Molecular Biology of the Cell track citations

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E02-11-0706 on March 7, 2003

Vol. 14, Issue 6, 2206-2215, June 2003

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E02-11-0706v1
14/6/2206    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Christensen, T. W.
Right arrow Articles by Tye, B. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Christensen, T. W.
Right arrow Articles by Tye, B. K.

Drosophila Mcm10 Interacts with Members of the Prereplication Complex and Is Required for Proper Chromosome Condensation

Tim W. Christensen, and Bik K. Tye *

Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York 14853-2703

Submitted November 4, 2002; Revised January 20, 2003; Accepted February 26, 2003
Monitoring Editor: Allan Spradling


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Mcm10 is required for the initiation of DNA replication in Saccharomyces cerevisiae. We have cloned MCM10 from Drosophila melanogaster and show that it complements a ScMCM10 null mutant. Moreover, Mcm10 interacts with key members of the prereplication complex: Mcm2, Dup (Cdt1), and Orc2. Interactions were also detected between Mcm10 and itself, Cdc45, and Hp1. RNAi depletion of Orc2 and Mcm10 in KC cells results in loss of DNA content. Furthermore, depletion of Mcm10, Cdc45, Mcm2, Mcm5, and Orc2, respectively, results in aberrant chromosome condensation. The condensation defects observed resemble previously published reports for Orc2, Orc5, and Mcm4 mutants. Our results strengthen and extend the argument that the processes of chromatin condensation and DNA replication are linked.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
DNA replication is one of life's most ancient inventions. Control of this process with respect to the cell cycle is critical. Replication must occur at both the right time and to the proper degree for the survival of an organism. Moreover, with increases in the DNA content and transcriptional complexity of organisms, essential mechanisms evolved to package DNA, control condensation for mitosis, and regulate accessibility to transcription factors. In response to these critical needs, a host of factors have evolved. The ancient origin of these controls is highlighted by the conservation of the key players throughout Eukarya and Archaea (Tye, 2000Go). Examples of these well-used players in control of DNA replication are the members of the prereplication complex (pre-RC). The pre-RC is defined as the set of factors required to license an origin for the initiation of DNA replication (Blow and Laskey, 1988Go). The members of the pre-RC include ORC, MCM2–7, Cdc6, Cdt1, and Mcm10 (Lei and Tye, 2001Go). On activation and recruitment of additional factors, such as Cdc45, the pre-RC is converted to the preinitiation complex (pre-IC), which is the complex required for the transition to replication (Bell and Dutta, 2002Go; Wohlschlegel et al., 2002Go).

Probably in part due to the evolutionary time that has passed and the increasing complexity of genomes, some of the functions of these proteins have been co-opted for use in other pathways. The prime example of this is the ORC complex whose ability to bind DNA and recruit other factors to DNA has been used for silencing in Saccharomyces cerevisiae and heterochromatin formation in Drosophila (Bell, 2002Go; Gerbi and Bielinsky, 2002Go). Members of the pre-RC and pre-IC complex, in addition to ORC, are also emerging as multifunctional proteins. Cdc45 has been shown to be required for silencing in S. cerevisiae (Ehrenhofer-Murray et al., 1999Go) and Mcm2 interacts with Hbo1, a protein that is implicated in chromatin remodeling (Burke et al., 2001Go). As more and more components of the pre-RC and pre-IC are implicated in chromatin remodeling, it becomes likely that these complexes as a whole, and their individual components, may have roles outside of DNA replication.

Mcm10 was first identified in S. cerevisiae as defective in S-phase progression (Solomon et al., 1992Go) and subsequently was shown to be defective in the maintenance of minichromosomes (Merchant et al., 1997Go). Work on Mcm10 in S. cerevisiae has revealed that Mcm10 interacts with members of the pre-RC and is required for efficient initiation of DNA replication. Mutants of Mcm10 exhibit pausing of replication forks, suggesting a role for Mcm10 in elongation. Chromatin fractionation experiments show that Mcm10 is constitutively bound to chromatin (Homesley et al., 2000Go; Kawasaki et al., 2000Go). Analysis in human has shown that Mcm10 interacts with Orc2, is phosphorylated, and is degraded by an ubiquitin-dependent pathway during the cell cycle (Izumi et al., 2000Go, 2001Go). Recent work in Xenopus demonstrates that Mcm10 is required for replication, is dependent on Mcm2–7 for association with the origin, and is necessary for recruitment of Cdc45 (Wohlschlegel et al., 2002Go).

In this study, we present evidence that Drosophila Mcm10 is the true ortholog of S. cerevisiae. Moreover, we show that Mcm10 interacts with members of the pre-RC. We also show that Mcm10 interacts with Hp1 suggestive of a role for Mcm10 in heterochromatin formation. To investigate the role of Mcm10 in tissue culture cells, we effectively depleted Mcm10 by RNA interference (RNAi) (Hutvagner and Zamore, 2002Go). This depletion has consequences for the overall DNA content of the cell and has dire consequences with respect to chromosome condensation. We also present evidence that depletion of Cdc45, Mcm2, Mcm5, and Orc2, respectively, from tissue culture results in aberrant chromosome condensation. These findings lend credence to the argument that DNA replication and chromosome condensation are processes that are intimately linked.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
DNA Manipulations
Clones for MCM10 95–776aa and 1–776aa, ORC2, ORC4, ORC5, MCM2, MCM5, DOCK, and CDC45 were amplified from cDNA prep (gift from J. Mueller, Cornell University, Ithaca, NY) with GATEWAY attB1 and B2 sequences on 5' end of primers with or without stop codon, depending on downstream application. PCR products were cloned into pDONR201 per manufacturer's protocol. Entry vectors were incubated with destination vectors pDEST117 (N term 6HIS tag), and pTCgfp. Destination green fluorescent protein (GFP) vector (pTCgfp) was generated from existing pUC18 plasmid with dMT::GFP::dADH 3'(pRmHa3) inserted into EcoR1/HindIII. Plasmid was converted to destination vector by insertion of CassA between promoter and GFP by blunt-end ligation into blunted BamH1 between dMT and GFP. Incubation with MCM10 entry vectors resulted in C terminal in frame fusion of GFP.

Antibodies/Immunoblots
Rabbit polyclonal anti-Mcm10 was generated against purified 6His::Mcm10 aa 95–776 and affinity purified against 6His::Mcm10 aa 1–776. Antibodies used were anti-Dock (Clemens et al., 2000Go); antiMcm2, anti-Mcm5, and anti-Cdc45 (Loebel et al., 2000Go); anti-Dup (Whittaker et al., 2000Go); anti-Orc2 (Austin et al., 1999Go); anti-Orc1 (Chesnokov et al., 2001Go); anti-Hp1 (kind gift from M. Botchan); and anti-Lamin (Stuurman et al., 1996Go). Mcm10, Orc2, Mcm2, Mcm5, and Cdc45 antibodies were used at 1:5000. Lamin, Dup, Orc1, Hp1, and Dock antibodies were used at 1:10,000. Embryo extracts were prepared in 1x phosphate-buffered saline (PBS) + 0.1% Trition X-100 + 1 mM phenylmethylsulfonyl fluoride + protease inhibitors (catalog no. 1697498; Roche Diagnostics, Indianapolis, IN) + DNase, and RNase. Buffer + embryos were frozen in liquid nitrogen then lysed by blending in a coffee grinder with dry ice. Lysate was spun at high speed for 20 min at 4°C. For KC cells, 1 ml of culture was spun down and washed two times in 1 ml of PBS, and 50 µl of radioimmunoprecipitation assay buffer was added and vortexed for 20 s. Three times loading buffer was added to extracts before PAGE analysis. All polyacrylamide gels were 8% except for those probed for Hp1, which were 12%. All blocking and antibody incubations were in 5% nonfat milk.

RNAi
All RNAi procedures were carried out in six-well plates with culture volumes of 2 ml at a starting concentration of 1 x 106 cells/ml. Specific double-stranded RNA (dsRNA) was added to a final concentration of 10 nM. RNA was generated using Megascript (catalog no. 1334; Ambion, Austin, TX) and protocols therein. Primers for generation of DNA templates all contained the T7 promoter at the 5' ends GAATTAATACGACTCACTATAGGGAGA. All amplifications were templated from entry vectors described above. Sequence-specific portions of primer pairs used in this study listed 5'-3' are as follows: CDC45, TCCCGACTGACGAACAAAACGAA and AAAAGAAAGCGAGCCAACAGTCCA; MCM2, AAGGCGCCATGGATGCTACTACAC and TGCTCTCCATTTTCCCCACTTACG; MCM5, AGTGCCCGCTGGACCCCTTCT and GGCTCCACCCTCCACGACAA; MCM10, TCGAGAGGAGAGCGGGAAGC and TGGGCGTTAAACTGGCATCAAAG; ORC2, GGTTGGGAATGCAGTGGAATCTCA and TACTGGGCGTTTTGGGCTCATCAT; and DOCK (Clemens et al., 2000Go).

Tissue Culture/Fluorescence-activated Cell Sorting (FACS) Analysis
KC cells were propagated in HyQ-CCM 3 serum-free media (catalog no. SH30065.01; Hyclone Laboratories, Logan, UT) supplemented with 100 U/ml penicillin, and 100 U/ml streptomycin in 75-cm2 flasks or six-well culture dishes. Stable cell line was generated as per Current Protocols Online for Preparation of Stable Polyclonal S2 Cell Lines by cotransfection of pHygo with Mcm10::GFP vector by using CellFECTIN (Invitrogen Life Technologies, Carlsbad, CA) and protocol therein. Induction of Mcm10::GFP was achieved with 1.7 mM CuSO4 for 8 h. Cells were prepared for FACS analysis as in Current Protocols Online for DNA Content Analysis of Fixed Cells with Propidium Iodide. Cells were analyzed on FACSCalibur system.

Complementation
Complementation analysis was carried out in strain DBY2063 in which MCM10 was replaced by the HisG URA3 cassette (Alani et al., 1987Go) and kept alive by pRS316URA3 containing ScMCM10. This strain was a gift from N. Douglas (Cornell University, Ithaca, NY).

Immunoprecipitation
Embryo extracts were prepared as described above. KC cells were harvested, washed two times in PBS, and extracted in the same manner as described for embryos. The resulting extract contained approximately 5 ml of 5 x 106 cells/ml/0.5 ml of lysate and was treated with DNase. Antibodies were used at 1:500 dilutions for all immunoprecipitations in 0.5 ml of extract. A slurry (25 µl) of magnetic beads coated in Protein A was used for all but anti-GFP where protein G beads were used (catalog nos. 100.02 and 100.04; Dynal Biotech, Lake Success, NY). Antibodies were incubated with extract for 2 h at 4°C after which beads were added and incubated for an additional 2 h. Beads were washed extensively in 1x PBS, 0.1% Triton X-100. Protein was eluted by addition of loading buffer.

Metaphase Spreads
Two milliliters of KC cells at 3 x 106 cells/ml in six-well culture dishes were incubated with 5 µM colchicine for 1.5 h. Cells were spun down and washed two times in 1 ml of room temperature PBS followed by incubation in 1 ml of 0.5% sodium citrate for 10 min at room temperature. Cells were gently spun down and fixed in 1 ml of ice-cold 3:1 methanol/acetic acid for 5 min followed by rinse in another 1 ml of fixative. Cells were resuspended in a small volume of fixative and dropped from 0.5 m onto cleaned microscope slides and allowed to air dry completely. Preparations were mounted in VectaShield with 0.5 µg/ml Hoechst and viewed within 12 h.

Microscopy
Metaphase spreads fluorescence microscopy was performed on a Nikon scope with 100x objective and appropriate filters and captured to 8-bit images by charge-couple device camera. All images were uniformly adjusted for brightness and contrast using windows Adobe Photoshop 5.5.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Mcm10 Is a Conserved Protein
The Drosophila homolog of Mcm10 was first identified by Izumi et al., (2000Go). The study used the predicted Drosophila Mcm10 to identify homologous human ESTs. The Drosophila Mcm10, known as CG9241, maps to the 2nd chromosome and cytologically to 39B1 (Flybase, 1999). We took advantage of known EST sequences to design primers to amplify MCM10 from cDNA isolated from Drosophila ovary tissue. Sequencing of the resulting clone revealed that Drosophila Mcm10 is a 776 amino acid protein with a predicted molecular mass of 86.5 kDa. Overall, it shares similarity to Human (32.1%), Xenopus (30.5%), Arabidopsis thaliana (29.7%), Caenorhabditis elegans (26.2%), S. cerevisiae (24.1%), and Schizosaccharomyces pombe (23.1%). Alignments of the conserved regions of human, Xenopus, Drosophila, and S. cerevisiae reveal that Drosophila Mcm10 shares a conserved central core and a signature zinc finger motif (Figure 1A). In addition, there is a high degree of regional conservation between Mcm10 of Drosophila and higher eukaryotes that points to the fact that studies in Drosophila will have significant bearing on those in Xenopus and human.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. Alignments of Mcm10 and DmMcm10 complements ScMcm10. (A) Mcm10 from Homo sapiens, X. laevis, D. melanogaster, and S. cerevisiae all share conserved core (black) and zinc finger motif (shaded box). Also shown is shared conserved region among metazoans (stippled). Line through at amino acid 95 of DmMcm10 represents C-terminal fragment able to complement ScMcm10. (B) DmMcm10 supports growth of S. cerevisiae strain null for ScMcm10. Null strain with ScMCM10 pRS316 URA3 plasmid grows on CM-URA (bottom right) but not on CM + 5-FOA (top middle). Transformation of null strain with Dm- MCM10 pRS315 Leu2 results in ability to grown on CM + 5-FOA (top middle). When taken from 5-FOA and plated on CM-Leu growth is observed (bottom left) but not observed on CM-Ura (bottom right).

 

Drosophila Mcm10 Complements ScMcm10
To assess whether Drosophila Mcm10 could functionally complement a S. cerevisiae null mutation, a Leu+ plasmid containing Drosophila MCM10 driven by the endogenous yeast MCM10 promoter was transformed into a strain null for the chromosomal copy of MCM10 and kept alive by a Ura+ plasmid containing ScMCM10. We then determined whether the strain could be rescued from 5-fluoroorotic acid (5-FOA) toxicity by the Leu+ plasmid containing Drosophila MCM10. FOA toxicity allows the positive selection of cells that can no longer synthesize uracil (Ura-) or have lost pRS316-URA3 ScMCM10. The results show that Drosophila Mcm10 is able to complement the null mutation for growth (Figure 1B). In addition, a fragment of Drosophila Mcm10 representing amino acids 96–776 was also able to complement ScMcm10 (our unpublished data). These results are unexpected given the low overall sequence similarity between the homologues and the fact that HsMcm10 does not complement mutants mcm10-1 and mcm10-43 in S. cerevisiae or Cdc23-M36 in S. pombe (Izumi et al., 2000Go). The fact that Drosophila Mcm10 can complement S. cerevisiae Mcm10 supports the conclusion that Drosophila Mcm10 is a true ortholog of S. cerevisiae, thus functional studies are likely to have significance for both species.

Mcm10 Interacts with Members of the Pre-RC
Mcm10 has been shown in yeast to interact with all members of the Mcm2-7 family except for the notable exception of Mcm5 (Merchant et al., 1997Go). In addition, human Mcm10 interacts with Orc2 (Izumi et al., 2000Go). To investigate which members of the pre-RC interact with Mcm10 in Drosophila coimmunoprecipitation experiments were performed. A stable KC cell line containing Mcm10::GFP was induced or not induced with Cu2+ and cells were harvested, processed, and immunoprecipitated with anti-GFP. Interactions with Mcm10-GFP are detected with Mcm2, Orc2, and the endogenous Mcm10, consistent with the two-hybrid studies (Figure 2A; our unpublished data). Also probed and shown positive for interactions are Dup, Cdc45, and Hp1 (Figure 2A). No interaction is detected with Mcm5, and Orc1. It could be argued that ectopic overexpression of Mcm10 could result in atypical interactions. Furthermore, positives could result from interaction with GFP. To address these concerns, immunoprecipitations were performed using antibodies to Cdc45, Dup, Mcm2, Orc2, Mcm5, Orc1, and Hp1, respectively, in embryo cell extracts. Similar to the coimmunoprecipitation results with Mcm10-GFP, in all but Mcm5 and Orc1, Mcm10 is detected (Figure 2B). The specificity of antibodies used was verified by Western blots of KC cell extracts (Figure 2C). Each antibody reacted with only the corresponding cognate protein antigen to yield a single reacting species with the exception of Mcm10-specific antibodies, which reacted with both the Mcm10::GFP fusion protein and the endogenous Mcm10p.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. Mcm10 interacts with members of the pre-RC and Hp1. (A) Interactions between Mcm10::GFP and Mcm2, Dup, Cdc45, Orc2, Hp1, and Mcm10, respectively. Extracts from KC cells induced or not induced to produce Mcm10::GFP were immunoprecipitated with anti-GFP. Precipitate was loaded onto SDS-PAGE gel and probed with antibodies indicated. No interactions were detected for Orc1 and Mcm5. (B) Western blot probed with antiMcm10 of immunoprecipitation from embryo extracts with antibodies against Cdc45, Dup, Mcm2, Orc2, and Hp1 respectively. Mock was performed with preimmune rabbit IgG. Input lanes in A and B represent 4% of total protein. (C) Western blots of extracts from KC cells probed with antibodies against Mcm2, Cdc45, Mcm5, Orc1, Mcm10, Dup, and Hp1, respectively.

 

Mcm10 Is Depleted by RNAi
In the absence of a known Drosophila mutant for Mcm10, we used RNAi to determine the function of Mcm10 in Drosophila. RNAi involves addition of dsRNA specific to the mRNA sequence of the target gene. RNAi acts to deplete the mRNA of the target species. The result is that the protein of interest is specifically depleted from cells at a rate corresponding to the inherent stability of the protein (Hutvagner and Zamore, 2002Go). RNAi has been demonstrated as an effective tool in Drosophila tissue culture for determining gene function (Clemens et al., 2000Go; Goto et al., 2001Go). In this analysis, KC cells at low densities were inoculated with specific dsRNA and collected over a 5-d period for immunoblot analysis. Over the course of the experiment, cells grew from low to high densities. Low densities corresponded to cell cycle time of ~22 h, and the apparent cell cycle lengthens to 40+ h at high density as cells begin to exit into G0 (see next section; Figure 4A). Mcm10, Cdc45, Mcm2, Mcm5, and Orc2 are all efficiently depleted from KC cells upon addition of specific dsRNA (Figure 3, A–E). This depletion is not a general effect, because treatment with dsRNA specific to Dock (a protein with no known connection to DNA replication) is identical to untreated (Figure 3F).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Effects of depletion of Mcm10 and Orc2, respectively, on cell growth and DNA content. (A) Cell density >6 d of KC cells either untreated or incubated with specific dsRNA to Mcm10, Orc2, and Dock, respectively. (B) Cumulative cell divisions >18 d in cells incubated with specified dsRNA or untreated. Cells were diluted every 3 d to 1 x 106cells/ml and reinoculated with specific dsRNA. Data points based on replica hemacytometer counts and calculations of doubling time before each dilution. (C) Cells from B were collected after 10 cell cycles, fixed, RNase treated, and stained for FACS analysis.

 


View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. RNAi depletion of Mcm10, Cdc45, Mcm2, Mcm5, and Orc2. (A–E) Specific dsRNA added at final concentration of 10 nM to KC cells as indicated at top of panels and depletions monitored by Western blots >5 d. Blots probed with antibodies as indicated to left of panels.

 

Mcm10 and Ccd45 are particularly sensitive to RNAi treatments because both are depleted by 48 h and are undetectable by Western blot (Figure 3, A and B, compared with F). The rapid depletion is indicative of either inherent instability of these proteins or regulation via proteolysis. Mcm2 and Mcm5 show depletion of the bulk of the protein by 48 h but both remain at low levels (Figure 3, C and D, compared with F). In contrast, Orc2 is slowly depleted over the time course compared with the others (Figure 3E compared with F). This observation is supported by the fact that null mutants for Orc2 in Drosophila persist until third instar, presumably due to the stability of maternal deposits (Landis et al., 1997Go).

Several interesting observations are apparent from these experiments. First, both Mcm10 and Cdc45 exhibit sensitivity to exit into G0 and/or increasing cell densities as shown by the fact that both are reduced in the nonspecific treatment (Figure 3F). This is in contrast to Mcm2, Mcm5, and Orc2, which all show increases correlating with increased cell densities and are seen to accumulate as cells exit into G0 and/or increase in density as measured over this time course (Figure 3F). These observations suggest that overall stability of Mcm10 and Cdc45 may be regulated as a function of the cell cycle, regulated in relation to cell densities, or a combination of both. On the other hand, overall stability of Mcm2, Mcm5, and Orc2 does not seem to be regulated with respect to the cell cycle and/or increased cell densities (Figure 3F). The relatively short-lived Drosophila Mcm10 is consistent with observations reported for the human Mcm10. HsMcm10 protein levels are regulated by both phosphorylation- and ubiquitin-dependent proteolysis during late M and early G1 phase (Izumi et al., 2001Go). In contrast, S. cerevisiae Mcm10 has been shown to be present at constant levels throughout the cell cycle (Homesley et al., 2000Go).

Cell Cycle Length Is Unaffected by Depletion of Mcm10
At the outset, one would predict that depletion of proteins required for initiation of DNA replication would have dire consequences for cell growth. We assayed cell growth of KC cells treated with dsRNA specific to Mcm10, Orc2, and Dock compared with untreated. However, over the course of 6 d the growth of cells depleted of Orc2 and Mcm10 seemed unaffected. No significant deviation was noted from the Dock control or the untreated cells (Figure 4A). One could argue that because of the short time assayed and the fact that apparent cell division slows as cell density increases that one would not be able to detect a significant decrease in growth. To address this, we performed a more rigorous test. We diluted cells every 3 d to keep them at densities that allow logarithmic growth rate. Concurrently, cells were inoculated with specific dsRNA when diluted to ensure that translation of the specific genes did not recover from the initial RNAi treatment. Cell divisions were quantified and cumulative cell divisions calculated over an 18-d period. Cells well past depletion of any detectable Orc2 or Mcm10 divided at wild-type rates (Figure 4B). The same phenomenon was observed for depletion of Mcm2, Mcm5, and Cdc45, respectively (our unpublished data).

The fact that long-term depletion of Orc2 to <10% had no effect on cell division rates demanded further investigation into how Orc2 depletion was tolerated. Given that KC cells are aneuploidy (see below; Figure 6, A–F), it seems reasonable that these cells could tolerate some degree of chromosome loss. Depletion of Orc2 that is involved in initiation of DNA replication and depletion of Mcm10 that has been shown in yeast to be required for initiation of DNA replication (Merchant et al., 1997Go) may have consequences for the DNA content of KC cells.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 6. Chromosome condensation defects in KC cells depleted of replication proteins. Micrographs of metaphase KC cell chromosomes stained with Hoechst. Metaphase chromosomal defects for each RNAi depletion after 10 cell cycles were sorted into categories: I, II, and III for defects in lateral condensation, and I', II', and III' for fragmentation. Representative chromosomes for wild type (A), Dock depleted (B), Mcm10 depleted (C), Cdc45 depleted (D), Mcm2 depleted (E), Mcm5 depleted (F), and Orc2 depleted (G). Bar, 5 µm.

 

To investigate possible DNA content effects in Drosophila KC cells depleted of Orc2, Mcm10 (both positive regulators of DNA replication), and Dock, respectively, were analyzed by FACS. Cells were inoculated with specific dsRNA and maintained in the continual presence of dsRNA and harvested after 10 cell cycles. FACS analysis indicates that both Orc2-depleted and Mcm10-depleted cells show a loss of DNA content compared with Dock-depleted and untreated controls (Fig. 4C). This suggests that depletion of Orc2 and Mcm10 both have consequences on the ability of cells to maintain DNA content that may result from decreases in the efficiency of DNA replication or chromosome stability.

Mcm10 Is Sensitive to Depletion of Mcm2 and Orc2
RNAi is specific to the target protein. However, because depletion of a particular protein does not occur in a vacuum but rather in a network of interactions, we wanted to examine Mcm10 stability in cells depleted of other proteins. KC cells were diluted in the presence of specific dsRNA for ~10 cell cycles. Cells were harvested, lysed, and whole cell extracts were loaded onto SDS-PAGE gels. Blots were then probed for Mcm10, Cdc45, Mcm2, Mcm5, Orc2, Dock, and lamin, respectively (Fig. 5). Total Mcm10 protein levels are reduced in KC cells depleted of Mcm2, Orc2, and to a lesser extent Mcm5. Cdc45 levels are reduced when Mcm10, Mcm2, and Mcm5 are depleted. Mcm2 levels are slightly reduced when Orc2 is depleted. Last, Orc2 levels are relatively unchanged in all but the specific treatment.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 5. Relative stability of Mcm10, Cdc45, Mcm2, and Orc2 in KC cells after respective RNAi treatments. Cells after 10 cell cycles in presence of indicated dsRNA species were harvested and extracted. Extracts were run on SDS-PAGE gels and resulting blots probed with indicated antibodies.

 

Depletion of Mcm10 and Other Replication Proteins Results in Aberrant Chromosome Condensation
In Drosophila, there is growing evidence that establishment of proper chromosome condensation is linked to either DNA replication or specific components of the pre-RC. Mutations in Orc2, Orc5, Mcm4, PCNA, and Rfc4 have all been shown to arrest with an elevated percentage of metaphase figures and demonstrate chromosome condensation defects (Loupart et al., 2000Go; Dobie et al., 2001Go; Pflumm and Botchan, 2001Go). Our ability to deplete members of the pre-RC by RNAi prompted us to investigate whether similar defects could be observed in KC cells. Furthermore, we were interested in finding out whether depletion of Mcm10 and Cdc45, both components of the pre-IC, may have similar effects on chromosome condensation. KC cells were again depleted >10 cell cycles of Mcm10, Cdc45, Mcm2, Mcm5, and Orc2, respectively. Cells were then treated with colchicine to enrich for metaphase figures, stained, and visualized. In all but the RNAi treatment for Dock and in untreated, defects are observed (Figure 6, A–G). Chromosomal defects observed in depletions of Mcm10 (Figure 6C) and Cdc45 (Figure 6D) were classified into three categories corresponding to increases in the severity of lateral condensation defects, with I corresponding to the least severe and III the most severe. In addition to lateral condensation defects, chromosomes of cells depleted of Mcm2, Mcm5, and Orc2 seemed fragmented and were categorized with respect to increasing fragmentation, with I' being the least and III' being the most severe.

Depletion of Mcm10 and Cdc45, respectively, results in strikingly similar defects in chromosome morphology (Figure 6, C and D). The condensation defects apparent in both depletions consist of similar "dumbbell" shaped chromosomes. Sister chromatid separation (see arrowheads) is observed in both treatments with a higher frequency observed in cells depleted of Cdc45. Chromosome fragmentation in Mcm10 and Cdc45 depletions is observed at levels no higher than that of wild type and is likely a consequence of specimen preparation. The fact that these defects are so similar combined with the findings that these two proteins have been shown to interact supports the supposition that these two proteins function in concert in the same pathway.

Depletion of Mcm2, Mcm5, and Orc2 results in a high degree of fragmentation in addition to lateral condensation defects suggestive of incomplete DNA synthesis and subsequent unchecked chromosome separation (Figure 6, E–G). Mcm2 depletion demonstrates the most severe defect with no wild-type figures found and an overwhelming percentage in class III', the most severe class. Sister chromatid separation is noted in all three treatments but is more prevalent in Mcm2-depleted cells. The small discrepancies between Mcm2 and Mcm5 depletions with respect to severity may represent merely different stability levels of the protein as Mcm2 is depleted more rapidly and thoroughly by RNAi.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Mcm10: Pre-RC and Pre-IC
Biochemical and genetic evidence in S. cerevisiae and Xenopus laevis studies suggest that Mcm10 is a member of the pre-RC (Homesley et al., 2000Go) and is required for the pre-IC transition (Homesley et al., 2000Go; Wohlschlegel et al., 2002Go). We report that Drosophila Mcm10 biochemically interacts with components of the pre-RC, including Mcm2, Orc2, and Dup, respectively, and with itself. These interactions further the argument that Mcm10 is present in the pre-RC before the transition to the pre-IC and that interaction of Mcm10 with its various partners may be mediated by a Mcm10 multimer (Lei and Tye, 2001Go).

We present the first evidence for an interaction between Mcm10 and Dup, the Drosophila homolog of Cdt1. This interaction is of particular interest in light of the observation that Cdt1 is required for loading of the MCM complex (Maiorano et al., 2000Go) and is a target for geminin regulation (Wohlschlegel et al., 2001Go). These and other studies suggest that Cdt1 interacts with the ORC and MCM complexes. In this context, Mcm10 may be interacting directly with Dup or indirectly through ORC or the MCMs to facilitate steps in pre-RC assembly.

Mcm10 interaction with Cdc45 has been implied previously in Xenopus where it has been shown that Cdc45 requires Mcm10 for origin binding (Wohlschlegel et al., 2002Go). In addition, it has been shown that S. cerevisiae Mcm10 genetically interacts with Cdc45 (Homesley et al., 2000Go). The experiments presented herein extend the interaction between Cdc45 and Mcm10 to Drosophila and support the hypothesis that stabilization of Cdc45 binding to origins may occur via a direct or indirect interaction with Mcm10.

Mcm10 and Hp1
Heterochromatin protein 1 (Hp1) has been shown to interact with members of the ORC complex (Pak et al., 1997Go). Interaction with Mcm10 suggests that, like Orc2, Mcm10 may be associated with heterochromatin to facilitate the role of Hp1 in heterochromatin formation, maintenance, transcriptional repression, or epigenetic inheritance (Eissenberg and Elgin, 2000Go). An interaction between Mcm10 and Hp1 may point to a trend that more members of the pre-RC are involved in heterochromatin formation. Indeed, this process may be a fundamental function of prereplication proteins. The involvement of ORC in establishing silencing at the mating type loci in yeast has been pointed to as an analog to the function of ORC in establishment of heterochromatin in Drosophila (for review, see Bell, 2002Go). In fact, the function of ORC in silencing and heterochromatin formation may be the most conserved aspect of ORC function. Drosophila Orc2, for example, is able to complement the silencing defect of a mutant Orc2 allele in yeast, but it is unable to complement the replication defect (Ehrenhofer-Murray et al., 1995Go). In addition to ORC, Cdc45 and Mcm2 have been implicated in yeast to be involved in chromatin formation (for review, see Gerbi and Bielinsky, 2002Go). The implication that Mcm10 is involved in formation of heterochromatin in Drosophila by virtue of an interaction with both Orc2 and Hp1 raises the tantalizing possibility that these dynamic properties of chromatin may require not only ORC function but also a number of other prereplication proteins as well.

Depletion of Pre-RC Proteins
We demonstrate that key members of the pre-RC and pre-IC are effectively and specifically depleted from KC cells by RNAi. Although deficiencies in DNA replication were not directly tested, replication must still be occurring at a level sufficient to maintain growth rates under long-term depletion of Mcm10 and Orc2. Precedence for this phenomenon has been reported in human HCT116 colon carcinoma cells where 10% of the wild-type level of Orc2 are sufficient to sustain normal chromosomal replication (Dhar et al., 2001Go). Maintenance of DNA content at levels that permit cell viability may be due to these proteins being required in very small amounts combined with the hypothesis that few origins are required to replicate the genome (Campbell and Newlon, 1991Go). Our results suggest that RNAi generates severe hypomorphs for protein depletions and not total depletion.

We have no explanation for the mechanism that selectively retains a complement of chromosomes that ensures viability as a result of reduced DNA replication. Precedence for ploidy effects by depletion of proteins by RNAi in Drosophila SD2 cells has recently been reported for both geminin and Dup (Mihaylov et al., 2002Go). This study reports that depletion of geminin, a negative regulator of DNA replication, resulted in an increase in DNA content. On the other hand, depletion of Dup, a positive regulator of DNA replication, resulted in loss of DNA content. Defects in the growth of these cells were not reported.

We observed that protein levels of certain members of the pre-RC may be coupled. These observations could be due to at least three different factors or combinations of factors. First, depletion of one protein results in transcriptional repression of another either directly or indirectly. Second, some or all of these depletions result in cell cycle defects that have consequences for other proteins, although cell cycle length is unchanged (previous section). Finally, interactions between proteins are required for stability. In other words, proteins are stable in a complex but not individually. An example of this is the coupling of Cdt1 and geminin protein levels observed when geminin is depleted from tissue culture (Mihaylov et al., 2002Go). The same study also demonstrated that depleting cyclin A results in a corresponding decrease in cyclin B protein levels. Another case of association-dependent stabilization is the destruction of Cdc6 when removed from chromatin and association with the pre-RC (Hua and Newport, 1998Go; Findeisen et al., 1999Go).

Replication and Condensation?
This is the first report of a possible role for Mcm10, Mcm2, Mcm5, and Cdc45, respectively, in proper condensation of chromosomes. This study demonstrates the utility of RNAi in tissue culture cells for assaying chromosomal condensation defects. Indeed, it points the way to analysis of other known replication proteins for which mutants do not yet exist with respect to functions in condensation. An interesting point to consider is that the process of chromosome condensation may be more sensitive to the dosage of these proteins than is DNA replication, because cells remain viable over long-term depletion. These observations raise the intriguing possibility that the bulk of these proteins in cells may function in chromosome condensation pathways and not overtly participate in the initiation of DNA replication. Alternatively, the depletion of these proteins may simply reduce the number of initiation sites along the chromosome, resulting in fewer replication foci. This reduction in foci may have direct mechanistic consequences for condensation. A third possibility is that depletion of replication initiation factors in S phase may force cells to enter mitosis prematurely, resulting in aberrant chromosome condensation (Rao and Johnson, 1970Go). Indeed, depletion of Cdt1/Dup protein first shown in S. pombe (Hofmann and Beach, 1994Go) and more recently shown in Drosophila (Whittaker et al., 2000Go) resulted in chromosome condensation without DNA replication and thereby bypassing S phase. We do not believe that the third possibility is a likely explanation because we did not observe a dramatic loss of cell viability or a change in cell cycle length as expected of mitosis without S phase. Determining whether these proteins are directly linked to condensation or are merely linked via DNA replication is a question that remains to be answered.

It is becoming increasingly clear that proteins involved in DNA replication are necessary for establishment of proper chromosomal condensation. There is some debate as to whether the defects observed are due to the specific functions of individual proteins (Loupart et al., 2000Go) or are a general function of compromised DNA replication (Pflumm and Botchan, 2001Go). The addition of Mcm10, Mcm2, Mcm5, and Cdc45 to the repertoire of replication proteins required for proper chromosomal condensation lends support to the hypothesis that DNA replication and condensation are generally linked.

What is the mechanism by which replication is linked to condensation? At the outset, it is intuitive that organization of chromatin would happen in concert with replication. Spatially and temporally separating the processes would seem to be both inefficient and problematic with respect to entanglement of DNA and nuclear organization. A simple mechanism for linkage of replication to condensation has been put forth that suggests that the density of replication initiation along a chromosome and the resulting DNA replication foci has impact, on a primary level, on the lateral condensation of a metaphase chromosome (Hearst et al., 1998Go). This hypothesis fits very well with the "dumbbell" lateral condensation defects observed when replication proteins are depleted both in this study and the one presented by Pflumm et al. (Pflumm and Botchan, 2001Go)

The simple mechanistic model probably has relevance to the linkage of condensation to DNA replication but may not provide a complete picture as to the role of pre-RC proteins in this process. There are several observations that speak to the possibility that the proteins of the pre-RC have roles outside of DNA replication. A comparison of two recent studies in yeast looking at global binding of prereplication complexes and global origin usage reveals that there are 30% less active origins compared with those predicted by binding of pre-RC proteins (Raghuraman et al., 2001Go; Wyrick et al., 2001Go). These observations point to the fact that sites not used for initiation are occupied by members of the pre-RC, leaving open the possibility for some functional role for these assemblies in chromatin condensation.


    CONCLUSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We present evidence for the conservation of Mcm10 function from Drosophila to S. cerevisiae. We show that DmMcm10 interacts with known members of the pre-RC, consistent with a role in the assembly of the pre-RC in Drosophila. Moreover, we show that Mcm10 interacts with Cdc45, suggesting that DmMcm10 may also participate in the transition to the pre-IC. Further evidence for a role of Mcm10 in DNA replication comes out of the observation that depletion of Mcm10 by RNAi, similar to that of Orc2, resulted in a loss of DNA content. We have also shown that Mcm10 is required for proper chromosome condensation. This role may be facilitated by an interaction with Hp1.


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank Terry Orr-Weaver, Julie Claycomb, Steve Bell, Igor Chesnokov, Michael Botchan, Peter W. Lewis, Sue Cotterill, and Mariana Wolfner for generously providing antibodies. We thank Justin Donato, Nancy Douglas, and John Lis for critical reading of the manuscript. We also thank Carol Bayles for help with microscopy. Michael Goldberg was instrumental in helping with the protocol for, and the analysis of, metaphase spreads. Lastly, we thank Jacob Mueller, Byron Williams, and Eric Andrulis for invaluable assistance. This work was supported by National Institutes of Health grant GM-34190 (to B.K.T.) and National Institutes of Health training grant GM-07616 (to T.W.C.).


    Footnotes
 
Abbreviations used: pre-IC, preinitiation complex; pre-RC, prereplication complex; RNAi, RNA interference.

* Corresponding author. E-mail address: bt16{at}cornell.edu.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 CONCLUSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Alani, E., Cao, L., and Kleckner, N. (1987). A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116, 541-545.[Abstract/Free Full Text]

Austin, R.J., Orr-Weaver, T.L., and Bell, S.P. (1999). Drosophila ORC specifically binds to ACE3, an origin of DNA replication control element. Genes Dev. 13, 2639-2649.[Abstract/Free Full Text]

Bell, S.P. (2002). The origin recognition complex: from simple origins to complex functions. Genes Dev. 16, 659-672.[Free Full Text]

Bell, S.P., and Dutta, A. (2002). DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71, 333-374.[CrossRef][Medline]

Blow, J.J., and Laskey, R.A. (1988). A role for the nuclear envelope in controlling DNA replication within the cell cycle. Nature 332, 546-548.[CrossRef][Medline]

Burke, T.W., Cook, J.G., Asano, M., and Nevins, J.R. (2001). Replication factors mcm2 and orc1 interact with the histone acetyltransferase hbo1. J. Biol. Chem. 276, 15397-15408.[Abstract/Free Full Text]

Campbell, J.L., and Newlon, C.S. (1991). Chromosomal DNA replication. In: The Molecular and Cellular Biology of the Yeast Saccharomyces: Genome Dynamics, Protein Synthesis, and Energetics, ed. J.R. Broach, J.R. Pringle, and E.W. Jones, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Chesnokov, I., Remus, D., and Botchan, M. (2001). Functional analysis of mutant and wild-type Drosophila origin recognition complex. Proc. Natl. Acad. Sci. USA 98, 11997-12002.[Abstract/Free Full Text]

Clemens, J.C., Worby, C.A., Simonson-Leff, N., Muda, M., Maehama, T., Hemmings, B.A., and Dixon, J.E. (2000). Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc. Natl. Acad. Sci. USA 97, 6499-6503.[Abstract/Free Full Text]

Dhar, S.K., Yoshida, K., Machida, Y., Khaira, P., Chaudhuri, B., Wohlschlegel, J.A., Leffak, M., Yates, J., and Dutta, A. (2001). Replication from oriP of Epstein-Barr virus requires human ORC and is inhibited by geminin. Cell 106, 287-296.[CrossRef][Medline]

Dobie, K.W., Kennedy, C.D., Velasco, V.M., McGrath, T.L., Weko, J., Patterson, R., and Karpen, G.H. (2001). Identification of chromosome inheritance modifiers in Drosophila melanogaster. Genetics 157, 1623-1637.[Abstract/Free Full Text]

Ehrenhofer-Murray, A.E., Gossen, M., Pak, D.T.S., Botchan, M.R., and Rine, J. (1995). Separation of origin recognition complex functions by cross-species complementation. Science 270, 1671-1674.[Abstract/Free Full Text]

Ehrenhofer-Murray, A.E., Kamakaka, R.T., and Rine, J. (1999). A role for the replication proteins PCNA, RF-C, polymerase e and Cdc45 in transcriptional silencing in Saccharomyces cerevisiae. Genetics 153, 1171-1182.[Abstract/Free Full Text]

Eissenberg, J.C., and Elgin, S.C. (2000). The HP1 protein family: getting a grip on chromatin. Curr. Opin. Genet. Dev. 10, 204-210.[CrossRef][Medline]

Findeisen, M., El-Denary, M., Kapitza, T., Graf, R., and Strausfeld, U. (1999). Cyclin A-dependent kinase activity affects chromatin binding of ORC, Cdc6, and MCM in egg extracts of Xenopus laevis. Eur. J. Biochem. 264, 415-426.[Medline]

Gerbi, S., and Bielinsky, A. (2002). DNA replication and chromatin. Curr. Opin. Genet. Dev. 12, 243-248.[CrossRef][Medline]

Goto, A., Aoki, M., Ichihara, S., and Kitagawa, Y. (2001). {alpha}-, {beta}- or {gamma}-chain-specific RNA interference of laminin assembly in Drosophila Kc167 cells. Biochem. J. 360, 167-172.[Medline]

Hearst, J., Kauffman, L., and McClain, W. (1998). A simple mechanism for the avoidance of entanglement during chromosome replication. Trends Genet. 14, 244-247.[CrossRef][Medline]

Hofmann, J.F., and Beach, D. (1994). cdt1 is an essential target of the Cdc10/Sct1 transcription factor: requirement for DNA replication and inhibition of mitosis. EMBO J. 13, 425-434.[Medline]

Homesley, L., Lei, M., Kawasaki, Y., Sawyer, S., Christensen, T., and Tye, B.K. (2000). Mcm10 and the MCM2–7 complex interact to initiate DNA synthesis and to release replication factors from origins. Genes Dev. 14, 913-926.[Abstract/Free Full Text]

Hua, X.H., and Newport, J. (1998). Identification of a preinitiation step in DNA replication that is independent of origin recognition complex and Cdc6, but dependent on cdk2. J. Cell Biol. 140, 271-281.[Abstract/Free Full Text]

Hutvagner, G., and Zamore, P. (2002). RNAi: nature abhors a double-strand. Curr. Opin. Genet. Dev. 12, 225-232.[CrossRef][Medline]

Izumi, M., Yanagi, K., Mizuno, T., Yokoi, M., Kawasaki, Y., Moon, K.-Y., Hurwitz, J., and Hanaoka, F. (2000). Identification of the human homolog of Saccharomyces cerevisiae Mcm10, a critical component for the initiation of DNA synthesis. Nucleic Acids Res. 28, 4769-4777.[Abstract/Free Full Text]

Izumi, M., Yatagai, F., and Hanaoka, F. (2001). Cell cycle-dependent proteolysis and phosphorylation of human Mcm10. J. Biol. Chem. 276, 48526-48531.[Abstract/Free Full Text]

Kawasaki, Y., Hiraga, S., and Sugino, A. (2000). Interactions between Mcm10p and other replication factors are required for proper initiation and elongation of chromosomal DNA replication in Saccharomyces cerevisiae. Genes Cells 5, 975-989.[Abstract]

Landis, G., Kelley, R., Spradling, A., and Tower, J. (1997). The k43 gene, required for chorion gene amplification and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin recognition complex subunit 2. Proc. Natl. Acad. Sci. USA 94, 3888-3892.[Abstract/Free Full Text]

Lei, M., and Tye, B.K. (2001). Initiating DNA synthesis: from recruiting to activating the MCM complex. J. Cell Sci. 114, 1447-1454.[Abstract]

Loebel, D., Huikeshoven, H., and Cotterill, S. (2000). Localisation of the DmCdc45 DNA replication factor in the mitotic cycle and during chorion gene amplification. Nucleic Acids Res. 28, 3897-3903.[Abstract/Free Full Text]

Loupart, M.L., Krause, S.A., and Heck, M.S. (2000). Aberrant replication timing induces defective chromosome condensation in Drosophila ORC2 mutants. Curr. Biol. 10, 1547[CrossRef][Medline]

Maiorano, D., Moreau, J., and Mechali, M. (2000). XCDT1 is required for the assembly of pre-replicative complexes in Xenopus laevis. Nature 404, 622-625.[CrossRef][Medline]

Merchant, A.M., Kawasaki, Y., Chen, Y., Lei, M., and Tye, B.K. (1997). A lesion in the DNA replication initiation factor Mcm10 induces pausing of elongation forks through chromosomal replication origins in S. cerevisiae. Mol. Cell. Biol. 17, 3261-3271.[Abstract]

Mihaylov, I.S., Kondo, T., Jones, L., Ryzhikov, S., Tanaka, J., Zheng, J., Higa, L.A., Minamino, N., Cooley, L., and Zhang, H. (2002). Control of DNA replication and chromosome ploidy by geminin and cyclin A. Mol. Cell. Biol. 22, 1868-1880.[Abstract/Free Full Text]

Pak, T.S.D., Pflumm, M., Chesnokov, I., Huang, D.W., Kellum, R., Marr, J., Romanowski, P., and Botchan, M.R. (1997). Association of the origin recognition complex with heterochromatin and HP1 in higher eukaryotes. Cell 91, 311-323.[CrossRef][Medline]

Pflumm, M.F., and Botchan, M.R. (2001). Orc mutants arrest in metaphase with abnormally condensed chromosomes. Development 128, 1697-1707.[Abstract]

Raghuraman, M.K., Winzeler, E.A., Collingwood, D., Hunt, S., Wodicka, L., Conway, A., Lockhart, D.J., Davis, R.W., Brewer, B.J., and Fangman, W.L. (2001). Replication dynamics of the yeast genome. Science 294, 115-121.[Abstract/Free Full Text]

Rao, P.N., and Johnson, R.T. (1970). Mammalian cell fusion: studies on the regulation of DNA synthesis and mitosis. Nature 225, 159-164.[CrossRef][Medline]

Solomon, N.A., Wright, M.B., Chang, S., Buckley, A.M., Dumas, L.B., and Gaber, R.F. (1992). Genetic and molecular analysis of DNA43 and DNA52: two new cell-cycle genes in Saccharomyces cerevisiae. Yeast 8, 273-289.[CrossRef][Medline]

Stuurman, N., Sasse, B., and Fisher, P.A. (1996). Intermediate filament protein polymerization: molecular analysis of Drosophila nuclear lamin head-to-tail binding. J. Struct. Biol. 117, 1-15.[CrossRef][Medline]

Tye, B.K. (2000). Insights into DNA replication from the third domain of life. Proc. Natl. Acad. Sci. USA 97, 2399-2401.[Free Full Text]

Whittaker, A.J., Royzman, I., and Orr-Weaver, T.L. (2000). Drosophila double parked: a conserved, essential replication protein that colocalizes with the origin recognition complex and links DNA replication with mitosis and the down-regulation of S phase transcripts. Genes Dev. 14, 1765-1776.[Abstract/Free Full Text]

Wohlschlegel, J.A., Dhar, S.K., Prokhorova, T.A., Dutta, A., and Walter, J.C. (2002). Xenopus Mcm10 binds to origins of DNA replication after Mcm2–7 and stimulates origin binding of Cdc45. Mol. Cell 9, 1-20.[CrossRef][Medline]

Wohlschlegel, J.A., Dwyer, B.T., Dhar, S.K., Cvetic, C., Walter, J.C., and Dutta, A. (2001). Geminin inhibits eukaryotic DNA replication by binding to Cdt1. Science 290, 2309-2312.

Wyrick, J.J., Aparicio, J.G., Chen, T., Barnett, J.D., Jennings, E.G., Young, R.A., Bell, S.P., and Aparicio, O.M. (2001). Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294, 2357-2360.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P. D. Robertson, E. M. Warren, H. Zhang, D. B. Friedman, J. W. Lary, J. L. Cole, A. V. Tutter, J. C. Walter, E. Fanning, and B. F. Eichman
Domain Architecture and Biochemical Characterization of Vertebrate Mcm10
J. Biol. Chem., February 8, 2008; 283(6): 3338 - 3348.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Chattopadhyay and A.-K. Bielinsky
Human Mcm10 Regulates the Catalytic Subunit of DNA Polymerase-{alpha} and Prevents DNA Damage during Replication
Mol. Biol. Cell, October 1, 2007; 18(10): 4085 - 4095.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. M. Lake, K. Teeter, S. L. Page, R. Nielsen, and R. S. Hawley
A Genetic Analysis of the Drosophila mcm5 Gene Defines a Domain Specifically Required for Meiotic Recombination
Genetics, August 1, 2007; 176(4): 2151 - 2163.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. M. Ricke and A.-K. Bielinsky
A Conserved Hsp10-like Domain in Mcm10 Is Required to Stabilize the Catalytic Subunit of DNA Polymerase-{alpha} in Budding Yeast
J. Biol. Chem., July 7, 2006; 281(27): 18414 - 18425.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. E. Moyer, P. W. Lewis, and M. R. Botchan
Isolation of the Cdc45/Mcm2-7/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase
PNAS, July 5, 2006; 103(27): 10236 - 10241.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Das-Bradoo, R. M. Ricke, and A.-K. Bielinsky
Interaction between PCNA and Diubiquitinated Mcm10 Is Essential for Cell Growth in Budding Yeast.
Mol. Cell. Biol., July 1, 2006; 26(13): 4806 - 4817.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. M. Ferree and W. Sullivan
A Genetic Test of the Role of the Maternal Pronucleus in Wolbachia-Induced Cytoplasmic Incompatibility in Drosophila melanogaster
Genetics, June 1, 2006; 173(2): 839 - 847.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H. Long, S. Cameron, L. Yu, and Y. Rao
De Novo GMP Synthesis Is Required for Axon Guidance in Drosophila
Genetics, March 1, 2006; 172(3): 1633 - 1642.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Ueno, M. Itoh, L. Kong, K. Sugihara, M. Asano, and N. Takakura
PSF1 Is Essential for Early Embryogenesis in Mice
Mol. Cell. Biol., December 1, 2005; 25(23): 10528 - 10532.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
I. Liachko and B. K. Tye
Mcm10 Is Required for the Maintenance of Transcriptional Silencing in Saccharomyces cerevisiae
Genetics, October 1, 2005; 171(2): 503 - 515.
[Abstract] [Full Text] [PDF]