|
|
|
|
Vol. 14, Issue 5, 2151-2162, May 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




Cell Biology Unit, Institut de Génétique Humaine, 34396 Montpellier cedex 05, France
Submitted July 31, 2002;
Revised December 20, 2002;
Accepted January 7, 2003
Monitoring Editor: Keith Yamamoto
| ABSTRACT |
|---|
|
|
|---|
-galactosidase was induced with the same kinetics as
MyoD during mouse muscle regeneration. In contrast induction of this
reporter was no longer seen in regenerating muscle from transgenic mice
carrying a mutated DRR-CArG. These results show that an SRF binding CArG
element present in MyoD gene DRR is involved in the control of
MyoD gene expression in skeletal myoblasts and in mature muscle
satellite cell activation during muscle regeneration. | INTRODUCTION |
|---|
|
|
|---|
We and others have shown previously that the serum response factor (SRF), a
DNA binding protein belonging to the MADS (MCM1, Agamous, Deficiens, SRF) box
family of transcription factors (Treisman,
1992
), is required for both myoblast differentiation
(Vandromme et al.,
1992
) and MyoD gene expression in proliferating myoblasts
(Gauthier-Rouvière et al.,
1996
; Soulez et al.,
1996
). Further studies revealed that SRF inactivation specifically
prevented MyoD gene expression, leaving Myf-5 protein levels intact
(Carnac et al., 1998
).
Moreover, an upstream regulator of SRF activity, the small G-protein RhoA,
also specifically regulates MyoD: blocking RhoA but not Rac or CDC42 protein
activity inhibits MyoD promoter activity
(Carnac et al., 1998
).
Because our previous studies using microinjection revealed that MyoD
expression was rapidly suppressed after inactivation of SRF
(Gauthier-Rouvière et al.,
1996
; Carnac et al.,
1998
), we wished to determine if SRF could directly bind to
MyoD regulatory sequences and regulate MyoD gene activity in
proliferating myoblasts. Previous studies have shown that a 24-kbp fragment of
human MyoD 5' flanking region is sufficient to recapitulate
endogenous MyoD expression during mouse muscle development
(Chen and Goldhamer, 1999
;
Chen et al., 2001
).
In addition to a minimal promoter called proximal regulatory region (PRR;
Tapscott et al.,
1992
), two muscle-specific enhancers with distinct but overlapping
specificity have been characterized within MyoD flanking sequences in humans
and mice. A highly conserved core enhancer sequence
20 kb upstream of
MyoD is sufficient for early MyoD activation in somites, limb buds, and
branchial arches (Goldhamer et
al., 1995
; Faerman et
al., 1995
; Kablar et
al., 1998
; Kucharczuk
et al., 1999
). However, this core enhancer is not
sufficient to maintain MyoD expression in skeletal muscle, being downregulated
in fetal and neonatal muscle and essentially inactive in adult muscle
(Faerman et al.,
1995
). Five kilobases upstream of MyoD is a second enhancer, the
distal regulatory region (DRR), which is unrelated in sequence to the core
enhancer and exhibits largely complementary activity in transgenic mice
(Tapscott et al.,
1992
; Asakura et al.,
1995
; Goldhamer et
al., 1995
; Kablar et
al., 1998
; Chen et
al., 2001
). DRR activity depends on myogenic b-HLH
(Asakura et al., 1995
)
and is restricted to skeletal muscle in vivo
(Kablar et al.,
1997
). Unlike the core enhancer, the DRR remains active in adult
muscle, demonstrating a similar expression profile at this stage as the
endogenous MyoD gene (Hughes et
al., 1993
; Chen et
al., 2002
). In addition, the study by Chen et al.
(2002
), clearly demonstrated
that MyoD DRR is dispensable for MyoD expression during muscle development
whereas it is essential at postnatal stages for expression in mature muscles.
Because MyoD expression in mature muscle is essentially induced upon muscle
regeneration and growth, the pertinent context to study a DRR-dependent
regulation of MyoD appeared to be during satellite cells activation induced
upon muscle regeneration.
Using satellite cellderived myoblasts and in vivo muscle regeneration assays, we show here that an SRF-binding CArG element present in MyoD DRR enhancer plays an essential role in DRR-dependent expression of MyoD.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Oligonucleotides and Electrophoretic Mobility Shift Assay
High-performance liquid chromatographypurified oligonucleotides were
purchased commercially (MWG-BIOTECH, France SA) and dissolved in sterile
water. Sense and antisense oligonucleotides were individually labeled with T4
polynucleotide kinase (New England Biolabs Inc., Beverley, MA). Labeled
double-strand oligonucleotides were gel-purified. Nuclear extracts from
proliferated C2.7 cells were prepared as previously described
(Dignam et al.,
1983
). All extracts were aliquoted, snap-frozen in liquid
nitrogen, and stored at 80°C.
For electrophoretic mobility shift assay (EMSA), 5 µg of nuclear extract
was incubated for 15 min on ice in 1x Retardation mix (10 mM Tris/Cl, pH
8, 0.1 mM EDTA, 10 mM MgCl2, 2 mM DTT, 15% glycerol, 2 mg/ml bovine
serum albumin [BSA]), 250 ng of single-stranded DNA, in the absence or
presence of unlabeled competitor oligonucleotides (50100x).
Approximately 15,000 cpm of labeled probe was then added to the mixture and
incubated at 30°C for 10 min. For supershift analysis, 0.2 µg of rabbit
polyclonal antibody (SRF G20, YY1 C20, C/EBP
198, and CBP C20,
Santa-Cruz Biotechnology, Inc., Santa Cruz, CA) were included before probe
addition and incubated with the mixture for 1 h on ice. Samples were resolved
on a nondenaturing 5% polyacrylamide gels (19:1 acrylamide/bisacrylamide).
Gel Filtration
A volume of 50 µl containing 500 µg of proliferating nuclear extracts
were loaded on a Superose 6 gel-filtration column (Pharmacia Biotech, Orsay,
France) preequilibrated with 100 mM NaCl/20 mM Tris/Cl, pH 7.4. Proteins were
resolved at 4°C using an FPLC system (Pharmacia Biotech).
Microinjection
For microinjection studies, growing C2.7 cells were microinjected with
wtCarG, mCarG, csCarG oligonucleotides, or buffer at two concentrations: 50
and 10 µg/ml in PBS 50% in water (v/v). In all cases, injection solutions
contained inert rabbit immunoglobins (1 mg/ml) to serve subsequently in
identifying injected cells. Three hours after microinjection, cells were fixed
with formalin and expression of MyoD in the injected cells was analyzed by
double-immunofluorescence. Cells were stained with Alexa Redconjugated
anti-rabbit antibodies (Molecular Probes) to visualize injected cells and
monoclonal anti-MyoD (5.8A, PharMingen) followed by Alexa 488conjugated
anti-mouse (Molecular Probes) to probe for MyoD expression. Alternatively, as
an independent control, expression of MyF5 was analyzed 3 h after injection of
the CArG oligonucleotides. In that case, the injection solution contained
mouse Igs and the expression of Myf5 was monitored using a rabbit polyclonal
antibody directed against Myf5 (Carnac
et al., 1998
).
Site-directed Mutagenesis
Construct 17.11wt containing the mice DRR and PRR regions of MyoD gene
fused to the
-galactosidase gene was generously provided by Dr. S.J
Tapscott (Tapscott et al.,
1992
). Mutations of the CArG-box in the DRR of 17.11 m and 17.11cs
plasmids were generated using the Quick-change mutagenesis kit (Stratagene
Inc., La Jolla, CA) with the following oligonucleotides:
CCCAAAAGCCAGCTCTCGATTTATAGCACCT and CCCAAAAGCCAGCTCTCCATTTATGGCACCT (and their
corresponding lower strand oligonucleotides) for the mCArG and csCArG mutants,
respectively. All mutations were verified by sequencing.
Transgenic Mice
Fragments from the 17.11wt and 17.11mutated constructs defined by the
5' ApaI site and the 3' EagI site were used for
oocyte injections from B6CBA mice. Transgenic mice were identified by PCR
analysis of DNA extracted from tail biopsies using the following
oligonucleotides: GCGCCCATCTACACCAACGTAACC and ACGCAACTCGCCGCACATCTGAAC.
Muscle Injury
For induced regeneration studies, 8-week-old transgenic male mice
(2528 g) were anesthetized with a mix of Ketamin/Xylasin by
intraperitoneal injection (0.1 ml at 1 mg/ml per 10 g weight). The tibialis
anterior (TA) muscle of each mouse was exposed and carefully dissected of its
overlying fascias. At the level of the proximal insertion of the TA muscle,
the skin was cut 3 mm in length. The needle of a 10-µl Hamilton
microsyringe was inserted near the proximal tendon and pushed down to the
distal one, and 10 µl of notexin (50 µg/ml; Sigma) was injected in the
TA, the needle being pulled up to deliver notexin all along the muscle. The
notexin was adjusted to 50 µg/ml with physiological serum. Muscles were
subsequently recovered for analysis at different times after notexin injury
(0, 2, 3, 4, 5, and 7 d after myonecrotic injury). Muscle extracts, normalized
for their protein content, were analyzed for
-Gal activity against ONPG
and for MyoD induction by Western blot as described below.
Trichostatin A and
-Galactosidase assays
For trichostatin assays, stable transfectants (17.11wt and 17.11 m C2.7
cells) were exposed to trichostatin A (TSA, Sigma) at 50 or 100 nM for 8 and
24 h in proliferation medium (as described above). Cells were subsequently
washed, harvested, and lysed in 0.25 M Tris-Cl (pH 7.8) by three cycles of
freezing in dry ice and thawing at 37°C. After clearing by centrifugation,
supernatants were assayed for
-galactosidase activity at 37°C (1
mg/ml ONPG, 1 mM MgCl2, 45 mM
-mercaptoethanol, 0.1 M sodium
phosphate, pH 7.5). Reactions were stopped by addition of
Na2CO3, and the optical density of each reaction read at
420 nm. TA muscles were snap frozen in liquid N2 before
homogenization in 0.25 M Tris-Cl (pH 7.8) for
-Gal activity measurements
or in nuclear suspension buffer (50 mM Tris-Cl, pH 7.5, 1% NP40, 40 mM
-glycero-phosphate, 300 mM NaCl, and antiproteases) for Western blot
analyses.
Immunoprecipitation
Proliferating C2.7 cells were placed on ice and extracted with lysis buffer
containing 50 mM Tris-Cl, pH 7.5, 1% w/v Nonidet P-40 (NP40), 40 mM
-glycero-phosphate, 120 mM NaCl, 0.1 sodium orthopervanadate, 1 mM
phenylmethylsulfonyl fluoride (PMSF), and 1 mM benzamidine. Lysates were
centrifuged for 20 min at 12,000 x g, and the SRF or C/EBP
protein were immunoprecipitated from 500 µg of cell-free extracts with
anti-SRF (G20) or anti-C/EBP
(
198). Immune complexes were
precipitated using protein G-sepharose (Pharmacia) and analyzed by Western
blot after washing three times in lysis buffer. Protein concentrations were
determined by Bradford Assay using BSA as a standard.
Western Blot Analysis
Proteins from gel-filtration, muscle extracts, or immunoprecipitates were
resolved on 10% SDS-polyacrylamide gels. After transfer to a nitrocellulose
membrane (Schleicher and Schuell), Western blot analysis was performed using
SRF (G20), or MyoD (C20) rabbit polyclonal antibodies (Santa Cruz), diluted
1:500 in PBS-5% nonfat powdered milk. To detect primary antibodies blots were
probed with horseradish peroxidaseconjugated anti-rabbit antibodies
(Amersham) at 1:5000 dilution in PBS-0.5% BSA for muscle extracts or
gel-filtration and protein A/G-peroxidase (Perbio) at dilution of 1:10,000 in
PBS-0.5% BSA for immunoprecipitations. Proteins were visualized using the ECL
protein detection Kit (Roche Diagnostics) as described by the
manufacturer.
| RESULTS |
|---|
|
|
|---|
|
Sequence analysis of the regulatory region of human and mouse MyoD
genes showed the presence of conserved putative binding sites for
transcription factors, including a potential SRF-binding sequence (CArG-box)
in the DRR (Figure 1B). This
element is localized 5014 base pairs upstream of the mouse gene transcription
start site (Figure 1A). Its
sequence (CC(A/T)6AG) diverges slightly at the 3' end from the
published SRF consensus sequence (CC(A/T)6GG) (reviewed in
Shore and Sharrocks, 1995
).
However, this divergence is similar to that observed in the MLC1A
promoter, which has been demonstrated to be transcriptionally active
(Catala et al., 1995
).
As shown in Figure 1B, this
MyoD putative CArG-box is also conserved in the human MyoD
DRR enhancer region (Chen et al.,
2001
).
The MyoD CArG-box Binds SRF-containing Complexes, But with Reduced
Affinity When Compared with the c-fos SRE
To test the capacity of this CArG-box to bind nuclear factors using EMSA,
several specific probes were designed spanning this region
(Figure 1C). In the presence of
nuclear extracts from growing C2.7 myoblasts, the MyoDCArG-box formed
two complexes, a major slow-migrating complex (complex B) and a minor faster
migrating complex (complex A; Figure
2A, lane a). To compare this binding with that of other well-known
SRF-binding sequences, we performed similar experiments with the CArG box from
skeletal muscle actin and the c-fos SRE sequence. Two complexes of similar
mobility but higher intensity for complex B were observed with these probes
(Figure 2A, lanes a, e, and g).
These results suggest that MyoDCArG-box formed the same major
complexes (B) but with lower affinity than canonical SRF binding sequences.
Complex formation is specific because a mutated CArG probe (CG(A/T)6AG)
containing a C to G change in 5'
(Figure 1) abolished binding to
either complex A or B (Figure
2A, lane i). Supershift analysis using a specific anti-SRF
antibody showed that SRF was present in complex B but not complex A
(supershifted complex C, Figure
2A, lanes b, d, f, and h). Further supershift experiments using
anti-YY1 antibody revealed that complex A contained the transcription factor
YY1 as shown below (Figure 3C,
lanes a and b).
|
|
To further examine the affinity of both complexes for the CArG-box motif, we performed competitive EMSA analysis. As shown in Figure 2B, complexes formed with SRF and YY1 were abolished when MyoD-wtCArG but not mutated MyoD-mCArG oligonucleotides were added as competitors (Figure 2B, lanes ae). In addition, both complexes A and B formed with MyoD-wtCArG were more efficiently competed when SRE (Figure 2B, lanes h and i) or skeletal muscle actin-CArG-box oligonucleotides were used (unpublished data). These observations further confirm that the MyoD-CArG-box bound SRF with lower affinity than SRE or skeletal muscle actin-CArG elements.
The lower affinity of the MyoDCArG-box for the SRF-containing complex B most likely resulted from the single nucleotide change in the decanucleotide core of MyoDCArG that differentiates it from the SRF consensus sequence. To test this, we used the mutated oligonucleotide MyoD-csCArG (CC(A/T)6GG), which contained an A to G transition thus creating a consensus CArG (Figure 1B). EMSA using this MyoD-csCArG in the presence of myoblast nuclear extracts formed two complexes with the same mobility as complexes A and B, but of greater intensity, similar to that obtained with SRE or Sk-actin CArG probes (Figure 2A, lanes c and d). Competition assays using this consensus MyoD-csCArG oligonucleotide abolished both complexes with the same affinity as an SRE oligonucleotide (Figure 2B, lanes f and g). Thus, the single nucleotide divergence in the MyoDCArG-box present in DRR is associated with a lower binding affinity for SRF.
These data show that the DRR enhancer of MyoD contains a noncanonical CArG-box that is able to bind SRF and YY1 protein complexes when incubated in presence of myoblast extracts. The SRF containing complex binds MyoDCArG-box with a weaker affinity than a canonical nonmuscle CArG, such as the c-fos SRE-CArG-box and this weaker affinity is uniquely due to the single nucleotide divergence at the 3' end of MyoDCArG-box.
The CArG-box of MyoD Interacts with SRF in High-Molecular-Weight
Complexes
It has been long known and documented that transcriptional activation via
SRF does not involve any change in protein expression or level but rather
changes in associated factors (and phosphorylation state; reviewed
Treisman, 1992
,
Treisman et al.,
1998
). SRF associates with DNA in the form of homodimers
interacting with other accessory regulatory proteins that appear to potentiate
its transcriptional activity (Belaguli
et al., 1997
;
Montaner et al.,
1999
; Belaguli et al.,
2000
; Gineitis and Treisman,
2001
; Wang et al.,
2001
). We therefore examined the SRF-containing complexes from
C2.7 myoblasts.
Extracts from C2 myoblasts were fractionated on a FPLC Superose 6 gel filtration column. Different fractions (from 124) were analyzed by Western blot using antibodies against SRF. As shown in Figure 3A in myoblast cell extracts, SRF eluted in fractions 1216 that correspond to protein complexes of 500700 kDa.
Because the mass of SRF is 67 kDa and it is associated as an homodimer
(Treisman, 1992
), our data
suggest that in myoblasts, SRF interacts with a number of other cofactors. The
fractions containing SRF were subsequently examined in EMSA and results
(Figure 3B) show that
SRF-containing complex B eluted as high-molecular-weight fractions, whereas
YY1-containing complex A eluted at a molecular weight of 100300
kDa.
We therefore examined the protein content of these high-molecular-mass
complexes. Members of C/EBP family transcription factors and the
acetyltransferases CBP/P300 have been identified with SRF before, in
transcriptionally active complexes
(Ramirez et al.,
1997
; Montaner et
al., 1999
; Qiu and Li,
2002
). Supershift assays performed with antibodies specific to
YY1, CBP, or C/EBP (Figure 3C)
show that members of the C/EBP family (lanes c and d) as well as the
acetyltransferase CBP (lanes e and f) are present together with SRF in complex
B. In addition, we found that C/EBP coimmunoprecipitated with SRF from
myoblast extracts, further supporting that this cofactor contributes to SRF
activity at the MyoD-CArG (unpublished data).
Endogeneous MyoD Expression Is Specifically and Rapidly Suppressed
after Microinjection of MyoD-CArG Competing Oligonucleotides.
To examine the consequence on endogeneous MyoD expression of
performing in vivo competition assays with microinjected oligonucleotides
(Lamb et al., 1996
),
we made use of the fact that both protein and mRNA for MyoD are short lived
(<2 h), and therefore the direct effects of the injected oligos could be
examined rapidly. Wild-type, mutated or consensus oligonucleotides
corresponding to MyoDCArG box sequences shown in
Figure 1C were injected in
growing myoblasts and cells were fixed after 3 h, a time considered to be
sufficient to allow for MyoD protein and RNA turnover. Approximately
5060% of cells express MyoD in growing myoblasts. Microinjection of IgG
marker alone (control) or mutated MyoD-mCArG oligonucleotides had
little or no effect on MyoD expression (5060% of microinjected cells
expressed MyoD both in control microinjected cells and in surrounding
uninjected cells; Figure 4).
When wtCArG oligonucleotides were used at a high concentration (50 µg/ml),
we observed a significant decrease of the number of MyoD-positive cells, with
fewer than 15% of injected cells expressing MyoD (70% inhibition;
Figure 4A). A similar degree of
inhibition was also observed when MyoD-csCArG oligonucleotides were
microinjected. However, at a lower concentration (10 µg/ml instead of 50
µg/ml), only the MyoD-csCArG, and not the MyoD-wtCArG,
still inhibited MyoD expression (Figure
4A). These results confirm the lower affinity of SRF for the
wild-type MyoD-wtCArG compared with the canonical
MyoD-csCArG sequence as observed in EMSA experiments. As an
additional control, to test whether the injected CArG oligos would affect an
SRF-independent target gene, we have performed the same microinjection
experiment, instead assaying for the effects on Myf5 expression. Like MyoD,
Myf5 is expressed in growing myoblasts and has a similarly short half-life.
However, we have shown before that its expression, unlike that of MyoD, is not
dependent on SRF activity (Carnac et
al., 1998
). As shown in
Figure 4B, neither MyoD-wtCArG
nor MyoD-csCArG microinjection had any effect on Myf5 expression although they
were used at 50 µg/ml, a concentration sufficient to inhibit MyoD
expression with both oligos. These results support that inhibition of SRF
binding to MyoD-CArG by competition with MyoD-CArG-box
oligonucleotides specifically blocked MyoD gene expression in proliferating
myoblasts and that the MyoD DRR-CarG sequence is active in modulating
endogenous MyoD expression in myoblasts.
|
The CArG-box Present in MyoD DRR Enhancer Is Required for
Transcriptional Activation of MyoD in Myoblasts
Previous results from stable transfections into C2.7 myoblasts and in
transgenic mice demonstrated that a chimeric construct (17.11wt), containing
the 720 base pairs of the DRR fused to the PRR followed by
-gal, was
expressed specifically in muscle cells in vivo and in myoblast cell lines but
not in 10T1/2 fibroblast cells (Tapscott
et al., 1992
). To test if MyoD-CArG-box was
required for the specific activation of the MyoD gene in adult
skeletal myoblasts, we separately introduced two mutations in the
DRR-PRR-
-galactosidase fusion construct. The first mutation, a C to G
substitution at position 5' is the same as that shown in
Figure 1A, resulting in the
complete abolition of complexes A and B
(Figure 1B, lane i). The second
single nucleotide mutation transforms a MyoD-wtCArG into the
consensus MyoD-csCArG and strongly increased the binding of the
SRF-containing complex but not that of the YY1-containing complex
(Figure 1B, lane c). Each
construct 17.11wt (wtCArG), 17.11 m (mCArG), and 17.11c (csCArG) was stably
transfected into C2.7 cells, and enhancer activity was measured in growing
myoblasts. Consistent with the data obtained by EMSA, results presented in
Figure 5A show a mutation that
suppressed the binding of both complexes A and B to the MyoDCArG
(MyoD-mCArG) abolished MyoD DRR enhancer activity in C2.7
cells. In contrast, a mutation reverting divergent MyoDCArG-box to
the consensus CArG sequence (MyoD-cs-CArG) resulted in a twofold
increase in enhancer activity (Figure
5A). In addition, to probe whether the presence of CBP found in a
complex with SRF in myoblasts nuclear extracts
(Figure 3C) plays a functional
role in SRF activity, we have tested if treatment with the histone deacetylase
inhibitor, trichostatin A (TSA), resulted in enhanced activation of the stably
transfected DRR-driven reporter constructs in myoblasts. As shown
Figure 5B, TSA treatment
induced a clear increase in
-Gal reporter activity that was specific for
a CArG-dependent activation because no such effect was seen in myoblasts
carrying a DRR construct with a mutated CArG
(Figure 5B). These data show
that a single base mutation in MyoD-CArG sequence produced major
effects on the expression of the reporter placed downstream of MyoD
enhancer, thus demonstrating that this CArG element must play an important
role in the control of MyoD expression by the DRR enhancer.
|
The CArG Element Present in MyoD DRR Is Essential for the Induction
of MyoD Expression during Muscle Regeneration
We have shown (Figure 5)
that in the myogenic cell line C2.7, the expression of a MyoD-DRRdriven
-gal reporter (made and described previously by
Tapscott et al.,
1992
) is modulated by point mutations in the CArG element present
in this DRR. Most, if not all myogenic cell lines are derived from adult
skeletal muscle satellite cells and a recent report has shown that the
activity of DRR is dispensable during embryogenesis but essential at postnatal
stages in mature muscle when the core enhancer cannot substitute for its role
(Chen et al., 2002
).
Therefore, we examined if the DRR enhancer and CArG element we identified are
specifically implicated in MyoD expression in the context of its induced
expression in vivo, i.e., upon activation of satellite cells when muscle
regeneration is induced. We generated transgenic mice carrying the
PRR-DRR-
-galactosidase chimeric constructs 17.11wt (with wild-type CArG
sequence) or 17.11 m (with mutated CArG sequence) used in
Figure 5.
Muscle regeneration can be artificially induced by injecting the snake
venom notexin, which causes muscle fiber degeneration but does not affect the
satellite cells. Once the lesion is induced, satellite cells are activated,
proliferate, and finally differentiate, thereby effecting repair and
regeneration (Harris and Montgomery,
1975
; Lefaucheur and Sebille,
1995
). Notexin was injected in the TA muscle of transgenic mice
and the muscle was subsequently dissected at different times thereafter. After
normalizing for total protein content,
-galactosidase assays were
performed to examine MyoD-DRR promoter activity, followed by Western blotting
for MyoD and SRF expression. The results are presented in
Figure 6. At day 0, we did not
detect any
-Gal transgene activity and this was correlated with an
absence of MyoD expression, because MyoD is not
significantly expressed either in mature muscle fibers or in quiescent
satellite cells. At day 2, when the muscle is entirely degenerated with a
major inflammatory response, still no
-galactosidase activity nor MyoD
protein could be detected. By days 3 and 4 after injury, a clear increase in
transgene activity was seen in regenerating muscle from mice carrying
wild-type wtCArG-box DRR, whereas no significant increase in transgene
activity was detected in muscle from mice carrying a mutated mCArG in the DRR
(Figure 6A). However, in both
wtCArG (unpublished data) and mutated CArG transgenic mice muscles, there was
a clear induction of endogenous MyoD gene expression, which corresponds to the
induction of satellite cell proliferation
(Figure 6B). The difference
observed between the slow reduction of
-galactosidase activity (in
muscle from wt-CarG transgenic mice) and the sharp drop in MyoD expression
after day 4 is most likely due to the higher stability of
-galactosidase
(at least 15 h) compared with MyoD protein (45 min).
|
In contrast to this induced expression of MyoD, SRF gene is already
expressed at day 0, before injury, and its expression does not vary during the
regeneration process, which is in agreement with the fact that in muscle cells
we have shown the need for SRF activity without changes in protein level
(Vandromme et al.,
1992
).
These results show that the transgene 17.11wt exhibit largely similar
induction of expression as the endogenous MyoD gene during muscle
regeneration, whereas the CArG-mutated version of the transgene 17.11 m does
not. As the minimal promoter PRR does not exhibit any activity by itself in
transgenic studies (Tapscott et
al., 1992
), we can conclude that the DRR is sufficient to
induce MyoD gene expression in vivo during satellite cell activation
linked to muscle regeneration. Therefore these data shown that the CArG
element present in MyoD-DRR promoter plays an essential role in vivo in the
regulation of MyoD expression during muscle regeneration.
| DISCUSSION |
|---|
|
|
|---|
-Gal construct activity both in stably
transfected myoblasts and in transgenic mice.
MyoD DRR Promoter and Its CArG Element Play a Unique Role in the
Control of MyoD Induction during Muscle Regeneration
From previous work on the two MyoD enhancers (the DRR at 5 kb and
the core enhancer at 20 kb), the picture emerging is that the core
enhancer is required for MyoD expression during embryogenesis
(Goldhamer et al.,
1995
; Kablar et al.,
1998
; Kucharczuk et
al., 1999
) and inactive after birth
(Faerman et al.,
1995
). In contrast, the DRR is not essential for expression of
MyoD during development and it is required at postnatal stages in mature
muscle (Chen et al.,
2002
). In addition, although the two myogenic factors MyoD and
Myf5 expressed in myoblasts and involved in muscle lineage determination can
compensate for each other in muscle development (Rudnicki et al.,
1992
,
1993
), at postnatal stages,
MyoD is required for muscle regeneration
(Megeney et al.,
1996
). Indeed, MyoD expression in mature muscle is mostly induced
in satellite cells activated into proliferation during muscle regeneration;
therefore it seemed pertinent to examine MyoD modulation by the DRR in the
context of growing myoblasts and in vivoinduced regeneration.
In agreement with these observations and hypotheses, using a DRR-containing reporter construct in transgenic mice, we show that this construct was sufficient to mimic the in vivo kinetics of MyoD expression upon induction of muscle regeneration by notexin injury. We show in addition that a single nucleotide mutation in MyoD-CArG, impaired SRF binding and abolished MyoD-DRR activity, both in stably transfected myoblasts and in regenerating muscle.
Studies to date have suggested that SRF activity is likely to be regulated
at posttranslational levels but neither through changes in SRF expression nor
through its ability to bind DNA. In agreement with this, we have observed,
using the same gel-filtration experiments as shown in
Figure 3, that in G0-quiescent
myoblasts extracts, SRF is present in low-molecular-weight complexes from
100200 kDa.(whereas in growing myoblasts it is found in
high-molecular-weight complexes ranging from 500 to 700 kDa). These complexes
in G0 myoblasts can bind CArG DNA (as assayed by EMSA) and most likely
correspond to SRF homodimers, without any associated cofactors (L'honore, A.,
Carnac, G., Fernandez, A., unpublished observations). Modulation of these
complexes at the G0-G1 transition is known to be linked to changes in SRF
phosphorylation, triggered by such diverse stimuli as growth factors and
cytoskeletal actin polymerization (Marais
et al., 1992
;
Treisman, 1995
;
Sotiropoulos et al.,
1999
).
In synchronized growing myoblasts, we have shown that whereas MyoD protein
is absent in quiescent-G0 cells, its expression is induced within 34 h
after myoblasts entry into the cell cycle
(Kitzmann et al.,
1998
). These results are also corroborated in satellite cells
using isolated muscle fibers: Beauchamp et al. have shown MyoD
expression to be induced within6hin satellite cells after fiber isolation and
serum activation (Figure 5 in Beauchamp
et al., 2000
). These results further support that
myoblast cell lines, being all derived from adult satellite cells, provide a
reliable model system that mimics the regenerative process in mature
muscle.
From these data, a picture emerge whereby in vivo activation of satellite cells upon induced regeneration, like in vitro G0 to G1 entry of myoblasts, is accompanied by an SRF-dependent induction of MyoD. Our data show that the low-affinity CArG-box present in MyoD-DRR plays a key role in this process.
SRF Binding in Association with High-Molecular-Weight Complexes Is
Responsible for the Transcriptional Activity of the MyoD CArG-box in
Myoblasts
Using EMSA, we showed that MyoD-CArG-box bound two protein
complexes from myoblast nuclear extracts. To probe the potential function of
this CArG element in the control of MyoD expression, we examined the effect of
two point mutations of MyoD-CArG sequence in a reporter construct.
The first mutation, which disrupted the CArG sequence and abolished binding of
SRF and YY1-containing complexes, resulted in inactivation of the
MyoD enhancer. In contrast, a mutation that enhanced SRF binding
without affecting YY1 interaction, induced a major increase in MyoD
enhancer activity. Although these results strongly support that SRF and not
YY1 binding to the CArG element is responsible for transcriptional activation,
it remains interesting to determine the functionality of YY1 binding because
recent reports described a functional interference between SRF and YY1 in the
regulation of smooth-muscle promoters
(Itoh et al., 2001
;
Strobeck et al.,
2001
).
Binding of SRF as a dimer produces only a weak transcriptional activation
per se, and previous studies have shown that SRF can efficiently activate
transcription only after association with a number of cofactors
(Montaner et al.,
1999
; Belaguli et al.,
2000
; Gineitis and Treisman,
2001
; Wang et al.,
2001
). In this model, SRF is viewed as an essential core element
for the assembly of a multiprotein complex that may be unique to any given
promoter. For example, activity of the CArG element in cardiac genes requires
the cooperative interplay between SRF and a newly identified specific factor,
myocardin (Wang et al.,
2001
). Here, we show that SRF is bound to MyoD-CArG-box
associated with high-molecular-weight complexes. Members of the C/EBP family
of transcription factors as well as the acetyltransferases CBP and P300 can
interact with SRF and behave as "accessory proteins" in the
modulation of the transcriptional activity of SRF by RhoA
(Montaner et al.,
1999
). Because SRF-dependent regulation of myogenesis and MyoD
implies an upstream control by the small GTPase RhoA
(Carnac et al., 1998
;
Wei et al., 1998
), we
investigated whether CBP and C/EBP family members were interacting with SRF on
the MyoDCArG-box. We show by supershift analysis that members of the
C/EBP family and the acetyltransferase CBP are present with SRF in the
complexes formed on the MyoD-CArG sequence, and we observed by
coimmunoprecipitation that C/EBP interact with SRF in myoblasts nuclear
extracts (unpublished data). In addition, using TSA to inhibit histone
deacetylases, we found that the activity of DRR increased in a manner
dependent on an intact CArG sequence, upon TSA treatment of stably transfected
myoblasts. This result favors that CBP plays a functional role in the
CArG-dependent activation of MyoD via the DRR and strongly supports that SRF
binding to MyoD-CArG is accompanied by transcriptional activation.
Together, these data show that SRF binding to MyoD-CArG element
modulates the transcriptional activity of MyoD DRR enhancer in
myoblasts. These results extend our previous observations that inactivation of
SRF through microinjection of dominant negative forms of SRF proteins rapidly
abolished MyoD expression
(Gauthier-Rouvière et al.,
1996
) by showing that this effect is likely mediated by the direct
binding of SRF-containing high-molecular-weight complexes to a CArG element
present in MyoD gene.
Is the Low SRF Affinity MyoD-CArG-box Involved in the Muscle-specific
Expression of MyoD Gene?
EMSA analysis showed that MyoDCArG-box binds SRF-containing
complexes (B) with a weaker affinity when compared with the c-fos SRE
or other muscle canonical CArG sequences. In addition, a single nucleotide
mutation in the 3' end of MyoDCArG (A to G, in csCArG)
confirmed that the divergence in 3' end of the decanucleotide is
responsible for this lower affinity. This conclusion was reinforced and
extended in living cells by microinjection experiments. Indeed,
MyoD-csCArG oligonucleotides presenting a high affinity for SRF have
a higher capacity to inhibit MyoD expression than wild-type muscle CArG
oligonucleotide, which binds SRF with lower affinity. Previous studies
suggested a correlation between low-affinity DNA binding of SRF and muscle
activity. In comparison to the c-fos promoter, which contains a single
high-affinity binding site for SRF, many muscle-specific genes including MLC1A
(Catala et al., 1995
),
cardiac
-actin (Sartorelli et
al., 1990
), SM
-actin
(Mack et al., 2000
),
SM-MHC (Itoh et al.,
2001
), and SM-22
, contain CArG elements that bind SRF with
relatively lower affinity.
Replacement of the most proximal CArG-box in the skeletal
-actin
promoter with the c-fos SRE resulted in constitutive expression in transfected
nonmuscle cells (Santoro and Walsh,
1991
). One possible explanation is that weaker CArG elements might
offer an additional level of control through mechanisms that influence SRF
binding: CArG-boxes with relatively high affinities for SRF are rapidly
overloaded by low levels of SRF in a wide range of cell types, whereas
muscle-specific CArG-boxes, which exhibit reduced affinity for SRF, can only
bind SRF when it is present at higher levels, which appears to be the case for
muscle cells (Belaguli et al.,
1997
). Another possible function of the divergence in 3' of
MyoD-wtCArG-box could be that the mutation G to A would create a new
binding site for other transcription factors in addition to SRF. This or these
factors could be muscle specific and thus bring tissue specificity to
MyoD gene expression. In support of this hypothesis, Latinkic et
al. (2002
) have recently
shown that differential affinities for SRF play an important role in sensing
SRF levels in cardiac vs. skeletal muscle expression of cardiac actin. In the
same line of evidence, Chang et al.
(2001
) have shown that
multimerized CArG-box transgenes with different flanking sequences can direct
distinct development-specific expression patterns during mouse embryogenesis.
We show here that a single nucleotide change in MyoD-CArG drastically
affected both its in vitro binding properties as well as the specific activity
of a corresponding CArG-containing DRR enhancer in myoblasts and in vivo in
regenerating muscle.
Together, our observations prove that the CArG element present in MyoD-DRR must play an essential role in the control of MyoD gene expression and represent to our knowledge the first demonstration of a functional transcriptional element in MyoD DRR enhancer sequence.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Present address: Ecole Normale Supérieure de Lyon, Laboratoire de
Biologie Moléculaire et Cellulaire, 46, allée d'Italie, 69364
Lyon cedex 07, France ![]()
Present address: Endothelial and Epithelial Cell Biology, Division of Cell
Biology, Institute of Ophtalmology, University College London, Bath Street,
London ECIV 9EL, England. ![]()
Both authors contributed equally to this work. ![]()
Corresponding author. E-mail address:
af{at}acrux.igh.cnrs.fr.
| REFERENCES |
|---|
|
|
|---|
Beauchamp, J.R., Heslop, L., Yu, D.S., Tajbakhsh, S., Kelly, R.G.,
Wernig, A., Buckingham, M.E., Partridge, T.A., Zammit, P.S.
(2000). Expression of C.D34, and Myf5 defines the majority of
quiescent adult skeletal muscle satellite cells. J. Cell. Biol.
151(6),
12211234.
Belaguli, N.S., Schildmeyer, L.S., and Schwartz, R.J.
(1997). Organization and myogenic restricted expression of the
murine serum response factor gene. A role for autoregulation. J. Biol.
Chem. 272(29),
1822218231.
Belaguli, N.S., Sepulveda, J.L., Nigam, V., Charron, F., Nemer, M.,
and Schwartz, R.J. (2000). Cardiac tissue enriched factors serum
response factor, and GATA-4 are mutual coregulators. Mol. Cell.
Biol. 20(20),
75507558.
Braun, T., Rudnicki, M.A., Arnold, H.H., and Jaenisch, R. (1992). Targeted inactivation of the muscle regulatory gene Myf-5 results in abnormal rib development and perinatal death. Cell 71(3), 369382.[CrossRef][Medline]
Braun, T., and Arnold, H.H. (1995). Inactivation of Myf-6 and Myf-5 genes in mice leads to alterations in skeletal muscle development. EMBO J. 14(6), 11761186.[Medline]
Brennan, T.J., Edmondson, D.G., and Olson, E.N.
(1990). Aberrant regulation of MyoD1 contributes to the partially
defective myogenic phenotype of BC3H1 cells. J. Cell Biol.
110(4),
929937.
Carnac, G., Primig, M., Kitzmann, M., Chafey, P., Tuil, D., Lamb,
N., and Fernandez, A. (1998). RhoA GTPase and serum response
factor control selectively the expression of MyoD without affecting Myf5 in
mouse myoblasts. Mol. Biol. Cell
9(7),
18911902.
Catala, F., Wanner, R., Barton, P., Cohen, A., Wright, W., and Buckingham, M. (1995). A skeletal muscle-specific enhancer regulated by factors binding to E and CArG boxes is present in the promoter of the mouse myosin light-chain 1A gene. Mol. Cell. Biol. 15(8), 45854596.[Abstract]
Chang, P.S., Li, L., McAnally, J., and Olson, E.N.
(2001). Muscle specificity encoded by specific serum response
factor-binding sites. J. Biol. Chem.
276(20),
1720617212.
Chen, J.C., and Goldhamer, D.J. (1999). Transcriptional mechanisms regulating MyoD expression in the mouse. Cell Tissue Res. 296(1), 213219.[CrossRef][Medline]
Chen, J.C., Love, C.M., and Goldhamer, D.J. (2001). Two upstream enhancers collaborate to regulate the spatial patterning, and timing of MyoD transcription during mouse development. Dev. Dyn. 221(3), 274288.[CrossRef][Medline]
Chen, J.C., Ramachandran, R., and Goldhamer, D.J. (2002). Essential, and redundant functions of the MyoD distal regulatory region revealed by targeted mutagenesis. Dev. Biol. 245(1), 213223.[CrossRef][Medline]
Davis, R.L., Weintraub, H., and Lassar, A.B. (1987). Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51(6), 9871000.[CrossRef][Medline]
Dignam, J.D., Lebovitz, R.M., and Roeder, R.G. (1983).
Accurate transcription initiation by RNA polymerase II in a soluble extract
from isolated mammalian nuclei. Nucleic Acids Res.
11(5),
14751489.
Faerman, A., Goldhamer, D.J., Puzis, R., Emerson, C.P., Jr., and Shani, M. (1995). The distal human myoD enhancer sequences direct unique muscle-specific patterns of lacZ expression during mouse development. Dev. Biol. 171(1), 2738.[CrossRef][Medline]
Gauthier-Rouviere, C., Vandromme, M., Tuil, D., Lautredou, N., Morris, M., Soulez, M., Kahn, A., Fernandez, A., and Lamb, N. (1996). Expression and activity of serum response factor is required for expression of the muscle-determining factor MyoD in both dividing and differentiating mouse C2C12 myoblasts. Mol. Biol. Cell 7(5), 719729.[Abstract]
Gineitis, D., and Treisman, R. (2001). Differential
usage of signal transduction pathways defines two types of serum response
factor target gene. J. Biol. Chem.
276(27),
2453124539.
Goldhamer, D.J., Brunk, B.P., Faerman, A., King, A., Shani, M., and Emerson, C.P., Jr. (1995). Embryonic activation of the myoD gene is regulated by a highly conserved distal control element. Development 121(3), 637649.[Abstract]
Harris, J.B., and Montgomery, A. (1975). Some mechanical and electrical properties of distal hind limb muscles of genetically dystrophic mice (C57BL/6Jdy2j/dy2j). Exp. Neurol. 48(3 Pt 1), 56958.[CrossRef][Medline]
Hasty, P., Bradley, A., Morris, J.H., Edmondson, D.G., Venuti, J.M., Olson, E.N., and Klein, W.H. (1993). Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature 364(6437), 501506.[CrossRef][Medline]
Hughes, S.M., Taylor, J.M., Tapscott, S.J., Gurley, C.M., Carter, W.J., and Peterson, C.A. (1993). Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones. Development 118(4), 11371147.[Abstract]
Itoh, S., Katoh, Y., Konishi, H., Takaya, N., Kimura, T., Periasamy, M., and Yamaguchi, H. (2001). Nitric oxide regulates smooth-muscle-specific myosin heavy chain gene expression at the transcriptional level-possible role of SRF, and YY1 through CArG element. J. Mol. Cell. Cardiol. 33(1), 95107.[CrossRef][Medline]
Kablar, B., Krastel, K., Ying, C., Asakura, A., Tapscott, S.J., and Rudnicki, M.A. (1997). MyoD and Myf-5 differentially regulate the development of limb versus trunk skeletal muscle. Development 124(23), 47294738.[Abstract]
Kablar, B., Asakura, A., Krastel, K., Ying, C., May, L.L., Goldhamer, D.J., and Rudnicki, M.A. (1998). MyoD and Myf-5 define the specification of musculature of distinct embryonic origin. Biochem. Cell. Biol. 76(6), 10791091.[CrossRef][Medline]
Kitzmann, M., Carnac, G., Vandromme, M., Primig, M., Lamb, N.J.,
and Fernandez, A. (1998). The muscle regulatory factors MyoD and
myf-5 undergo distinct cell cycle-specific expression in muscle cells.
J. Cell Biol. 142(6),
14471459.
Kitzmann, M., and Fernandez, A. (2001). Crosstalk between cell cycle regulators, and the myogenic factor MyoD in skeletal myoblasts. Cell. Mol. Life Sci. 58(4), 571579.[CrossRef][Medline]
Kucharczuk, K.L., Love, C.M., Dougherty, N.M., and Goldhamer, D.J. (1999). Fine-scale transgenic mapping of the MyoD core enhancer: MyoD is regulated by distinct but overlapping mechanisms in myotomal and non-myotomal muscle lineages. Development 126(9), 19571965.[Abstract]
Lamb, N.J.C., Gauthier-Rouviere, C., and Fernandez, A. (1996). Microinjection strategies for the study of mitogenic signaling in mammalian cells. Front. Biosci. 1, d19d29.[Medline]
Latinkic, B.V., Cooper, B., Towers, N., Sparrow, D., Kotecha, S.,
and Mohun, T.J. (2002). Distinct enhancers regulate skeletal, and
cardiac muscle-specific expression programs of the cardiac
-actin gene
in xenopus embryons. Dev. Biol.
245,
5770.[CrossRef][Medline]
Lefaucheur, J.P., and Sebille, A. (1995). The cellular events of injured muscle regeneration depend on the nature of the injury. Neuromuscul. Disord. 5(6), 501509.[CrossRef][Medline]
Mack, C.P., Thompson, M.M., Lawrenz-Smith, S., and Owens, G.K.
(2000). Smooth muscle alpha-actin CArG elements coordinate
formation of a smooth muscle cell-selective, serum response factor-containing
activation complex. Circ. Res.
86(2),
221232.
Marais, R.M., Hsuan, J.J., McGuigan, C., Wynne, J., and Treisman, R. (1992). Casein kinase II phosphorylation increases the rate of serum response factor-binding site exchange. EMBO J. 11(1), 97105.[Medline]
Megeney, L.A., Kablar, B., Garrett, K., Anderson, J.E., and
Rudnicki, M.A. (1996). MyoD is required for myogenic stem cell
function in adult skeletal muscle. Genes Dev.
10(10),
11731183.
Montaner, S., Perona, R., Saniger, L., and Lacal, J.C.
(1999). Activation of serum response factor by RhoA is mediated
by the nuclear factor-kappaB and C/EBP transcription factors. J. Biol.
Chem. 274(13),
85068515.
Nabeshima, Y., Hanaoka, K., Hayasaka, M., Esumi, E., Li, S., Nonaka, I., and Nabeshima, Y. (1993). Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature 364(6437), 532535.[CrossRef][Medline]
Olson, E. et al. (1990). Myogenin is in an evolutionarily conserved linkage group on human chromosome 1q31q41 and unlinked to other mapped muscle regulatory factor genes. Genomics 3, 427434.[CrossRef]
Patapoutian, A., Yoon, J.K., Miner, J.H., Wang, S., Stark, K., and Wold, B. (1995). Disruption of the mouse MRF4 gene identifies multiple waves of myogenesis in the myotome. Development 121(10), 33473358.[Abstract]
Pinset, C., Montarras, D., Chenevert, J., Minty, A., Barton, P., Laurent, C., and Gros, F. (1988). Control of myogenesis in the mouse myogenic C2 cell line by medium composition and by insulin: characterization of permissive and inducible C2 myoblasts. Differentiation 38(1), 2834.[CrossRef][Medline]
Qiu, P., and Li, L. (2002). Histone acetylation, and
recruitment of serum responsive factor, and CREB-binding protein onto SM22
promoter during SM22 gene expression. Circ. Res.
90(8),
858865.
Ramirez, S., Ait-Si-Ali, S., Robin, P., Trouche, D., and
Harel-Bellan, A. (1997). The CREB-binding protein (CBP)
cooperates with the serum response factor for transactivation of the c-fos
serum response element. J. Biol. Chem.
272(49),
3101631021.
Rawls, A., Valdez, M.R., Zhang, W., Richardson, J., Klein, W.H., and Olson, E.N. (1998). Overlapping functions of the myogenic bHLH genes MRF4 and MyoD revealed in double mutant mice. Development 125(13), 23492358.[Abstract]
Rudnicki, M.A., Braun, T., Hinuma, S., and Jaenisch, R. (1992). Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development. Cell 71(3), 383390.[CrossRef][Medline]
Rudnicki, M.A., Schnegelsberg, P.N., Stead, R.H., Braun, T., Arnold, H.H., and Jaenisch, R. (1993). MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 75(7), 13511359.[CrossRef][Medline]
Santoro, I.M., and Walsh, K. (1991). Natural and
synthetic DNA elements with the CArG motif differ in expression and
proteinbinding properties. Mol. Cell. Biol.
11(12),
62966305.
Sartorelli, V., Webster, K.A., and Kedes, L. (1990).
Muscle-specific expression of the cardiac alpha-actin gene requires MyoD1,
CArG-box binding factor, and Sp1. Genes Dev.
4(10),
18111822.
Shore, P., and Sharrocks, A.D. (1995). The MADS-box family of transcription factors. Eur. J. Biochem. 229(1), 113.[Medline]
Sotiropoulos, A., Gineitis, D., Copeland, J., and Treisman, R. (1999). Signal-regulated activation of serum response factor is mediated by changes in actin dynamics. Cell 98, 159169.[CrossRef]