![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, Issue 6, 2206-2215, June 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York 14853-2703
Submitted November 4, 2002;
Revised January 20, 2003;
Accepted February 26, 2003
Monitoring Editor: Allan Spradling
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
). Examples of these well-used players in control of DNA
replication are the members of the prereplication complex (pre-RC). The pre-RC
is defined as the set of factors required to license an origin for the
initiation of DNA replication (Blow and
Laskey, 1988). The members of the pre-RC include ORC,
MCM2–7, Cdc6, Cdt1, and Mcm10 (Lei
and Tye, 2001). On activation and recruitment of additional
factors, such as Cdc45, the pre-RC is converted to the preinitiation complex
(pre-IC), which is the complex required for the transition to replication
(Bell and Dutta, 2002;
Wohlschlegel et al.,
2002).
Probably in part due to the evolutionary time that has passed and the
increasing complexity of genomes, some of the functions of these proteins have
been co-opted for use in other pathways. The prime example of this is the ORC
complex whose ability to bind DNA and recruit other factors to DNA has been
used for silencing in Saccharomyces cerevisiae and heterochromatin
formation in Drosophila (Bell,
2002; Gerbi and Bielinsky,
2002). Members of the pre-RC and pre-IC complex, in addition to
ORC, are also emerging as multifunctional proteins. Cdc45 has been shown to be
required for silencing in S. cerevisiae
(Ehrenhofer-Murray et al.,
1999) and Mcm2 interacts with Hbo1, a protein that is implicated
in chromatin remodeling (Burke et
al., 2001). As more and more components of the pre-RC and
pre-IC are implicated in chromatin remodeling, it becomes likely that these
complexes as a whole, and their individual components, may have roles outside
of DNA replication.
Mcm10 was first identified in S. cerevisiae as defective in
S-phase progression (Solomon et
al., 1992) and subsequently was shown to be defective in the
maintenance of minichromosomes (Merchant
et al., 1997). Work on Mcm10 in S. cerevisiae
has revealed that Mcm10 interacts with members of the pre-RC and is required
for efficient initiation of DNA replication. Mutants of Mcm10 exhibit pausing
of replication forks, suggesting a role for Mcm10 in elongation. Chromatin
fractionation experiments show that Mcm10 is constitutively bound to chromatin
(Homesley et al.,
2000; Kawasaki et
al., 2000). Analysis in human has shown that Mcm10 interacts
with Orc2, is phosphorylated, and is degraded by an ubiquitin-dependent
pathway during the cell cycle (Izumi et al.,
2000,
2001). Recent work in
Xenopus demonstrates that Mcm10 is required for replication, is
dependent on Mcm2–7 for association with the origin, and is necessary
for recruitment of Cdc45 (Wohlschlegel
et al., 2002).
In this study, we present evidence that Drosophila Mcm10 is the
true ortholog of S. cerevisiae. Moreover, we show that Mcm10
interacts with members of the pre-RC. We also show that Mcm10 interacts with
Hp1 suggestive of a role for Mcm10 in heterochromatin formation. To
investigate the role of Mcm10 in tissue culture cells, we effectively depleted
Mcm10 by RNA interference (RNAi)
(Hutvagner and Zamore, 2002).
This depletion has consequences for the overall DNA content of the cell and
has dire consequences with respect to chromosome condensation. We also present
evidence that depletion of Cdc45, Mcm2, Mcm5, and Orc2, respectively, from
tissue culture results in aberrant chromosome condensation. These findings
lend credence to the argument that DNA replication and chromosome condensation
are processes that are intimately linked.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
Antibodies/Immunoblots
Rabbit polyclonal anti-Mcm10 was generated against purified 6His::Mcm10 aa
95–776 and affinity purified against 6His::Mcm10 aa 1–776.
Antibodies used were anti-Dock (Clemens
et al., 2000); antiMcm2, anti-Mcm5, and anti-Cdc45
(Loebel et al.,
2000); anti-Dup (Whittaker
et al., 2000); anti-Orc2
(Austin et al., 1999);
anti-Orc1 (Chesnokov et al.,
2001); anti-Hp1 (kind gift from M. Botchan); and anti-Lamin
(Stuurman et al.,
1996). Mcm10, Orc2, Mcm2, Mcm5, and Cdc45 antibodies were used at
1:5000. Lamin, Dup, Orc1, Hp1, and Dock antibodies were used at 1:10,000.
Embryo extracts were prepared in 1x phosphate-buffered saline (PBS) +
0.1% Trition X-100 + 1 mM phenylmethylsulfonyl fluoride + protease inhibitors
(catalog no. 1697498; Roche Diagnostics, Indianapolis, IN) + DNase, and RNase.
Buffer + embryos were frozen in liquid nitrogen then lysed by blending in a
coffee grinder with dry ice. Lysate was spun at high speed for 20 min at
4°C. For KC cells, 1 ml of culture was spun down and washed two times in 1
ml of PBS, and 50 µl of radioimmunoprecipitation assay buffer was added and
vortexed for 20 s. Three times loading buffer was added to extracts before
PAGE analysis. All polyacrylamide gels were 8% except for those probed for
Hp1, which were 12%. All blocking and antibody incubations were in 5% nonfat
milk.
RNAi
All RNAi procedures were carried out in six-well plates with culture
volumes of 2 ml at a starting concentration of 1 x 106
cells/ml. Specific double-stranded RNA (dsRNA) was added to a final
concentration of 10 nM. RNA was generated using Megascript (catalog no. 1334;
Ambion, Austin, TX) and protocols therein. Primers for generation of DNA
templates all contained the T7 promoter at the 5' ends
GAATTAATACGACTCACTATAGGGAGA. All amplifications were templated from entry
vectors described above. Sequence-specific portions of primer pairs used in
this study listed 5'-3' are as follows: CDC45,
TCCCGACTGACGAACAAAACGAA and AAAAGAAAGCGAGCCAACAGTCCA; MCM2,
AAGGCGCCATGGATGCTACTACAC and TGCTCTCCATTTTCCCCACTTACG; MCM5,
AGTGCCCGCTGGACCCCTTCT and GGCTCCACCCTCCACGACAA; MCM10, TCGAGAGGAGAGCGGGAAGC
and TGGGCGTTAAACTGGCATCAAAG; ORC2, GGTTGGGAATGCAGTGGAATCTCA and
TACTGGGCGTTTTGGGCTCATCAT; and DOCK (Clemens
et al., 2000).
Tissue Culture/Fluorescence-activated Cell Sorting (FACS)
Analysis
KC cells were propagated in HyQ-CCM 3 serum-free media (catalog no.
SH30065.01; Hyclone Laboratories, Logan, UT) supplemented with 100 U/ml
penicillin, and 100 U/ml streptomycin in 75-cm2 flasks or six-well
culture dishes. Stable cell line was generated as per Current Protocols Online
for Preparation of Stable Polyclonal S2 Cell Lines by cotransfection of pHygo
with Mcm10::GFP vector by using CellFECTIN (Invitrogen Life Technologies,
Carlsbad, CA) and protocol therein. Induction of Mcm10::GFP was achieved with
1.7 mM CuSO4 for 8 h. Cells were prepared for FACS analysis as in
Current Protocols Online for DNA Content Analysis of Fixed Cells with
Propidium Iodide. Cells were analyzed on FACSCalibur system.
Complementation
Complementation analysis was carried out in strain DBY2063 in which
MCM10 was replaced by the HisG URA3 cassette
(Alani et al., 1987)
and kept alive by pRS316URA3 containing ScMCM10. This strain was a gift from
N. Douglas (Cornell University, Ithaca, NY).
Immunoprecipitation
Embryo extracts were prepared as described above. KC cells were harvested,
washed two times in PBS, and extracted in the same manner as described for
embryos. The resulting extract contained approximately 5 ml of 5 x
106 cells/ml/0.5 ml of lysate and was treated with DNase.
Antibodies were used at 1:500 dilutions for all immunoprecipitations in 0.5 ml
of extract. A slurry (25 µl) of magnetic beads coated in Protein A was used
for all but anti-GFP where protein G beads were used (catalog nos. 100.02 and
100.04; Dynal Biotech, Lake Success, NY). Antibodies were incubated with
extract for 2 h at 4°C after which beads were added and incubated for an
additional 2 h. Beads were washed extensively in 1x PBS, 0.1% Triton
X-100. Protein was eluted by addition of loading buffer.
Metaphase Spreads
Two milliliters of KC cells at 3 x 106 cells/ml in
six-well culture dishes were incubated with 5 µM colchicine for 1.5 h.
Cells were spun down and washed two times in 1 ml of room temperature PBS
followed by incubation in 1 ml of 0.5% sodium citrate for 10 min at room
temperature. Cells were gently spun down and fixed in 1 ml of ice-cold 3:1
methanol/acetic acid for 5 min followed by rinse in another 1 ml of fixative.
Cells were resuspended in a small volume of fixative and dropped from 0.5 m
onto cleaned microscope slides and allowed to air dry completely. Preparations
were mounted in VectaShield with 0.5 µg/ml Hoechst and viewed within 12
h.
Microscopy
Metaphase spreads fluorescence microscopy was performed on a Nikon scope
with 100x objective and appropriate filters and captured to 8-bit images
by charge-couple device camera. All images were uniformly adjusted for
brightness and contrast using windows Adobe Photoshop 5.5.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
). The
study used the predicted Drosophila Mcm10 to identify homologous
human ESTs. The Drosophila Mcm10, known as CG9241, maps to the 2nd
chromosome and cytologically to 39B1 (Flybase, 1999). We took advantage of
known EST sequences to design primers to amplify MCM10 from cDNA isolated from
Drosophila ovary tissue. Sequencing of the resulting clone revealed
that Drosophila Mcm10 is a 776 amino acid protein with a predicted
molecular mass of 86.5 kDa. Overall, it shares similarity to Human (32.1%),
Xenopus (30.5%), Arabidopsis thaliana (29.7%),
Caenorhabditis elegans (26.2%), S. cerevisiae (24.1%), and
Schizosaccharomyces pombe (23.1%). Alignments of the conserved
regions of human, Xenopus, Drosophila, and S. cerevisiae
reveal that Drosophila Mcm10 shares a conserved central core and a
signature zinc finger motif (Figure
1A). In addition, there is a high degree of regional conservation
between Mcm10 of Drosophila and higher eukaryotes that points to the
fact that studies in Drosophila will have significant bearing on
those in Xenopus and human.
|
Drosophila Mcm10 Complements ScMcm10
To assess whether Drosophila Mcm10 could functionally complement a
S. cerevisiae null mutation, a Leu+ plasmid containing
Drosophila MCM10 driven by the endogenous yeast MCM10
promoter was transformed into a strain null for the chromosomal copy of MCM10
and kept alive by a Ura+ plasmid containing ScMCM10. We then determined
whether the strain could be rescued from 5-fluoroorotic acid (5-FOA) toxicity
by the Leu+ plasmid containing Drosophila MCM10. FOA toxicity allows
the positive selection of cells that can no longer synthesize uracil (Ura-) or
have lost pRS316-URA3 ScMCM10. The results show that Drosophila Mcm10
is able to complement the null mutation for growth
(Figure 1B). In addition, a
fragment of Drosophila Mcm10 representing amino acids 96–776
was also able to complement ScMcm10 (our unpublished data). These results are
unexpected given the low overall sequence similarity between the homologues
and the fact that HsMcm10 does not complement mutants
mcm10-1 and mcm10-43 in S. cerevisiae or Cdc23-M36
in S. pombe (Izumi et
al., 2000). The fact that Drosophila Mcm10 can
complement S. cerevisiae Mcm10 supports the conclusion that
Drosophila Mcm10 is a true ortholog of S. cerevisiae, thus
functional studies are likely to have significance for both species.
Mcm10 Interacts with Members of the Pre-RC
Mcm10 has been shown in yeast to interact with all members of the Mcm2-7
family except for the notable exception of Mcm5
(Merchant et al.,
1997). In addition, human Mcm10 interacts with Orc2
(Izumi et al., 2000).
To investigate which members of the pre-RC interact with Mcm10 in
Drosophila coimmunoprecipitation experiments were performed. A stable
KC cell line containing Mcm10::GFP was induced or not induced with
Cu2+ and cells were harvested, processed, and immunoprecipitated
with anti-GFP. Interactions with Mcm10-GFP are detected with Mcm2, Orc2, and
the endogenous Mcm10, consistent with the two-hybrid studies
(Figure 2A; our unpublished
data). Also probed and shown positive for interactions are Dup, Cdc45, and Hp1
(Figure 2A). No interaction is
detected with Mcm5, and Orc1. It could be argued that ectopic overexpression
of Mcm10 could result in atypical interactions. Furthermore, positives could
result from interaction with GFP. To address these concerns,
immunoprecipitations were performed using antibodies to Cdc45, Dup, Mcm2,
Orc2, Mcm5, Orc1, and Hp1, respectively, in embryo cell extracts. Similar to
the coimmunoprecipitation results with Mcm10-GFP, in all but Mcm5 and Orc1,
Mcm10 is detected (Figure 2B).
The specificity of antibodies used was verified by Western blots of KC cell
extracts (Figure 2C). Each
antibody reacted with only the corresponding cognate protein antigen to yield
a single reacting species with the exception of Mcm10-specific antibodies,
which reacted with both the Mcm10::GFP fusion protein and the endogenous
Mcm10p.
|
Mcm10 Is Depleted by RNAi
In the absence of a known Drosophila mutant for Mcm10, we used
RNAi to determine the function of Mcm10 in Drosophila. RNAi involves
addition of dsRNA specific to the mRNA sequence of the target gene. RNAi acts
to deplete the mRNA of the target species. The result is that the protein of
interest is specifically depleted from cells at a rate corresponding to the
inherent stability of the protein
(Hutvagner and Zamore, 2002).
RNAi has been demonstrated as an effective tool in Drosophila tissue
culture for determining gene function
(Clemens et al., 2000;
Goto et al., 2001).
In this analysis, KC cells at low densities were inoculated with specific
dsRNA and collected over a 5-d period for immunoblot analysis. Over the course
of the experiment, cells grew from low to high densities. Low densities
corresponded to cell cycle time of 
22 h, and the apparent cell cycle
lengthens to 40+ h at high density as cells begin to exit into G0 (see next
section; Figure 4A). Mcm10,
Cdc45, Mcm2, Mcm5, and Orc2 are all efficiently depleted from KC cells upon
addition of specific dsRNA (Figure 3,
A–E). This depletion is not a general effect, because
treatment with dsRNA specific to Dock (a protein with no known connection to
DNA replication) is identical to untreated
(Figure 3F).
|
|
Mcm10 and Ccd45 are particularly sensitive to RNAi treatments because both
are depleted by 48 h and are undetectable by Western blot
(Figure 3, A and B, compared with
F). The rapid depletion is indicative of either inherent
instability of these proteins or regulation via proteolysis. Mcm2 and Mcm5
show depletion of the bulk of the protein by 48 h but both remain at low
levels (Figure 3, C and D, compared with
F). In contrast, Orc2 is slowly depleted over the time course
compared with the others (Figure 3E
compared with F). This observation is supported by the fact that
null mutants for Orc2 in Drosophila persist until third instar,
presumably due to the stability of maternal deposits
(Landis et al.,
1997).
Several interesting observations are apparent from these experiments.
First, both Mcm10 and Cdc45 exhibit sensitivity to exit into G0 and/or
increasing cell densities as shown by the fact that both are reduced in the
nonspecific treatment (Figure
3F). This is in contrast to Mcm2, Mcm5, and Orc2, which all show
increases correlating with increased cell densities and are seen to accumulate
as cells exit into G0 and/or increase in density as measured over this time
course (Figure 3F). These
observations suggest that overall stability of Mcm10 and Cdc45 may be
regulated as a function of the cell cycle, regulated in relation to cell
densities, or a combination of both. On the other hand, overall stability of
Mcm2, Mcm5, and Orc2 does not seem to be regulated with respect to the cell
cycle and/or increased cell densities
(Figure 3F). The relatively
short-lived Drosophila Mcm10 is consistent with observations reported
for the human Mcm10. HsMcm10 protein levels are regulated by both
phosphorylation- and ubiquitin-dependent proteolysis during late M and early
G1 phase (Izumi et al.,
2001). In contrast, S. cerevisiae Mcm10 has been shown to
be present at constant levels throughout the cell cycle
(Homesley et al.,
2000).
Cell Cycle Length Is Unaffected by Depletion of Mcm10
At the outset, one would predict that depletion of proteins required for
initiation of DNA replication would have dire consequences for cell growth. We
assayed cell growth of KC cells treated with dsRNA specific to Mcm10, Orc2,
and Dock compared with untreated. However, over the course of 6 d the growth
of cells depleted of Orc2 and Mcm10 seemed unaffected. No significant
deviation was noted from the Dock control or the untreated cells
(Figure 4A). One could argue
that because of the short time assayed and the fact that apparent cell
division slows as cell density increases that one would not be able to detect
a significant decrease in growth. To address this, we performed a more
rigorous test. We diluted cells every 3 d to keep them at densities that allow
logarithmic growth rate. Concurrently, cells were inoculated with specific
dsRNA when diluted to ensure that translation of the specific genes did not
recover from the initial RNAi treatment. Cell divisions were quantified and
cumulative cell divisions calculated over an 18-d period. Cells well past
depletion of any detectable Orc2 or Mcm10 divided at wild-type rates
(Figure 4B). The same
phenomenon was observed for depletion of Mcm2, Mcm5, and Cdc45, respectively
(our unpublished data).
The fact that long-term depletion of Orc2 to <10% had no effect on cell
division rates demanded further investigation into how Orc2 depletion was
tolerated. Given that KC cells are aneuploidy (see below;
Figure 6, A–F), it seems
reasonable that these cells could tolerate some degree of chromosome loss.
Depletion of Orc2 that is involved in initiation of DNA replication and
depletion of Mcm10 that has been shown in yeast to be required for initiation
of DNA replication (Merchant et
al., 1997) may have consequences for the DNA content of KC
cells.
|
To investigate possible DNA content effects in Drosophila KC cells depleted of Orc2, Mcm10 (both positive regulators of DNA replication), and Dock, respectively, were analyzed by FACS. Cells were inoculated with specific dsRNA and maintained in the continual presence of dsRNA and harvested after 10 cell cycles. FACS analysis indicates that both Orc2-depleted and Mcm10-depleted cells show a loss of DNA content compared with Dock-depleted and untreated controls (Fig. 4C). This suggests that depletion of Orc2 and Mcm10 both have consequences on the ability of cells to maintain DNA content that may result from decreases in the efficiency of DNA replication or chromosome stability.
Mcm10 Is Sensitive to Depletion of Mcm2 and Orc2
RNAi is specific to the target protein. However, because depletion of a
particular protein does not occur in a vacuum but rather in a network of
interactions, we wanted to examine Mcm10 stability in cells depleted of other
proteins. KC cells were diluted in the presence of specific dsRNA for 10
cell cycles. Cells were harvested, lysed, and whole cell extracts were loaded
onto SDS-PAGE gels. Blots were then probed for Mcm10, Cdc45, Mcm2, Mcm5, Orc2,
Dock, and lamin, respectively (Fig.
5). Total Mcm10 protein levels are reduced in KC cells depleted of
Mcm2, Orc2, and to a lesser extent Mcm5. Cdc45 levels are reduced when Mcm10,
Mcm2, and Mcm5 are depleted. Mcm2 levels are slightly reduced when Orc2 is
depleted. Last, Orc2 levels are relatively unchanged in all but the specific
treatment.
|
Depletion of Mcm10 and Other Replication Proteins Results in Aberrant
Chromosome Condensation
In Drosophila, there is growing evidence that establishment of
proper chromosome condensation is linked to either DNA replication or specific
components of the pre-RC. Mutations in Orc2, Orc5, Mcm4, PCNA, and Rfc4 have
all been shown to arrest with an elevated percentage of metaphase figures and
demonstrate chromosome condensation defects
(Loupart et al.,
2000; Dobie et al.,
2001; Pflumm and Botchan,
2001). Our ability to deplete members of the pre-RC by RNAi
prompted us to investigate whether similar defects could be observed in KC
cells. Furthermore, we were interested in finding out whether depletion of
Mcm10 and Cdc45, both components of the pre-IC, may have similar effects on
chromosome condensation. KC cells were again depleted >10 cell cycles of
Mcm10, Cdc45, Mcm2, Mcm5, and Orc2, respectively. Cells were then treated with
colchicine to enrich for metaphase figures, stained, and visualized. In all
but the RNAi treatment for Dock and in untreated, defects are observed
(Figure 6, A–G). Chromosomal defects observed in depletions of Mcm10
(Figure 6C) and Cdc45
(Figure 6D) were classified
into three categories corresponding to increases in the severity of lateral
condensation defects, with I corresponding to the least severe and III the
most severe. In addition to lateral condensation defects, chromosomes of cells
depleted of Mcm2, Mcm5, and Orc2 seemed fragmented and were categorized with
respect to increasing fragmentation, with I' being the least and
III' being the most severe.
Depletion of Mcm10 and Cdc45, respectively, results in strikingly similar defects in chromosome morphology (Figure 6, C and D). The condensation defects apparent in both depletions consist of similar "dumbbell" shaped chromosomes. Sister chromatid separation (see arrowheads) is observed in both treatments with a higher frequency observed in cells depleted of Cdc45. Chromosome fragmentation in Mcm10 and Cdc45 depletions is observed at levels no higher than that of wild type and is likely a consequence of specimen preparation. The fact that these defects are so similar combined with the findings that these two proteins have been shown to interact supports the supposition that these two proteins function in concert in the same pathway.
Depletion of Mcm2, Mcm5, and Orc2 results in a high degree of fragmentation in addition to lateral condensation defects suggestive of incomplete DNA synthesis and subsequent unchecked chromosome separation (Figure 6, E–G). Mcm2 depletion demonstrates the most severe defect with no wild-type figures found and an overwhelming percentage in class III', the most severe class. Sister chromatid separation is noted in all three treatments but is more prevalent in Mcm2-depleted cells. The small discrepancies between Mcm2 and Mcm5 depletions with respect to severity may represent merely different stability levels of the protein as Mcm2 is depleted more rapidly and thoroughly by RNAi.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
) and is required for the pre-IC transition
(Homesley et al.,
2000; Wohlschlegel et
al., 2002). We report that Drosophila Mcm10
biochemically interacts with components of the pre-RC, including Mcm2, Orc2,
and Dup, respectively, and with itself. These interactions further the
argument that Mcm10 is present in the pre-RC before the transition to the
pre-IC and that interaction of Mcm10 with its various partners may be mediated
by a Mcm10 multimer (Lei and Tye,
2001).
We present the first evidence for an interaction between Mcm10 and Dup, the
Drosophila homolog of Cdt1. This interaction is of particular
interest in light of the observation that Cdt1 is required for loading of the
MCM complex (Maiorano et al.,
2000) and is a target for geminin regulation
(Wohlschlegel et al.,
2001). These and other studies suggest that Cdt1 interacts with
the ORC and MCM complexes. In this context, Mcm10 may be interacting directly
with Dup or indirectly through ORC or the MCMs to facilitate steps in pre-RC
assembly.
Mcm10 interaction with Cdc45 has been implied previously in
Xenopus where it has been shown that Cdc45 requires Mcm10 for origin
binding (Wohlschlegel et al.,
2002). In addition, it has been shown that S. cerevisiae
Mcm10 genetically interacts with Cdc45
(Homesley et al.,
2000). The experiments presented herein extend the interaction
between Cdc45 and Mcm10 to Drosophila and support the hypothesis that
stabilization of Cdc45 binding to origins may occur via a direct or indirect
interaction with Mcm10.
Mcm10 and Hp1
Heterochromatin protein 1 (Hp1) has been shown to interact with members of
the ORC complex (Pak et al.,
1997). Interaction with Mcm10 suggests that, like Orc2, Mcm10 may
be associated with heterochromatin to facilitate the role of Hp1 in
heterochromatin formation, maintenance, transcriptional repression, or
epigenetic inheritance (Eissenberg and
Elgin, 2000). An interaction between Mcm10 and Hp1 may point to a
trend that more members of the pre-RC are involved in heterochromatin
formation. Indeed, this process may be a fundamental function of
prereplication proteins. The involvement of ORC in establishing silencing at
the mating type loci in yeast has been pointed to as an analog to the function
of ORC in establishment of heterochromatin in Drosophila (for review,
see Bell, 2002). In fact, the
function of ORC in silencing and heterochromatin formation may be the most
conserved aspect of ORC function. Drosophila Orc2, for example, is
able to complement the silencing defect of a mutant Orc2 allele in yeast, but
it is unable to complement the replication defect
(Ehrenhofer-Murray et al.,
1995). In addition to ORC, Cdc45 and Mcm2 have been implicated in
yeast to be involved in chromatin formation (for review, see
Gerbi and Bielinsky, 2002).
The implication that Mcm10 is involved in formation of heterochromatin in
Drosophila by virtue of an interaction with both Orc2 and Hp1 raises
the tantalizing possibility that these dynamic properties of chromatin may
require not only ORC function but also a number of other prereplication
proteins as well.
Depletion of Pre-RC Proteins
We demonstrate that key members of the pre-RC and pre-IC are effectively
and specifically depleted from KC cells by RNAi. Although deficiencies in DNA
replication were not directly tested, replication must still be occurring at a
level sufficient to maintain growth rates under long-term depletion of Mcm10
and Orc2. Precedence for this phenomenon has been reported in human HCT116
colon carcinoma cells where 10% of the wild-type level of Orc2 are sufficient
to sustain normal chromosomal replication
(Dhar et al., 2001).
Maintenance of DNA content at levels that permit cell viability may be due to
these proteins being required in very small amounts combined with the
hypothesis that few origins are required to replicate the genome
(Campbell and Newlon, 1991).
Our results suggest that RNAi generates severe hypomorphs for protein
depletions and not total depletion.
We have no explanation for the mechanism that selectively retains a
complement of chromosomes that ensures viability as a result of reduced DNA
replication. Precedence for ploidy effects by depletion of proteins by RNAi in
Drosophila SD2 cells has recently been reported for both geminin and
Dup (Mihaylov et al.,
2002). This study reports that depletion of geminin, a negative
regulator of DNA replication, resulted in an increase in DNA content. On the
other hand, depletion of Dup, a positive regulator of DNA replication,
resulted in loss of DNA content. Defects in the growth of these cells were not
reported.
We observed that protein levels of certain members of the pre-RC may be
coupled. These observations could be due to at least three different factors
or combinations of factors. First, depletion of one protein results in
transcriptional repression of another either directly or indirectly. Second,
some or all of these depletions result in cell cycle defects that have
consequences for other proteins, although cell cycle length is unchanged
(previous section). Finally, interactions between proteins are required for
stability. In other words, proteins are stable in a complex but not
individually. An example of this is the coupling of Cdt1 and geminin protein
levels observed when geminin is depleted from tissue culture
(Mihaylov et al.,
2002). The same study also demonstrated that depleting cyclin A
results in a corresponding decrease in cyclin B protein levels. Another case
of association-dependent stabilization is the destruction of Cdc6 when removed
from chromatin and association with the pre-RC
(Hua and Newport, 1998;
Findeisen et al.,
1999).
Replication and Condensation?
This is the first report of a possible role for Mcm10, Mcm2, Mcm5, and
Cdc45, respectively, in proper condensation of chromosomes. This study
demonstrates the utility of RNAi in tissue culture cells for assaying
chromosomal condensation defects. Indeed, it points the way to analysis of
other known replication proteins for which mutants do not yet exist with
respect to functions in condensation. An interesting point to consider is that
the process of chromosome condensation may be more sensitive to the dosage of
these proteins than is DNA replication, because cells remain viable over
long-term depletion. These observations raise the intriguing possibility that
the bulk of these proteins in cells may function in chromosome condensation
pathways and not overtly participate in the initiation of DNA replication.
Alternatively, the depletion of these proteins may simply reduce the number of
initiation sites along the chromosome, resulting in fewer replication foci.
This reduction in foci may have direct mechanistic consequences for
condensation. A third possibility is that depletion of replication initiation
factors in S phase may force cells to enter mitosis prematurely, resulting in
aberrant chromosome condensation (Rao and
Johnson, 1970). Indeed, depletion of Cdt1/Dup protein first shown
in S. pombe (Hofmann and Beach,
1994) and more recently shown in Drosophila
(Whittaker et al.,
2000) resulted in chromosome condensation without DNA replication
and thereby bypassing S phase. We do not believe that the third possibility is
a likely explanation because we did not observe a dramatic loss of cell
viability or a change in cell cycle length as expected of mitosis without S
phase. Determining whether these proteins are directly linked to condensation
or are merely linked via DNA replication is a question that remains to be
answered.
It is becoming increasingly clear that proteins involved in DNA replication
are necessary for establishment of proper chromosomal condensation. There is
some debate as to whether the defects observed are due to the specific
functions of individual proteins (Loupart
et al., 2000) or are a general function of compromised
DNA replication (Pflumm and Botchan,
2001). The addition of Mcm10, Mcm2, Mcm5, and Cdc45 to the
repertoire of replication proteins required for proper chromosomal
condensation lends support to the hypothesis that DNA replication and
condensation are generally linked.
What is the mechanism by which replication is linked to condensation? At
the outset, it is intuitive that organization of chromatin would happen in
concert with replication. Spatially and temporally separating the processes
would seem to be both inefficient and problematic with respect to entanglement
of DNA and nuclear organization. A simple mechanism for linkage of replication
to condensation has been put forth that suggests that the density of
replication initiation along a chromosome and the resulting DNA replication
foci has impact, on a primary level, on the lateral condensation of a
metaphase chromosome (Hearst et
al., 1998). This hypothesis fits very well with the
"dumbbell" lateral condensation defects observed when replication
proteins are depleted both in this study and the one presented by Pflumm
et al. (Pflumm and Botchan,
2001)
The simple mechanistic model probably has relevance to the linkage of
condensation to DNA replication but may not provide a complete picture as to
the role of pre-RC proteins in this process. There are several observations
that speak to the possibility that the proteins of the pre-RC have roles
outside of DNA replication. A comparison of two recent studies in yeast
looking at global binding of prereplication complexes and global origin usage
reveals that there are 30% less active origins compared with those predicted
by binding of pre-RC proteins (Raghuraman
et al., 2001; Wyrick
et al., 2001). These observations point to the fact that
sites not used for initiation are occupied by members of the pre-RC, leaving
open the possibility for some functional role for these assemblies in
chromatin condensation.
|
CONCLUSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
Footnotes |
|---|
* Corresponding author. E-mail address: bt16{at}cornell.edu.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONACKNOWLEDGMENTSREFERENCES |
|---|
Austin, R.J., Orr-Weaver, T.L., and Bell, S.P. (1999).
Drosophila ORC specifically binds to ACE3, an origin of DNA replication
control element. Genes Dev. 13,
2639-2649.
Bell, S.P. (2002). The origin recognition complex:
from simple origins to complex functions. Genes Dev.
16,
659-672.
Bell, S.P., and Dutta, A. (2002). DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71, 333-374.[CrossRef][Medline]
Blow, J.J., and Laskey, R.A. (1988). A role for the nuclear envelope in controlling DNA replication within the cell cycle. Nature 332, 546-548.[CrossRef][Medline]
Burke, T.W., Cook, J.G., Asano, M., and Nevins, J.R.
(2001). Replication factors mcm2 and orc1 interact with the
histone acetyltransferase hbo1. J. Biol. Chem.
276,
15397-15408.
Campbell, J.L., and Newlon, C.S. (1991). Chromosomal DNA replication. In: The Molecular and Cellular Biology of the Yeast Saccharomyces: Genome Dynamics, Protein Synthesis, and Energetics, ed. J.R. Broach, J.R. Pringle, and E.W. Jones, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Chesnokov, I., Remus, D., and Botchan, M. (2001).
Functional analysis of mutant and wild-type Drosophila origin
recognition complex. Proc. Natl. Acad. Sci. USA
98,
11997-12002.
Clemens, J.C., Worby, C.A., Simonson-Leff, N., Muda, M., Maehama,
T., Hemmings, B.A., and Dixon, J.E. (2000). Use of
double-stranded RNA interference in Drosophila cell lines to dissect signal
transduction pathways. Proc. Natl. Acad. Sci. USA
97,
6499-6503.
Dhar, S.K., Yoshida, K., Machida, Y., Khaira, P., Chaudhuri, B., Wohlschlegel, J.A., Leffak, M., Yates, J., and Dutta, A. (2001). Replication from oriP of Epstein-Barr virus requires human ORC and is inhibited by geminin. Cell 106, 287-296.[CrossRef][Medline]
Dobie, K.W., Kennedy, C.D., Velasco, V.M., McGrath, T.L., Weko, J.,
Patterson, R., and Karpen, G.H. (2001). Identification of
chromosome inheritance modifiers in Drosophila melanogaster.
Genetics 157,
1623-1637.
Ehrenhofer-Murray, A.E., Gossen, M., Pak, D.T.S., Botchan, M.R.,
and Rine, J. (1995). Separation of origin recognition complex
functions by cross-species complementation. Science
270,
1671-1674.
Ehrenhofer-Murray, A.E., Kamakaka, R.T., and Rine, J.
(1999). A role for the replication proteins PCNA, RF-C,
polymerase e and Cdc45 in transcriptional silencing in Saccharomyces
cerevisiae. Genetics 153,
1171-1182.
Eissenberg, J.C., and Elgin, S.C. (2000). The HP1 protein family: getting a grip on chromatin. Curr. Opin. Genet. Dev. 10, 204-210.[CrossRef][Medline]
Findeisen, M., El-Denary, M., Kapitza, T., Graf, R., and Strausfeld, U. (1999). Cyclin A-dependent kinase activity affects chromatin binding of ORC, Cdc6, and MCM in egg extracts of Xenopus laevis. Eur. J. Biochem. 264, 415-426.[Medline]
Gerbi, S., and Bielinsky, A. (2002). DNA replication and chromatin. Curr. Opin. Genet. Dev. 12, 243-248.[CrossRef][Medline]
Goto, A., Aoki, M., Ichihara, S., and Kitagawa, Y.
(2001). 
-, 
- or 
-chain-specific RNA
interference of laminin assembly in Drosophila Kc167 cells.
Biochem. J. 360,
167-172.[Medline]
Hearst, J., Kauffman, L., and McClain, W. (1998). A simple mechanism for the avoidance of entanglement during chromosome replication. Trends Genet. 14, 244-247.[CrossRef][Medline]
Hofmann, J.F., and Beach, D. (1994). cdt1 is an essential target of the Cdc10/Sct1 transcription factor: requirement for DNA replication and inhibition of mitosis. EMBO J. 13, 425-434.[Medline]
Homesley, L., Lei, M., Kawasaki, Y., Sawyer, S., Christensen, T.,
and Tye, B.K. (2000). Mcm10 and the MCM2–7 complex interact
to initiate DNA synthesis and to release replication factors from origins.
Genes Dev. 14,
913-926.
Hua, X.H., and Newport, J. (1998). Identification of a
preinitiation step in DNA replication that is independent of origin
recognition complex and Cdc6, but dependent on cdk2. J. Cell
Biol. 140,
271-281.
Hutvagner, G., and Zamore, P. (2002). RNAi: nature abhors a double-strand. Curr. Opin. Genet. Dev. 12, 225-232.[CrossRef][Medline]
Izumi, M., Yanagi, K., Mizuno, T., Yokoi, M., Kawasaki, Y., Moon,
K.-Y., Hurwitz, J., and Hanaoka, F. (2000). Identification of the
human homolog of Saccharomyces cerevisiae Mcm10, a critical component
for the initiation of DNA synthesis. Nucleic Acids Res.
28,
4769-4777.
Izumi, M., Yatagai, F., and Hanaoka, F. (2001). Cell
cycle-dependent proteolysis and phosphorylation of human Mcm10. J.
Biol. Chem. 276,
48526-48531.
Kawasaki, Y., Hiraga, S., and Sugino, A. (2000). Interactions between Mcm10p and other replication factors are required for proper initiation and elongation of chromosomal DNA replication in Saccharomyces cerevisiae. Genes Cells 5, 975-989.[Abstract]
Landis, G., Kelley, R., Spradling, A., and Tower, J.
(1997). The k43 gene, required for chorion gene amplification and
diploid cell chromosome replication, encodes the Drosophila homolog of yeast
origin recognition complex subunit 2. Proc. Natl. Acad. Sci.
USA 94,
3888-3892.
Lei, M., and Tye, B.K. (2001). Initiating DNA synthesis: from recruiting to activating the MCM complex. J. Cell Sci. 114, 1447-1454.[Abstract]
Loebel, D., Huikeshoven, H., and Cotterill, S. (2000).
Localisation of the DmCdc45 DNA replication factor in the mitotic cycle and
during chorion gene amplification. Nucleic Acids Res.
28,
3897-3903.
Loupart, M.L., Krause, S.A., and Heck, M.S. (2000). Aberrant replication timing induces defective chromosome condensation in Drosophila ORC2 mutants. Curr. Biol. 10, 1547[CrossRef][Medline]
Maiorano, D., Moreau, J., and Mechali, M. (2000). XCDT1 is required for the assembly of pre-replicative complexes in Xenopus laevis. Nature 404, 622-625.[CrossRef][Medline]
Merchant, A.M., Kawasaki, Y., Chen, Y., Lei, M., and Tye, B.K. (1997). A lesion in the DNA replication initiation factor Mcm10 induces pausing of elongation forks through chromosomal replication origins in S. cerevisiae. Mol. Cell. Biol. 17, 3261-3271.[Abstract]
Mihaylov, I.S., Kondo, T., Jones, L., Ryzhikov, S., Tanaka, J.,
Zheng, J., Higa, L.A., Minamino, N., Cooley, L., and Zhang, H.
(2002). Control of DNA replication and chromosome ploidy by
geminin and cyclin A. Mol. Cell. Biol.
22,
1868-1880.
Pak, T.S.D., Pflumm, M., Chesnokov, I., Huang, D.W., Kellum, R., Marr, J., Romanowski, P., and Botchan, M.R. (1997). Association of the origin recognition complex with heterochromatin and HP1 in higher eukaryotes. Cell 91, 311-323.[CrossRef][Medline]
Pflumm, M.F., and Botchan, M.R. (2001). Orc mutants arrest in metaphase with abnormally condensed chromosomes. Development 128, 1697-1707.[Abstract]
Raghuraman, M.K., Winzeler, E.A., Collingwood, D., Hunt, S.,
Wodicka, L., Conway, A., Lockhart, D.J., Davis, R.W., Brewer, B.J., and
Fangman, W.L. (2001). Replication dynamics of the yeast genome.
Science 294,
115-121.
Rao, P.N., and Johnson, R.T. (1970). Mammalian cell fusion: studies on the regulation of DNA synthesis and mitosis. Nature 225, 159-164.[CrossRef][Medline]
Solomon, N.A., Wright, M.B., Chang, S., Buckley, A.M., Dumas, L.B., and Gaber, R.F. (1992). Genetic and molecular analysis of DNA43 and DNA52: two new cell-cycle genes in Saccharomyces cerevisiae. Yeast 8, 273-289.[CrossRef][Medline]
Stuurman, N., Sasse, B., and Fisher, P.A. (1996). Intermediate filament protein polymerization: molecular analysis of Drosophila nuclear lamin head-to-tail binding. J. Struct. Biol. 117, 1-15.[CrossRef][Medline]
Tye, B.K. (2000). Insights into DNA replication from
the third domain of life. Proc. Natl. Acad. Sci. USA
97,
2399-2401.
Whittaker, A.J., Royzman, I., and Orr-Weaver, T.L.
(2000). Drosophila double parked: a conserved, essential
replication protein that colocalizes with the origin recognition complex and
links DNA replication with mitosis and the down-regulation of S phase
transcripts. Genes Dev. 14,
1765-1776.
Wohlschlegel, J.A., Dhar, S.K., Prokhorova, T.A., Dutta, A., and Walter, J.C. (2002). Xenopus Mcm10 binds to origins of DNA replication after Mcm2–7 and stimulates origin binding of Cdc45. Mol. Cell 9, 1-20.[CrossRef][Medline]
Wohlschlegel, J.A., Dwyer, B.T., Dhar, S.K., Cvetic, C., Walter, J.C., and Dutta, A. (2001). Geminin inhibits eukaryotic DNA replication by binding to Cdt1. Science 290, 2309-2312.
Wyrick, J.J., Aparicio, J.G., Chen, T., Barnett, J.D., Jennings,
E.G., Young, R.A., Bell, S.P., and Aparicio, O.M. (2001).
Genome-wide distribution of ORC and MCM proteins in S. cerevisiae:
high-resolution mapping of replication origins. Science
294,
2357-2360.
This article has been cited by other articles:
|
|
 |
|
  P. D. Robertson, E. M. Warren, H. Zhang, D. B. Friedman, J. W. Lary, J. L. Cole, A. V. Tutter, J. C. Walter, E. Fanning, and B. F. Eichman Domain Architecture and Biochemical Characterization of Vertebrate Mcm10 J. Biol. Chem., February 8, 2008; 283(6): 3338 - 3348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Chattopadhyay and A.-K. Bielinsky Human Mcm10 Regulates the Catalytic Subunit of DNA Polymerase-{alpha} and Prevents DNA Damage during Replication Mol. Biol. Cell, October 1, 2007; 18(10): 4085 - 4095. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Lake, K. Teeter, S. L. Page, R. Nielsen, and R. S. Hawley A Genetic Analysis of the Drosophila mcm5 Gene Defines a Domain Specifically Required for Meiotic Recombination Genetics, August 1, 2007; 176(4): 2151 - 2163. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Ricke and A.-K. Bielinsky A Conserved Hsp10-like Domain in Mcm10 Is Required to Stabilize the Catalytic Subunit of DNA Polymerase-{alpha} in Budding Yeast J. Biol. Chem., July 7, 2006; 281(27): 18414 - 18425. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Moyer, P. W. Lewis, and M. R. Botchan Isolation of the Cdc45/Mcm2-7/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase PNAS, July 5, 2006; 103(27): 10236 - 10241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Das-Bradoo, R. M. Ricke, and A.-K. Bielinsky Interaction between PCNA and Diubiquitinated Mcm10 Is Essential for Cell Growth in Budding Yeast. Mol. Cell. Biol., July 1, 2006; 26(13): 4806 - 4817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Ferree and W. Sullivan A Genetic Test of the Role of the Maternal Pronucleus in Wolbachia-Induced Cytoplasmic Incompatibility in Drosophila melanogaster Genetics, June 1, 2006; 173(2): 839 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Long, S. Cameron, L. Yu, and Y. Rao De Novo GMP Synthesis Is Required for Axon Guidance in Drosophila Genetics, March 1, 2006; 172(3): 1633 - 1642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ueno, M. Itoh, L. Kong, K. Sugihara, M. Asano, and N. Takakura PSF1 Is Essential for Early Embryogenesis in Mice Mol. Cell. Biol., December 1, 2005; 25(23): 10528 - 10532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Liachko and B. K. Tye Mcm10 Is Required for the Maintenance of Transcriptional Silencing in Saccharomyces cerevisiae Genetics, October 1, 2005; 171(2): 503 - 515. [Abstract] [Full Text] [PDF] |
