a region encompassing the C subdomain and
the COOH extremity contains sequences sufficient for the interaction of DP
with epidermal and simple keratin filaments; (2) the presence of the B
subdomain and the linker region or the COOH-terminal stretch of 51 residues
has an important impact on the potential of the C subdomain and COOH-terminal
region to become coaligned with keratin networks; and (3) sequences within the
linker region confer additional binding activity for the vimentin IF network
and are thus essential for such an interaction.
|
|
The DP Tail Preferentially Associates with Polymeric IF Proteins in
In Vitro Binding Assays
Because our data suggest that binding of DP and BP230 to epidermal and
simple cytokeratins requires that the keratins are in the form of
heterodimers, we tested the ability of DP and BP230 tails to associate with
monomeric and polymeric IF proteins in in vitro binding assays. K5, K14, K8,
and K18 monomers and keratin and vimentin filaments were immobilized on
nitrocellulose membranes and overlaid with recombinant DP and BP230 proteins
that were in vitro transcribed and translated and used as fluid-phase ligands.
In agreement with our yeast two-hybrid results, the recombinant
DP-BCS2849G interacted strongly with filaments of K5/K14, K8/K18,
and vimentin but not with K5, K8, and K18 monomers
(Figure 9), whereas weak
associations with K14 were observed. Identical results were found using the
recombinant protein DP-BC without the Ser substitution, most likely because
the in vitro translated product was not phosphorylated (not shown).
Furthermore, the recombinant protein DP-C bound to both K5/K14 and K8/K18,
although less efficiently than DP-BCS2849G. Finally, deletion of
the last 51 residues from the tail of DP-C, DP-C
51, abrogated these
interactions. These results provide strong support for the contention that DP
associates preferentially with heterodimers of keratin. Attempts to
demonstrate an association of the BP230 tail with keratin filaments in overlay
binding assays failed (not shown). It is possible that the interaction of
BP230 with keratin filaments is too weak to be detected in our in vitro
binding assay. Alternatively, the in vitro translated recombinant form of
BP230 used may fold incorrectly or lack posttranslational modifications
essential for binding to IFs. Such modifications were recently shown to be
critical for the association of PL with IF proteins
(Janda et al.,
2001
)
|
Evidence That Sequences within the DP Tail Confer Binding
Specificities to Distinct IF Proteins
The assumption that distinct subdomains of the plakin tails are responsible
for their selective binding to IF proteins was tested further in yeast by
generation of chimeric constructs in which distinct regions of BP230 were
swapped with the equivalent sequences in DP
(Figure 10). A chimeric
construct consisting of the B subdomain of BP230 fused at its carboxyl
extremity with the linker of DP, BP(B)DP(L), had binding activities
similar to those of the linker of DP
(Figure 10). Complementary to
this, we swapped the linker region of BP230 with the corresponding region of
DP in BP230-BC to obtain BP(BC)DP(L). Despite this swapping, this
latter construct was unable to interact with any of the IF proteins tested
(Figure 10). Finally, a
chimeric protein consisting of BP230-BC fused at its COOH extremity with the
last 51 residues of DP, BP(BC)DP(Ct) with or without the S2849G
substitution, was able to bind to K5/K14. Most importantly, the chimeric
construct carrying the S2849G acquired the ability to interact with K8/K18 and
weakly with vimentin. Overall, these observations reveal that the linker
region and/or the COOH extremity of DP contain sequences critical for the
association with K8/K18 and vimentin. Proper folding and exposure of the
recognition sites within the linker appear to be affected by the context of
the flanking sequences such as the B and/or C subdomains, as inferred from the
behavior of BP(BC)DP(L).
|
The Head and Tail Domains of K5 and K14 Are Not Needed for Their
Interaction with BP230 and DP
Finally, because previous studies have provided strong evidence that the
head domain of K1 and K5 contains sequences that mediate binding to DP
(Kouklis et al.,
1994
; Meng et al.,
1997
), we studied the effect of the truncation of the head or the
tail domain of K5 (K5
H and K5
T, respectively) and of K14
(K14
H and K14
T, respectively) on the binding of DP and BP230 to
IF proteins. In yeast two-hybrid assays, we first verified that the deletion
of the head or tail domains did not impair the ability of K5 and K14 to
associate with each other (data not shown). In accordance with previous
studies using other combinations of keratin pairs
(Schnabel et al.,
1998
), we found that the head or tail domains of K5 and K14 are
unnecessary for dimerization. We then tested the binding activity of
DP-BCS2849G, DP-CS2849G, and BP230-BC with various
combinations of K5 and K14 with or without their head and tail domains
(Figure 11). The results of
all experiments were positive. In contrast, DP-C
51 did not bind to the
various keratin pair combinations (not shown). These findings strongly suggest
that the keratin rod domain is sufficient for binding.
|
| DISCUSSION |
|---|
|
|
|---|
Identification of Distinct Sequences within the COOH-Terminal Regions
of BP230 and DP Required for Their Association with IFs
Our results demonstrate that a region encompassing the B and C subdomains
of BP230 contains the minimal sequences required for its specific interaction
with the epidermal K5/K14 keratins (Figure
12). It does not bind to the simple epithelial keratins or, in
line with a recent study (Leung et
al., 1999
), vimentin. These findings further support the role
of BP230 in tethering the keratin network in basal keratinocytes, in which
BP230 and the keratin pair K5/K14 are coexpressed
(Arnemann et al.,
1993
; Guo et al.,
1995
; Fuchs and Cleveland,
1998
).
|
Our data demonstrate that DP has a broader binding capacity than BP230,
because it interacts with dimeric K5/K14, K8/K18, and vimentin, as well as
with desmin (Meng et al.,
1997
). This versatility is most likely a prerequisite for the
association of DP with distinct IF networks in several cell types, including
meningeal cells, dendritic reticulum cells, and cardiac muscle cells, in which
DP is thought to link nonkeratin IFs to desmosomes (Kartenbeck et
al., 1983
,
1984
;
Meng et al., 1997
).
Different regions within the DP tail are important for its interaction with
vimentin or keratins (Figure
12). The linker region is a specific binding domain for vimentin
and simple epithelial keratins but not for epidermal keratins. Furthermore,
the C subdomain and the COOH extremity are implicated in its interaction with
keratins (see Figures 3 and
5). The association of the C
subdomain with simple epithelial and epidermal keratin filaments depends on
the presence of a stretch of 51 amino acids at the COOH extremity of DP,
because its deletion abrogated binding. However, additional sequences
contributing to binding are also contained in a region encompassing the B
subdomain and the linker, as evidenced by the fact that construct
DP-BC
51 but not DP-C
51 interacts with K5/K14 keratins. Our
findings pose a disparity with the reported inability of the C subdomain and
the COOH extremity of DP to become coaligned with the keratin network
(Stappenbeck et al.,
1993
). A possible explanation is that, whereas our construct was
GFP-tagged at its NH2-terminus, the DP mutant previously used had a
c-myc tag at its COOH extremity, which might interfere with its function.
Importance of the Head and Tail Domains of Cytokeratins and of Their
Heterodimerization on Their Interaction Potential with BP230 and DP
As judged by the consistent findings obtained in yeast three-hybrid assays
with keratin pairs and the cell transfection studies, both DP and BP230
preferentially interact with K5/K14 and K8/K18 heterodimers. This contention
is also supported by the overlay binding assays, which confirmed a significant
association of DP with keratin filaments but not with monomeric keratins.
These observations suggest that in our yeast assays, the binding activity of
certain plakin deletion mutants with monomeric keratins (see BP230-C), which
was not observed with larger constructs, is artifactual and results from the
exposure of cryptic binding sites by the truncation procedure (see
BP230-C).
Our results seem to be at variance with two previous studies, which
indicated that DP is able to interact with various monomeric type II keratins,
including K5 and K1, as demonstrated by solution binding assays or yeast
two-hybrid analysis (Kouklis et
al., 1994
; Meng et
al., 1997
).
Nevertheless, in line with our findings, Meng et al.
(1997
) showed in yeast
two-hybrid assays that the association of DP with K8/K18, in contrast to that
with the epidermal keratin K1, required the presence of both keratin partners.
Together, the latter observation and our data strongly suggest that the
association of DP and BP230 with epidermal and simple keratins is favored by
the tertiary structure associated with the keratin
-helical coiled-coil
and heterodimers. In this context, it is of interest to note that Kouklis
et al. (1994
)
reported that a region encompassing the KSIS motif within the head domain of
K1 and K5 was crucial for the interaction of DP with epidermal keratins,
whereas Meng et al.
(1997
) found that the head
domain of K1 contributed to the interaction of K1 with DP in yeast and peptide
competition assays. Although our findings do not exclude a role of the head
domain for binding to DP and BP230, they strongly suggest that there are
additional, critical interaction sites in the keratin
-helical
coiled-coil of K5 and K14, because deletion of their head or tail domains does
not abrogate their binding with either DP or BP230 in yeast. It is likely that
the association of DP with K8/K18 involves similar IF domains. In fact, Meng
et al. (1997
) showed
that the association of DP with K8/K18 heterodimer was not dependent on the
head domain of K8 and K18. However, additional experiments are needed to
clarify whether the mechanisms by which simple epithelial and epidermal
keratins bind to plakins are comparable.
Potential Role of the Phosphorylation of the DP and BP230 Tail for
Binding with IFs
Previous studies have shown that only DP mutants carrying the amino acid
substitution S2849G were coaligned with keratin IF networks in certain cell
lines and showed increased binding activity with vimentin and K8/K18 in yeast
(Stappenbeck et al.,
1994
; Meng et al.,
1997
). These observations suggested that phosphorylation of Ser
2849 in the DP COOH terminus critically affects its association with IF
proteins. In line with this idea, we found here that none of the DP
GAL4-fusion proteins containing the wild-type COOH-terminal tail were able to
interact with epidermal and simple keratins or vimentin in yeast three-hybrid
assays. However, whereas the replacement of Ser 2849 by Asp to mimic
phosphorylation did not inhibit the interaction of the DP tail with IF
proteins, substitution of Ser 2849 by Gly resulted in significant binding
activity in yeast. Our findings obtained with alkaline
phosphatasetreated yeast extracts provide indirect evidence that Ser
2849 is phosphorylated in yeast, probably by a cAMP-dependent protein kinase,
an enzyme that is highly conserved in all eukaryote cells
(Taylor et al.,
1990
).
It is possible that the potential to phosphorylate Ser 2849 in yeast varies
among the strains used. This would provide a plausible explanation for the
observation that Meng et al.
(1997
), using the PCY2 strain,
found, in apparent contrast to our results, a weak interaction between DP-AC
and K8/K18. An alternative and more likely explanation is that the LacZ
reporter gene of the PCY2 strain is more sensitive than the HIS3 and ADE2
reporter genes of the PJ69 strain used in this study and also allowed
detection of less robust interactions.
Regulation of the IF-binding properties of BP230 by its phosphorylation has not been reported as yet. However, our finding that the deletion of the last stretch of eight amino acids from the BP230 tail containing Tyr and Ser residues that can be phosphorylated had a dramatic effect on its interaction with K5/K14 raises the possibility that posttranslational modifications of the COOH extremity of BP230 regulate its function.
Elucidating the Function of the Linker Region of Plakins for IF
Binding
Previous in vitro binding studies
(Nikolic et al.,
1996
; Steinbock et
al., 2000
) have demonstrated that the IF-binding activity of
PL with vimentin and cytokeratins depends on an
50-amino-acid stretch
within its linker. The latter is highly conserved in DP and PL (70% identity)
but not in BP230 (35% identity) (Figure
1A) (Nikolic et al.,
1996
; Steinbock et
al., 2000
). The four basic residues that were shown to be
crucial for the association of PL with vimentin are present in DP but not in
BP230. Hence, we argued that the linker of DP contains sequences sufficient
for IF binding. In line with this idea, we found that the linker of DP binds
to K8/K18 keratins and vimentin in yeast and is colocalized with these IF
networks when expressed in transfected cells. However, it remains unclear
whether the binding sites for K8/K18 and vimentin overlap or are located on
distinct sequences within the linker.
The fact that the linker region of BP230 is different from that in DP and PL can explain the inability of BP230 to associate with either vimentin or K8/K18. BP230 lacks not only the crucial short stretch of basic residues but also a series of Ser residues between the B and C repeats (Figure 1A). Notably, the swapping of the linker of BP230 with that of DP in the construct BP(BC)DP(L) abolished the ability of the BP230 tail to associate with K5/K14. This result suggests that the proper folding and alignment of the linker region and/or of the B and C subdomains are essential for binding to IF proteins.
Finally, the idea that the linker region contains sequences critical for
the codistribution of plakins with distinct IF proteins is further supported
by recent studies of periplakin. The coalignment with IFs of this protein and
its binding ability to simple keratins and vimentin in yeast appeared to
depend on sequences within the linker at its COOH extremity
(DiColandrea et al.,
2000
; Karashima and Watt,
2002
; Kazerounian et
al., 2002
).
An Increased Importance of the COOH Extremity of Plakins
The importance of the COOH extremity of DP is supported by the observation
that patients with mutations in the DP gene leading to a deletion of the C
subdomain have abnormalities of the heart and the skin with a disorganized
cytokeratin network (Norgett et
al., 2000
). Furthermore, it has been shown that a stretch
encompassing residues 4868 from the extremity of the carboxyl-terminus
of DP was necessary for the coalignment of the DP tail with the keratin
network (Stappenbeck et al.,
1993
). As an extension of these findings, we demonstrate here that
the COOH extremity of DP is critical for its association with both K5/K14 and
K8/K18, because its deletion, as in DP-C
51, abrogates all binding
activities in yeast and biochemical assays. This stretch of residues may
contribute to the proper folding of the recognition sites for IFs and/or
participate directly in the binding to IFs, as inferred from the ability of
the last 79 amino acid residues of DP to weakly bind to keratins in yeast.
The COOH-terminal extremity of DP seems to contribute not only to keratin
but also to vimentin binding, a role hitherto unappreciated. In fact, the
presence of the terminal 51-amino-acid stretch of the COOH extremity of DP
confers upon the BP230 tail the ability to bind to simple epithelial keratins
and vimentin [see chimeric protein BP(BC)DP(Ct) in
Figure 10]. An alternative
explanation for this finding is that the BP230 tail has the potential to
interact, as previously suggested (Yang
et al., 1996
), to vimentin. The presence of the terminal
51-amino-acid stretch of the DP may contribute to increase or stabilize this
interaction. However, the function of this portion of DP appears to be
regulated by phosphorylation, because no interaction with either vimentin or
K8/K18 was observed when a similar chimeric construct without the S2849G
substitution was used (see Figure
10), whereas binding to K5/K14 remained largely unaffected.
Finally, it should be noted that the region of residues 5168 from
the carboxyl extremity of DP contains a motif, GXXSXYXXS (where X is not
defined), that is conserved in DP, BP230, and PL. Removal of this motif from
the BP230 tail as in construct BP230-BC
8 abrogated its binding to
K5/K14, an observation underlining a key role of this sequence for keratin
binding (see Figures 2 and
3).
Contribution of the B and C Subdomains to IF Binding
On the basis of their sequence homology, the B and C subdomains in DP, PL,
and BP230 have been thought to represent the major IF binding modules, the
available number of which determines the binding affinity for IFs
(Stappenbeck et al.,
1993
). However, using different approaches, we found here no
compelling evidence for this model for either DP or BP230. Nevertheless, these
subdomains most likely contribute to IF binding, as inferred from the reduced
ability of DP-L compared with that of DP-BL and DP-BC to become codistributed
with the IF network in transfected cells. These results suggest that the
single B and C subdomains of DP contain recognition sites for IFs, but their
affinity is too low to detect interactions in transfection studies and yeast
assays. Notably, crystallographic studies have shown that the B and C
subdomains are globular and exhibit a conserved basic groove that may serve as
recognition site for the rod domain of vimentin
(Choi et al., 2002
).
Alternatively, it is possible, as previously proposed for PL
(Steinbock et al.,
2000
), that these subdomains are involved in the proper exposure
and folding of linker sequences containing the actual IF binding sites. In
line with this idea, in vitro binding assays have demonstrated that a
recombinant protein of DP encompassing both the B and C subdomains showed
better binding to vimentin than the isolated B or C subdomain, the interaction
potential of which was very weak and occurred only when a large molar excess
of DP recombinant proteins was used (Choi
et al., 2002
).
Together, on the basis of our and previous studies, the following model is proposed (see Figure 12). Sequences between the highly homologous B and C subdomains and within the COOH extremity of DP and BP230 have a critical impact on their function: the linker and the COOH extremity of plakins contain recognition sites crucial for IF binding and confer specificity for various IF proteins. In this context, the B and C subdomain contribute to efficient binding by either providing additional interaction sites or ensuring the proper conformation and folding of the linker and COOH extremity. Furthermore, the latter region is subject to phosphorylation events that profoundly affect the ability of plakins to interact with various and distinct IF networks. Finally, although epidermal and simple keratins may associate with DP or BP230 via different binding sites located on either their rod or globular end-domains, in both cases the association is favored by the tertiary structure induced by heterodimerization.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Abbreviations used: mAb, monoclonal antibody; AD, transcription-activation domain; BD, DNA-binding domain; BP230, bullous pemphigoid antigen 1; DP, desmoplakin; EGFP, enhanced green fluorescent protein; GFP, green fluorescent protein; IF, intermediate filament; PL, plectin
These three authors contributed equally to this work. ![]()
|| Present address: Novartis Forschungsinstitut, IDTA, Vienna, Austria ![]()
¶ Present address: Department of Human Genetics, Academic Medical Center,
Amsterdam, The Netherlands. ![]()
# Corresponding author. E-mail address: luca.borradori{at}hcuge.ch.
| REFERENCES |
|---|
|
|
|---|
Angst, B.D., Nilles, L.A., and Green, K.J. (1990).
Desmoplakin II expression is not restricted to stratified epithelia. J.
Cell Sci. 97,
247257.
Arnemann, J., Sullivan, K.H., Magee, A.I., King, I.A., and Buxton, R.S. (1993). Stratification-related expression of isoforms of the desmosomal cadherins in human epidermis. J. Cell Sci. 104, 741750.[Abstract]
Borradori, L., and Sonnenberg, A. (1999). Structure and function of hemidesmosomes: more than simple adhesion complexes. J. Invest. Dermatol. 112, 411418.[CrossRef][Medline]
Brown, A., Bernier, G., Mathieu, M., Rossant, J., and Kothary, R. (1995). The mouse dystonia musculorum gene is a neural isoform of bullous pemphigoid antigen 1. Nat. Genet. 10, 301306.[CrossRef][Medline]
Cagney, G., Uetz, P., and Field, S. (2000). High-throughput screening for protein-protein interaction using the two-hybrid assay. Methods Enzymol. 328, 314.[CrossRef][Medline]
Choi, H.J., Park-Snyder, S., Pascoe, L.T., Green, K.J., and Weis, W.I. (2002). Structure of two intermediate filaments-binding fragments of desmoplakin reveal a unique repeat motif structure. Nat. Struct. Biol. 9, 612620.[Medline]
Coulombe, P.A., and Fuchs, E. (1990). Elucidating the
early stages of keratin filament assembly. J. Cell Biol.
111,
153169.
DiColandrea, T., Karashima, T., Määttä, A., and
Watt, F.M. (2000). Subcellular distribution of envoplakin and
periplakin: insights into their role as precursors of the epidermal cornified
envelope. J. Cell Biol. 151,
573586.
Dowling, J., Yang, Y., Wollmann, R., Reichardt, L.F., and Fuchs, E. (1997). Developmental expression of BPAG1-n: insights into the spastic ataxia and gross neurologic degeneration in dystonia musculorum mice. Dev. Biol. 187, 131142.[CrossRef][Medline]
Favre, B., Fontao, L., Koster, J., Shafaatian, R., Jaunin, F.,
Saurat, J.H., Sonnenberg, A., and Borradori, L. (2001). The
hemidesmosomal proteins bullous pemphigoid antigen 1 and the integrin
4
subunit bind to ERBIN. J. Biol. Chem.
276,
3242732436.
Foisner, R., Leichtfried, F.E., Herrmann, H., Small, J.V., Lawson,
D., and Wiche, G. (1988). Cytoskeleton-associated plectin: in
situ localization, in vitro reconstitution, and binding to immobilized
intermediate filament proteins. J. Cell Biol.
106,
723733.
Fuchs, E. (1994). Intermediate filaments and disease:
mutations that cripple cell strength. J. Cell Biol.
125,
511516.
Fuchs, E., and Cleveland, D.W. (1998). A structural
scaffolding of intermediate filaments in health and disease.
Science. 279,
514519.
Fuchs, E., and Weber, K. (1994). Intermediate filaments: structure, dynamics, function, and disease. Annu. Rev. Biochem. 63, 345382.[Medline]
Fuchs, E., and Yang, Y. (1999). Crossroads on cytoskeletal highways. Cell. 98, 547550.[CrossRef][Medline]
Gallicano, G.I., Bauer, C., and Fuchs, E. (2001). Rescuing desmoplakin function in extra-embryonic ectoderm reveals the importance of this protein in embryonic heart, neuroepithelium, skin and vasculature. Development 128, 929941.[Abstract]
Gallicano, G.I., Kouklis, P., Bauer, C., Yin, M., Vasioukhin, V.,
Degenstein, L., and Fuchs, E. (1998). Desmoplakin is required
early in development for assembly of desmosomes and cytoskeletal linkage.
J. Cell Biol. 143,
20092022.
Green, K.J., Virata, M.L., Elgart, G.W., Stanley, J.R., and Parry, D.A. (1992). Comparative structural analysis of desmoplakin, bullous pemphigoid antigen and plectin: members of a new gene family involved in organization of intermediate filaments. Int. J. Biol. Macromol. 14, 145153.[CrossRef][Medline]
Guo, L., Degenstein, L., Dowling, J., Yu, Q.C., Wollmann, R., Perman, B., and Fuchs, E. (1995). Gene targeting of BPAG1: abnormalities in mechanical strength and cell migration in stratified epithelia and neurologic degeneration. Cell. 81, 233243.[CrossRef][Medline]
Hashimoto, T., Amagai, M., Ebihara, T., Gamou, S., Shimizu, N., Tsubata, T., Hasegawa, A., Miki, K., and Nishikawa, T. (1993). Further analyses of epitopes for human monoclonal anti-basement membrane zone antibodies produced by stable human hybridoma cell lines constructed with Epstein-Barr virus transformants. J. Invest. Dermatol. 100, 310315.[CrossRef][Medline]
Herrmann, H., and Aebi, U. (2000). Intermediate filaments and their associates: multi-talented structural elements specifying cytoarchitecture and cytodynamics. Curr. Opin. Cell Biol. 12, 7990.[CrossRef][Medline]
Hopkinson, S.B., and Jones, J.C. (2000). The
N-terminus of the transmembrane protein BP180 interacts with the N-terminal
domain of BP230, thereby mediating keratin cytoskeleton anchorage to the cell
surface at the site of the hemidesmosome. Mol. Biol. Cell
11,
277286.
James, P., Halladay, J., and Craig, E.A. (1996). Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 14251436.[Abstract]
Janda, L., Damborsky, J., Rezniczek, G., and Wiche, G. (2001). Plectin repeats, and modules: strategic cysteines and their presumed impact on cytolinker functions. Bioassays 23, 10641069.[CrossRef][Medline]
Karashima, T., and Watt, F.M. (2002). Interaction of periplakin and envoplakin with intermediate filaments. J. Cell Sci. 115, 50275037.
Kartenbeck, J., Franke, W.W., Moser, J.G., and Stoffels, U. (1983). Specific attachment of desmin filaments to desmosomal plaques in cardiac myocytes. EMBO J. 2, 735742.[Medline]
Kartenbeck, J., Schwechheimer, K., Moll, R., and Franke, W.W.
(1984). Attachment of vimentin filaments to desmosomal plaques in
human meningiomal cells and arachnoidal tissue. J. Cell Biol.
98,
10721081.
Kazerounian, S., Uitto, J., and Aho, S. (2002). Unique role for the periplakin tail in intermediate filament association: specific binding to keratin 8 and vimentin. Exp. Dermatol. 11, 428438.[CrossRef][Medline]
Kouklis, P.D., Hutton, E., and Fuchs, E. (1994).
Making a connection: direct binding between keratin intermediate filaments and
desmosomal proteins. J. Cell Biol.
127,
10491060.
Kowalczyk, A.P., Bornslaeger, E.A., Borgwardt, J.E., Palka, H.L.,
Dhaliwal, A.S., Corcoran, C.M., Denning, M.F., and Green, K.J.
(1997). The amino-terminal domain of desmoplakin binds to
plakoglobin and clusters desmosomal cadherin-plakoglobin complexes. J.
Cell Biol. 139,
773784.
Leung, C.L., Green, K.J., and Liem, R.K. (2002). Plakins: a family of versatile cytolinker proteins. Trends Cell Biol. 12, 3745.[CrossRef][Medline]
Leung, C.L., and Liem, R.K. (1996). Characterization
of interactions between the neurofilament triplet proteins by the yeast
two-hybrid system. J. Biol. Chem.
271,
1404114044.
Leung, C.L., Liem, R.K., Parry, D.A., Green, K.J.
(2001b). The plakin family. J. Cell Sci.
114,
34093410.
Leung, C.L., Sun, D., and Liem, R.K. (1999). The
intermediate filament protein peripherin is the specific interaction partner
of mouse BPAG1-n (dystonin) in neurons. J. Cell Biol.
144,
435446.
Leung, C.L., Zheng, M., Prater, S.M., Liem, R.K.
(2001a). The B.P.A.G1 locus: alternative splicing produces
multiple isoforms with distinct cytoskeletal linker domains, including
predominant isoforms in neurons and muscles. J. Cell Biol.
154,
691698.
Meng, J.J., Bornslaeger, E.A., Green, K.J., Steinert, P.M., and Ip,
W. (1997). Two-hybrid analysis reveals fundamental differences in
direct interactions between desmoplakin and cell type-specific intermediate
filaments. J. Biol. Chem. 272,
2149521503.
Meng, J.J., Khan, S., and Ip, W. (1996). Intermediate
filament protein domain interactions as revealed by two-hybrid screens.
J. Biol. Chem. 271,
15991604.
Nikolic, B., Mac Nulty, E., Mir, B., and Wiche, G.
(1996). Basic amino acid residue cluster within nuclear targeting
sequence motif is essential for cytoplasmic plectin-vimentin network
junctions. J. Cell Biol. 134,
14551467.
Norgett, E.E., Hatsell, S.J., Carvajal-Huerta, L., Cabezas, J.C.,
Common, J., Purkis, P.E., Whittock, N., Leigh, I.M., Stevens, H.P., and
Kelsell, D.P. (2000). Recessive mutation in desmoplakin disrupts
desmoplakin-intermediate filament interactions and causes dilated
cardiomyopathy, woolly hair and keratoderma. Hum. Mol. Genet.
9,
27612766.
Parry, D.A., and Steinert, P.M. (1999). Intermediate filaments: molecular architecture, assembly, dynamics and polymorphism. Q. Rev. Biophys. 32, 99187.[CrossRef][Medline]
Ruhrberg, C., and Watt, F.M. (1997). The plakin family: versatile organizers of cytoskeletal architecture. Curr. Opin. Genet. Dev. 7, 392397.[CrossRef][Medline]
Schnabel, J., Weber, K., and Hatzfeld, M. (1998). Protein-protein interactions between keratin polypeptides expressed in the yeast two-hybrid system. Biochim. Biophys. Acta 1403, 158168.[Medline]
Skaria, M., Jaunin, F., Hunziker, T., Riou, S., Schumann, H., Bruckner-Tuderman, L., Hertl, M., Bernard, P., Saurat, J.H., Favre, B., and Borradori, L. (2000). IgG autoantibodies from bullous pemphigoid patients recognize multiple antigenic reactive sites located predominantly within the B and C subdomains of the COOH-terminus of BP230. J. Invest. Dermatol. 114, 9981004.[CrossRef][Medline]
Smith, E.A., and Fuchs, E. (1998). Defining the
interactions between intermediate filaments and desmosomes. J. Cell
Biol. 141,
12291241.
Stappenbeck, T.S., Bornslaeger, E.A., Corcoran, C.M., Luu, H.H.,
Virata, M.L., and Green, K.J. (1993). Functional analysis of
desmoplakin domains: specification of the interaction with keratin versus
vimentin intermediate filament networks. J. Cell Biol.
123,
691705.
Stappenbeck, T.S., Lamb, J.A., Corcoran, C.M., and Green, K.J.
(1994). Phosphorylation of the desmoplakin COOH-terminus
negatively regulates its interaction with keratin intermediate filament
networks. J. Biol. Chem. 269,
2935129354.
Steinbock, F.A., Nikolic, B., Coulombe, P.A., Fuchs, E., Traub, P., and Wiche, G. (2000). Dose-dependent linkage, assembly inhibition and disassembly of vimentin and cytokeratin 5/14 filaments through plectin's intermediate filament-binding domain. J. Cell Sci. 113, 483491.[Abstract]
Steinbock, F.A., and Wiche, G. (1999). Plectin: a cytolinker by design. Biol. Chem. 380, 151158.[CrossRef][Medline]
Steinert, P.M., Chou, Y.H., Prahlad, V., Parry, D.A., Marekov,
L.N., Wu, K.C., Jang, S.I., and Goldman, R.D. (1999). A high
molecular weight intermediate filament-associated protein in BHK-21 cells is
nestin, a type VI intermediate filament protein: limited co-assembly in vitro
to form heteropolymers with type III vimentin and type IV alpha-internexin.
J. Biol. Chem. 274,
98819890.
Sterk, L.M., Geuijen, C.A., Oomen, L.C., Calafat, J., Janssen, H.,
and Sonnenberg, A. (2000). The tetraspan molecule CD151, a novel
constituent of hemidesmosomes, associates with the integrin
6
4
and may regulate the spatial organization of hemidesmosomes. J. Cell
Biol. 149,
969982.
Taylor, S.S., Buechler, J.A., and Yonemoto, W. (1990). cAMP-dependent protein kinase: framework for a diverse family of regulatory enzymes. Annu. Rev. Biochem. 59, 9711005.[CrossRef][Medline]
Wiche, G., Becker, B., Luber, K., Weitzer, G., Castanon, M.J.,
Hauptmann, R., Stratowa, C., and Stewart, M. (1991). Cloning and
sequencing of rat plectin indicates a 466-kD polypeptide chain with a
three-domain structure based on a central alpha-helical coiled coil. J.
Cell Biol. 114,
8399.
Wiche, G., Gromov, D., Donovan, A., Castanon, M.J., and Fuchs, E.
(1993). Expression of plectin mutant cDNA in cultured cells
indicates a role of COOH-terminal domain in intermediate filament association.
J. Cell Biol. 121,
607619.
Yang, Y., Dowling, J., Yu, Q.C., Kouklis, P., Cleveland, D.W., and Fuchs, E. (1996). An essential cytoskeletal linker protein connecting actin microfilaments to intermediate filaments. Cell 86, 655665.[CrossRef][Medline]
Zhang, J. (2000). Use of yeast three-hybrid system to clone bridging proteins. Methods Enzymol. 328, 103110.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. E. Bass-Zubek, R. P. Hobbs, E. V. Amargo, N. J. Garcia, S. N. Hsieh, X. Chen, J. K. Wahl III, M. F. Denning, and K. J. Green Plakophilin 2: a critical scaffold for PKC{alpha} that regulates intercellular junction assembly J. Cell Biol., October 17, 2008; 181(4): 605 - 613. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Woll, R. Windoffer, and R. E. Leube p38 MAPK-dependent shaping of the keratin cytoskeleton in cultured cells J. Cell Biol., June 21, 2007; 177(5): 795 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lapouge, L. Fontao, M.-F. Champliaud, F. Jaunin, M. A. Frias, B. Favre, D. Paulin, K. J. Green, and L. Borradori New insights into the molecular basis of desmoplakinand desmin-related cardiomyopathies J. Cell Sci., December 1, 2006; 119(23): 4974 - 4985. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Kottke, E. Delva, and A. P. Kowalczyk The desmosome: cell science lessons from human diseases. J. Cell Sci., March 1, 2006; 119(Pt 5): 797 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Godsel, S. N. Hsieh, E. V. Amargo, A. E. Bass, L. T. Pascoe-McGillicuddy, A. C. Huen, M. E. Thorne, C. A. Gaudry, J. K. Park, K. Myung, et al. Desmoplakin assembly dynamics in four dimensions: multiple phases differentially regulated by intermediate filaments and actin J. Cell Biol., December 19, 2005; 171(6): 1045 - 1059. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sawa, S.-i. Kuroshima, Y. Yamaoka, and S. Yoshida Intracellular Distribution of Desmoplakin in Human Odontoblasts J. Histochem. Cytochem., September 1, 2005; 53(9): 1099 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-M. Lin, H.-J. Chen, C. L. Leung, D. A. D. Parry, and R. K. H. Liem Microtubule actin crosslinking factor 1b: a novel plakin that localizes to the Golgi complex J. Cell Sci., August 15, 2005; 118(16): 3727 - 3738. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Osada, H. L. Park, Y. Nagakawa, K. Yamashita, A. Fomenkov, M. S. Kim, G. Wu, S. Nomoto, B. Trink, and D. Sidransky Differential Recognition of Response Elements Determines Target Gene Specificity for p53 and p63 Mol. Cell. Biol., July 15, 2005; 25(14): 6077 - 6089. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-I. Jang, A. Kalinin, K. Takahashi, L. N. Marekov, and P. M. Steinert Characterization of human epiplakin: RNAi-mediated epiplakin depletion leads to the disruption of keratin and vimentin IF networks J. Cell Sci., February 15, 2005; 118(4): 781 - 793. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||