![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, Issue 6, 2292-2302, June 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Biological Sciences, Columbia University, New York, New York
10027;
Department of Neurology and Neuroscience, Cornell University, New York, New
York 10021; and
Department of Surgery, Wayne State University School of Medicine, Detroit,
Michigan 48201
Submitted October 7, 2002;
Revised February 4, 2003;
Accepted February 11, 2003
Monitoring Editor: Thomas D. Fox
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
; Sirum-Connolly and
Mason, 1995).
The mitochondrial genetic system has diverged in significant ways from its
prokaryotic ancestor and its present day cytoplasmic counterpart. This is
evidenced not only by the deviations of the mitochondrial from the universal
genetic code and a reduction in the number of tRNAs but also in the appearance
of new ribosomal proteins that have no homologues in bacterial and eukaryotic
cytoplasmic ribosomes (Graack and
Wittmann-Liebold, 1998). Assembly of mitochondrial ribosomes
presents special problems because of the dual genetic source of the RNA and
protein components. In yeast, all but one of the ribosomal proteins
(Terpstra et al.,
1979) are derived from nuclear genes, whereas the two ribosomal
RNAs are transcribed from mitochondrial genes. The factors that regulate a
coordinate output of these compartmentally separated genes are not known.
In an effort to better understand how mitochondrial ribosomes are formed, we have screened for mutants blocked in mitochondrial translation. The first step in this screen was to identify genes that affect translation but do not directly participate in the process. The mtg1 mutants reported in this communication meet this criterion. MTG1 codes for a mitochondrial protein, which does not fractionate with mitochondrial ribosomes and is not homologous to any protein previously described to function in translation. The probable involvement of Mtg1p in ribosome biogenesis is supported by the identification of suppressor mutations in the 21S rRNA gene in mtDNA. We also present evidence that Mtg1p is present in human mitochondria and is capable of partially rescuing a yeast mtg1 null mutant. The wide phylogenetic distribution of Mtg1p suggests that it plays a fundamental role in expression of the mitochondrial translational machinery.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
).
|
Cloning of MTG1
The mtg1 mutant N472/U9 (MAT
ura3 mtg1-1) was
transformed by the method of Schiestl and Gietz
(1989) with 
10 µg of a
plasmid library consisting of Sau3A fragments of yeast nuclear DNA
averaging 10 kb cloned in the 2-µm plasmid YEp24
(Botstein and Davis, 1982).
This library was a generous gift of Dr. Marian Carlson, Department of
Development and Human Genetics, Columbia University. The transformation
yielded several uracil-independent clones that grew on glycerol as the carbon
source. The respiratory competent phenotype of one clone was found to
cosegregate with the uracil independence, indicating rescue by a plasmid. This
plasmid (pG132/T1) was amplified in Escherichia coli and used to
subclone MTG1.
Construction of an mtg1 Null Allele
The subclone pG132/ST3 (Figure
2) was used to delete the 570-base pair long sequence between the
SphI and BglII sites internal to the gene. The gapped
plasmid was ligated to a 1.80-kb SphI-BamH1 fragment
containing the yeast HIS3 gene. The resultant construct was used to
obtain a linear 2.5-kb PvuII fragment with the mtg1::HIS3
allele. The null allele was introduced into the respiratory competent haploid
strain W303-1B by the one-step gene replacement procedure
(Rothstein, 1983).
|
mtg1 ts Mutants
Temperature-sensitive (ts) mtg1 alleles were obtained by PCR
mutagenesis of the wild-type gene (Staples
and Dieckmann, 1993). The primers used for the synthesis were as
follows: 5'-TGGCCACTGCAGTAGTAG and 5'-CATTTTGCCGCGGATCCAAGAACACG.
Synthesis of the gene was carried out in four separate reactions containing
0.25 mM MnCl2, 1.5 mM MgCl2, and 0.2 mM dITP. In each
reaction the concentration of one of the four deoxynucleotides was reduced
from 0.2 to 0.02 mM. To construct the mutant library, the four 1.5-kb products
were pooled and cloned in the centromeric plasmid pRS315 containing the
LEU2 marker (Sikorski and Hieter,
1989). Leucine-independent clones obtained by transformation of
W303
MTG1 with the PCR-generated library were replicated on YPEG and
scored for growth at 30 and 37°C. Two mutants were isolated that grew very
poorly at 37°C.
Mitochondrial Protein Synthesis
Mitochondrially encoded proteins were labeled in whole cells with
[35S]methionine (7 mCi/mmol, Amersham, Piscataway, NJ) in the
presence of cycloheximide (Barrientos
et al., 2002). The conditions for extraction and
separation the radiolabeled proteins on a 17.5% polyacrylamide gel have been
described (Hell et al.,
2000). The radiolabeled proteins were transferred to
nitrocellulose and visualized by exposure to Kodak X-OMAT film. Deviations
from this procedure are described in some figure legends.
Cloning and Expression of Human MTG1
The human cDNA clone (IMAGE 3638994) codes for a homologue of MTG1
(hMTG1). The cDNA sequence in the clone pOTB7-hMTG1 was
amplified with primers hG132–1: 5'-GGCGAGCTCAATTCGGCCGAGGGCGGC and
hG132-HA: 5'-CCGGAAGCTTTCAAGCGTAGTCTGGGACGTATGGGTAGGGCAAAGTCTCAGCCG to
express hMtg1p with a hemagluttin (HA) epitope at the carboxy terminus. The
cDNA coding for the HA tagged protein was cloned as a
SacI-HindIII fragment in the vector pEGFP1-N1 (Clontech,
Palo Alto, CA), regulated by a cytomegalovirus immediate early promoter to
obtain the construct phG132-ST4H. For immunohistochemistry, human osteosarcoma
143B cells grown on glass slides were transiently transfected with the
construct phG132-ST4H, using FuGENE6 Transfection Reagent (Roche,
Indianapolis, IN) according to the manufacturer's protocol. After 48 h,
immunostaining was carried out with mouse monoclonal anti-HA (Santa Cruz
Biotechnology, Santa Cruz, CA) and Cox1 antibodies (Molecular Probes, Eugene,
OR) as described (Sciacco and Bonilla,
1996). We used secondary anti-rabbit Cy2 or anti-mouse Cy3
(Jackson Immunochemicals, West Grove, PA) for immunodetection and visualized
immunofluorescence in a Zeiss Confocal microscope. Selected digital images
were visualized with different pseudocolors for HA or Cox1, as appropriate,
and merged in RGB format for evaluation of colocalization. For expression of
the human gene in yeast cells, the amplified hMTG1 gene was also
cloned as a SacI-HindIII fragment into the yeast expression
vector YEp351 (Hill et al.,
1986) to obtain the construct pG132/ST5H.
Miscellaneous Procedures
Standard procedures were used for the preparation and ligation of DNA
fragments and for transformation and recovery of plasmid DNA from E.
coli (Maniatis et al.,
1982). The entire insert of pG132/ST6 was sequenced by the method
of Maxam and Gilbert (1977)
using single-stranded restriction fragments labeled at their 5' ends
with 32P-ATP in the presence of polynucleotide kinase. Proteins
were separated by PAGE in the buffer system of Laemmli
(1970), and Western blots were
treated with antibodies against the appropriate proteins followed by a second
reaction with anti-rabbit IgG conjugated to horseradish peroxidase (Sigma, St.
Louis, MO). The SuperSignal chemiluminescent substrate kit (Pierce, Rockford,
IL) was used for the final detection. For the detection of Mtg1p, the blot was
reacted with 125I-labeled protein A according to the protocol of
Schmidt et al.
(1984). Unless otherwise
indicated, mitochondria were prepared by the method of Faye et al.
(1974) except that Zymolyase
20T (ICN Laboratories, Aurora, OH) was used instead of Glusulase for the
conversion of cells to spheroplasts. Protein concentrations were estimated by
the Lowry procedure (Lowry et
al., 1951).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). Both mutants are complemented by a 
o
tester, indicating that the respiratory defect stems from recessive mutations
in a nuclear gene. The mutants are pleiotropically deficient in cytochromes
a, a3, and cytochrome b
(Figure 1A) and lack cytochrome
oxidase, NADH-cytochrome c reductase, and oligomycin-sensitive ATPase
activity (Table 2). This
phenotype is generally observed in mutants impaired in mitochondrial
translation. This was confirmed by assays of mitochondrial protein synthesis
in whole cells in the presence of cycloheximide, which showed only trace
incorporation of [35S]methionine into mitochondrial gene products
(Figure 1B). Preincubation of
mutant cells in chloramphenicol did not improve labeling of the proteins
during a subsequent pulse with [35S]methionine. The chloramphenicol
treatment has been shown to increase translational efficiency, presumably by
drawing newly synthesized mitochondrial products into their respective
assembly pathways (Tzagoloff,
1971). In agreement with earlier studies, the chloramphenicol
preincubation stimulated [35S]methionine incorporation in the two
wild-type strains, W303-1A and D273-10B/A1
(Figure 1B).
|
|
Both the 21S and 15S rRNAs are present in mtg1 mutants (Figure 1C). This excludes transcription and/or processing of the precursor RNAs as a cause of the translational defect. The lowered ratio of 15S to the 21S rRNA observed in the mutant, however, suggests that the mutation affects ribosome assembly. In other studies we have noted that mutations in ribosomal proteins frequently lead to a preferential decrease in the steady state concentration of the 15S rRNA (Myers and Tzagoloff, 1987; unpublished studies).
Cloning and Disruption of MTG1
The respiratory competent clone N472/U9/T1 was obtained by transformation
of the mutant with a yeast genomic library. A plasmid (pG132/T1) capable of
rescuing the respiratory defect was amplified in E. coli and used to
subclone the gene. The smallest subclone that conferred respiration to the
mutant contained a 1.4-kb EcoRI-HindIII fragment (pG132/ST3;
Figure 2). The complete
sequence of this fragment revealed the presence of a single reading frame
identical to ORF YMR097c on chromosome XIII. The correct identity of the gene
was supported by the failure of subclones pG132/ST1 and pG132/ST2, containing
the amino and the carboxyl coding regions of the gene, respectively, to
complement the mutant. This gene has been named MTG1
(mitochondrial GTPase).
A mutant allele with a partial deletion of MTG1
(mtg1::HIS3) was obtained by replacing the sequence
between the SphI and BglII sites of the gene with a 1.7-kb
BamH1-SphI fragment containing the yeast HIS3 gene.
A respiratory-deficient and histidine-independent clone (W303MTG1),
obtained by transformation of the respiratory competent haploid strain W303-1B
with a linear fragment of DNA containing the partially deleted mtg1
mutation, was verified by Southern analysis to have the null mutation. The
respiratory defect of the null mutant was complemented by a ° mutant
with a wild-type copy of MTG1 but not by aN472, suggesting that the
two mutations are allelic. This was supported by the phenotype of
W303MTG1, which is deficient in cytochrome oxidase, NADH-cytochrome c
reductase and oligomycin-sensitive ATPase as a consequence of its failure to
translate the mitochondrially encoded subunits of these complexes
(Figure 1,
Table 2).
MTG1 Codes for a Mitochondrial Protein
Mtg1p is located exclusively in mitochondria. An antibody against an
Mtg1p/trpE fusion protein detected a 45-kDa protein in mitochondria but not in
the postmitochondrial supernatant fraction
(Figure 3A). The protein is
more abundant in a transformant harboring MTG1 on a high-copy plasmid
(Figure 3A) and is absent in
the mtg1 null mutant (unpublished data).
|
Even though the Mtg1p protein sequence is largely hydrophilic (unpublished data), disruption of mitochondria from wild-type or from a high-copy transformant by sonic irradiation failed to solubilize the protein (Figure 3A). The recovery of Mtg1p in the membrane fraction after disruption of mitochondria was not due to cosedimentation as a high-molecular-weight complex. This was confirmed by sedimentation of the membrane fraction on an isopycnic gradient. Mtg1p banded at the same density as the submitochondrial particles and not at the 60–80% sucrose interface where large protein complexes are expected to band (Figure 3B).
The membrane localization and topology of Mtg1p was probed by testing its
sensitivity to proteinase K digestion in intact mitochondria and in mitoplasts
prepared by hypotonic swelling of mitochondria. Mtg1p was protected against
proteinase K in intact mitochondria and in mitoplasts
(Figure 3C). Sco1p, an inner
membrane protein previously shown to face the intermembrane space
(Beers et al., 1997)
was digested in the mitoplasts but not in mitochondria
(Figure 3C). As expected, the
hypotonic conditions used to disrupt the outer membrane resulted in the loss
of cytochrome b2, a soluble protein marker of the
intermembrane space. -Ketoglutarate dehydrogenase, a soluble matrix
protein, was protected against proteinase K in mitochondria and mitoplasts
(Figure 3C). These results
indicate that Mtg1p faces the matrix side of the inner membrane. Approximately
50% of Mtg1p is extracted from mitochondria with alkaline carbonate suggestive
of a peripheral association with the inner membrane. The solubility properties
of Mtg1p in these experiments mimicked that of the peripherally associated
F1 component of the ATPase (unpublished data).
Mtg1p Is Not Associated with Ribosomes
The peripheral association of Mtg1p with the inner membrane could indicate
that it is a component of mitochondrial ribosomes. This was excluded by
analysis of the large and small subunits of mitochondrial ribosomes. The
ribosomal subunits were separated on a sucrose gradient and analyzed
immunochemically for the presence of Mtg1p and Mrp10p, a constituent of the
small ribosomal subunit (Jin et
al., 1997). The results of this experiment failed to show
Mtg1p in the fractions containing the small or large ribosomal subunits
(Figure 4). The same gradient
showed an enrichment of Mrp10p in the small ribosomal subunit
(Jin et al.,
1997).
|
Mitochondrial Translation in a Mutant with a ts Mutation in MTG1
Temperature-sensitive mtg1 mutants were obtained by low-stringency
PCR amplification of the gene. The mtg1 null mutant was transformed
with a library consisting of the PCR products cloned in a low-copy CEN
plasmid. Several clones were isolated that were temperature sensitive for
growth on rich glycerol medium (YPEG). One of the ts mutants
(W303MTG1ts) was further characterized by assessing the effect of the
restrictive temperature on mitochondrial rRNAs and translational
efficiency.
The concentrations of the 21S and 15S rRNAs in the ts transformant were comparable to that of wild-type when cells were grown at 30°C (Figure 5A). Growth at 38°C, however, resulted in a partial loss of the two rRNAs. This was especially evident for the 15S rRNA whose concentration was decreased to a level similar to that of the null mutant grown at 30°C (Figures 1C and 4A).
|
Mitochondrial translation was assayed in whole cells by measuring
[35S]methionine incorporation in the presence of cycloheximide.
Cells grown at 30°C were incubated for 10 min either at 30 or 38°C
before addition of [35S]methionine. Translation was also measured
in the wild-type, the mtg1 null mutant, and an mss51 ts
mutant. The results of this experiment indicated that labeling of
mitochondrial translation products was not significantly different in the
wild-type and the mtg1 ts mutant pretreated either at 30 or 38°C,
even when incorporation of [35S]methionine was allowed to proceed
for 1 h at 38°C (Figure
5B). A similar incubation of the mss51 ts mutant at
38°C resulted in significant reduction of labeling of Cox1p. Mss51p is a
mitochondrial protein required for translation of subunit 1 (Cox1p) of
cytochrome oxidase (Decoster et
al., 1990; Siep et
al., 2000).
When the mtg1 ts mutant was grown and assayed at the two different temperatures, incorporation of [35S]methionine was two or three times less in cells that had been grown at 38°C (Figure 5C). The reduced translation seen in cells grown at 38°C is consistent with their slow growth at this temperature.
Suppression of the mtg1 Null Mutant
The mtg1 null mutant W303MTG1 spontaneously reverts to
respiratory competence on YPEG. Growth of the revertants on YPEG is slower
than that of the wild-type parent at 30°C
(Figure 6A). The difference in
growth of the revertant and mutant is even more striking at 37°C
(Figure 6A). The revertants are
also cold sensitive for growth on YPEG at 24°C (unpublished data).
|
The partial rescue of respiration in the revertants correlates with a
25–30% restoration of mitochondrial protein synthesis
(Figure 6B). The enhanced
translational activity of mitochondria is paralleled by partial restoration of
cytochromes a, a3, and b
(Figure 1A) and increased
stability of mtDNA. Although 50% of cells in a vegetatively grown culture
of the mutant W303MTG1 consist of o/- derivatives, this
percentage is decreased to 10% in the revertant
(Figure 6C).
Crosses of four independent revertants (aW303MTG1/R1, R2, R3, and
R8) to the mtg1 null mutant produced respiratory competent diploid
cells, indicating that the mutations behave as dominant suppressors. The
suppressors were ascertained to be mitochondrial by several criteria.
Elimination of mtDNA from the revertants by ethidium bromide treatment
abolished their ability to restore respiration in the mtg1 mutant
N472. The suppressor did not segregate as a nuclear gene. Diploid cells
obtained from a cross of aW303MTG1/R1 to N472 were sporulated and
tetrads dissected. Of 28 tetrads analyzed, only four had 4 viable spores. The
spores in each of the 4 complete tetrads were respiratory competent,
consistent with the presence of a dominant mitochondrial suppressor.
Approximately 25% of the diploid cells formed from the cross of the mutant to
the revertant were respiratory defective indicated that the suppressor
segregated as a cytoplasmic factor.
The mitochondrial suppressors in two of the revertants were mapped by
deletion analysis. aW303MTG1/R1 and aW303MTG1/R2 were converted
to - mutants by treatment with ethidium bromide, and panels of
the - clones were crossed to the null mutant, to different
mit- and syn- mutants, and to a wild-type strain with
the erythromycin resistance marker in the 21S rRNA. The resultant diploid
cells were scored for growth on YPEG and for the presence of the erythromycin
resistance allele. The suppressor was ascertained to be linked to a region of
mtDNA with the erythromycin resistance marker and with the downstream cysteine
tRNA. Attempts to further dissect this region by repeated mutagenesis with
ethidium bromide were not successful, probably because of the inherent
stability of the - genome.
The suppressor mutations in the four revertants were further localized by
sequence analysis of the mitochondrial 21S rRNA gene. The complete sequence of
the gene in aW303MTG1/R2 revealed a G to A transition at nucleotide
1956 based on the 21S rRNA sequence in GenBank (NC001224). This mutation was
also found in 21S rRNA gene of aW303MTG1/R1, whereas in
aW303MTG1/R3 there was G to T transversion at the neighboring
nucleotide 1957 (Figure 7). The
fourth revertant aW303MTG1/R8 had a T to A transversion in the same
region of the RNA at nucleotide 4020 of the gene. The three mutations are in a
stem structure connecting domain V to the central peptidyl transferase domain
of the RNA (Figure 7).
|
MTG1 Has a Human Homologue That Partially Complements the Yeast mtg1
Null Mutant
A human cDNA clone (IMAGE 3638994) codes for a putative homologue of Mtg1p.
The cDNA sequence was mapped to locus 92170 on chromosome 10q26.3. The human
gene, here referred to as hMTG1, consists of 11 exons and 10 introns
(Figure 8A).
|
The subcellular location of hMtg1p was studied by transient expression of the protein tagged with a hemagluttin epitope (HA) in human osteosarcoma 143B cells. Immunohistochemical assays for the HA epitope in the transformed cells showed a typical punctate mitochondrial pattern that colocalized with subunit 1 of cytochrome c oxidase (Figure 8B).
Evidence for the functional equivalence of the two proteins was obtained by
testing the ability of hMTG1 to complement a yeast mtg1 null
mutant. The human cDNA was cloned in the yeast multicopy shuttle plasmid
YEp351. Transformation of W303MTG1 with this construct (pG132/ST5H)
partially restored growth of the mutant on YPEG
(Figure 8C). In vivo assays of
mitochondrial translation indicated that the transformant had 5–10% of
wild-type activity (Figure 6B).
Human Mtg1p also alleviated the tendency of the yeast mutant to undergo
deletions in mtDNA. The percentage of + cells in a
vegetatively growing culture of the transformant was estimated to be greater
than 95% compared with 50% in the null mutant
(Figure 6C).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
The phenotype of mtg1 mutants indicates that the function of Mtg1p
is related to mitochondrial translation. Mutations in MTG1 induce an
instability of the mitochondrial genome resulting in a high rate of conversion
to o/- mutants. Despite the tendency of mtDNA to undergo
deletions, 50% of a vegetatively grown culture of the null mutant
consists of + cells. This is significant in view of previous
observations that mutations abolishing mitochondrial translational lead to a
quantitative loss of the + genome
(Myers et al., 1985).
The presence of normal mtDNA in a sizeable fraction of mtg1 mutants
indicates that they retain a low level of mitochondrial translation. This is
consistent with the results of in vivo mitochondrial translation assays.
Three lines of evidence argue against a direct function of Mtg1p in mitochondrial translation. The absence of the protein in the large or small ribosomal subunits indicates that it is not a ribosomal protein. Second, Mtg1p is not homologous to any known prokaryotic or eukaryotic proteins with described functions in translation (e.g., elongation, initiation factors). Mitochondrial translation assay of the mtg1 ts mutant are also more consistent with a role of the protein in expression of the translational apparatus than in translation itself. Mitochondrial protein synthesis was inhibited when the ts mutant was grown at the nonpermissive temperature. Growth of the ts mutant at the permissive temperature, however, did not affect mitochondrial translation at either the permissive and restrictive temperature. Although these results are more compatible with a requirement of Mtg1p for some aspect of the biogenesis of the translational apparatus, they do not totally exclude the possibility of an involvement of Mtg1p in translation. For example, the ts allele could block maturation or localization of the protein in its proper compartment when cells are grown at the nonpermissive temperature.
The translational defect of mtg1 mutants is compensated by
mutations in the 21S rRNA. This suggests that the target of Mtg1p action is
likely to be the 21S rRNA or the large subunit of mitochondrial ribosomes. The
presence of mature size 21S rRNA in yeast mtg1 null and point mutants
excludes Mtg1p from having a function in processing of the primary rRNA
transcripts. It is also unlikely that Mtg1p catalyzes rRNA modification
because the enzymes involved in the three modifications of the 21S rRNA have
been identified (Sirum-Connolly and Mason,
1995; Ansmant et al.,
2000; Pintard et al.,
2002).
Mtg1p is a member of a larger GTPase superfamily, although this activity
has not been experimentally demonstrated in the yeast protein. The only member
of this superfamily with known functions are the Nug proteins, which have been
shown to be involved in export of preribosomal particles from the nucleolus to
the nucleoplasm (Bassler et al.,
2001). It is difficult to imagine how Mtg1p could be involved in
transport of a preribosomal particle
(Bassler et al., 2001)
as the rRNAs are transcribed in the matrix compartment where ribosome assembly
is presumed to take place.
Although the exact function Mtg1p is difficult to pinpoint, our data are
most consistent with a role in ribosome assembly. Three different suppressor
mutations have been identified in the 21S rRNA that partially compensate for
the absence of Mtg1p. The three mutations are located in a stem structure in
loop V of the peptidyl transferase domain. This region of the prokaryotic
rRNAs has been shown to bind several different antibiotics, including
erythromycin (Sor and Fukuhara,
1982; Ettayebi et
al., 1985; Cui and Mason,
1989; Harris et al.,
1989). The U to A change at nucleotide 2877 of one of the
revertants confers resistance to erythromycin (unpublished data). In E.
coli this region of the rRNA is close to the opening in the tunnel of the
50S subunit through which the polypeptide chain traverses during elongation
(Ban et al., 2000).
This region of the rRNA also interacts with the L4 and L22 subunits, both of
which can acquire mutations causing erythromycin resistance
(Chittum and Champney, 1994).
Mtg1p may be required for assembly of this important structure in the large
subunit by catalyzing a modification of a ribosomal protein that interacts
with domain V or transiently stabilizes an RNA fold.
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
Footnotes |
|---|
Corresponding author. E-mail address:
spud{at}cubpet2.bio.columbia.edu.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Ban, N., Nisson, P., Hansen, J., Moore, P.B., and Steitz, T.S.
(2000). The complete atomic structure of the large ribosomal
subunit at 2.4Å resolution. Science
289,
905-920.
Barrientos, A., Korr, D., and Tzagoloff, A. (2002). Shy1p is necessary for full expression of mitochondrial COX1 in the yeast model of Leigh's syndrome. EMBO J. 21, 43-52.[CrossRef][Medline]
Bassler, J., Grandi, P., Gadal, O., Lessman, T., Petfalski, E., Tollerway, D., Lechner, J., and Hurt, E. (2001). Identification of a 60S preribosomal particle that is closely linked to nuclear export. Mol. Cell 8, 517-529.[CrossRef][Medline]
Beers, J., Glerum, D.M., and Tzagoloff, A. (1997).
Purification, characterization, and localization of yeast Cox17p, a
mitochondrial copper shuttle. J. Biol. Chem.
272,
33191-33196.
Botstein, D., and Davis, R.W. (1982). In: The molecular biology of the yeast Saccharomyces cerevisiae: metabolism and gene expression, ed. J.N. Strathern, E.W. Jones, and J.R. Broach, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 607-636.
Chittum, H.S., and Champney, W.S. (1994). Ribosomal
protein gene sequence changes in erythromycin resistant mutants of
Escherichia coli. J. Bacteriol.
176,
6192-6198.
Claisse, M., Slonimski, P.P., Johnston, J., and Malher, H.R. (1980). Mutations within an intron and its flanking sites: patterns of novel polypeptides generated by mutants in one segment of the cob-box region of yeast mitochondrial DNA. Mol. Gen. Genet. 177, 375-387.[CrossRef][Medline]
Cui, Z., and Mason, T.L. (1989). A single nucleotide substitution at the rib2 locus of the yeast mitochondrial gene for 21S rRNA confers resistance to erythromycin and cold-sensitive ribosome assembly. Curr. Genet. 16, 273-279.[CrossRef][Medline]
Decoster, E., Simon, M., Hatat, D., and Faye, G. (1990). The MSS51 gene product is required for the translation of the COX1 mRNA in yeast mitochondria. Mol. Gen. Genet. 224, 111-118.[Medline]
Ettayebi, M., Prasad, S.M., and Morgan, E.A. (1985).
Chloramphenicol-erythromycin resistance mutations in a 23S rRNA gene of
Escherichia coli. J. Bacteriol.
162,
551-557.
Faye, G., Kujawa, C., and Fukuhara, H. (1974). Physical and genetic organization of petite and grande yeast mitochondrial DNA. IV. In vivo transcription products of mitochondrial DNA and localization of 23 S ribosomal RNA in petite mutants of Saccharomyces cerevisiae. J. Mol. Biol. 88, 185-203.[CrossRef][Medline]
Glick, B., and Pon, L.A. (1995). Isolation of highly purified mitochondria from Saccharomyces cerevisiae. Methods Enzymol. 260, 213-223.[Medline]
Graack, H.-R., and Wittmann-Liebold, B. (1998). Mitochondrial ribosomal proteins (MRPs) of yeast. Biochem. J. 329, 433-448.
Harris, E.H., Burkhart, B.D., Gillham, N.W., and Boynton, J.E.
(1989). Antibiotic resistance mutations in the chloroplast 16S
and 23S rRNA genes of Chlamydomonas reinhardtii: correlation of
genetic and physical maps of the chloroplast genome. Genetics
123,
281-292.
Hell, K., Herrmann, J.M., Pratje, E., Neupert, W., and Stuart, R.A.
(1998). Oxa1p, an essential component of the N-tail protein
export machinery in mitochondria. Proc. Natl. Acad. Sci. USA
95,
2250-2255.
Hell, K., Tzagoloff, A., Neupert, W., and Stuart, R.A.
(2000). Identification of Cox20p, a novel protein involved in the
maturation and assembly of cytochrome oxidase subunit 2. J. Biol.
Chem. 275,
4571-4578.
Hill, J.E., Myers, A.M., Koerner, T.J., and Tzagoloff, A. (1986). Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2, 163-167.[CrossRef][Medline]
Jin, C., Myers, A.M., and Tzagoloff, A. (1997). Cloning and characterization of MRP10, a yeast gene coding for a mitochondrial ribosomal protein. Curr. Genet. 31, 228-234.[CrossRef][Medline]
Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[CrossRef][Medline]
Lowry, O.H., Rosebrough, N.J., Farr, A.L., and Randall, R.J.
(1951). Protein measurement with the Folin phenol reagent.
J. Biol. Chem. 193,
265-275.
Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Maxam, A.M., and Gilbert, W. (1977). A new method for
sequencing DNA. Proc. Natl. Acad. Sci. USA
74,
560-564.
Morales, M.J., Dang, Y.L., Lou, Y.C., Sulo, P., and Martin, N.C.
(1992). A 105-kDa protein is required for yeast mitochondrial
RNase P activity. Proc. Natl. Acad. Sci. USA
89,
9875-9879.
Myers, A.M., Crivellone, M.D., and Tzagoloff, A.
(1987). MRP1 and MRP2, two yeast nuclear genes coding
for mitochondrial ribosomal proteins. J. Biol. Chem.
262,
3388-97.
Myers, A.M., Pape, L.K., and Tzagoloff, A. (1985). Mitochondrial protein synthesis is required for the maintenance of intact mitochondrial genomes in S. cerevisiae. EMBO J. 4, 2087-2092.[Medline]
Pintard, L., Bujnicki, J.M., Lapeyre, B., and Bonnerot, C. (2002). MRM2 encodes a novel yeast mitochondrial 21S rRNA methyltransferase. EMBO J. 21, 1139-1147.[CrossRef][Medline]
Rothstein, R.J. (1983). One-step gene disruption in yeast. Methods Enzymol. 101, 202-211.[Medline]
Schiestl, R.H., and Gietz, R.D. (1989). High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16, 339-346.[CrossRef][Medline]
Schmidt, R.J., Myers, A.M., Gillham, N.W., and Boynton, J.E. (1984). Immunological similarities between specific chloroplast ribosomal proteins from Chlamydomonas reinhardtii and ribosomal proteins from Escherichia coli. Mol. Biol. Evol. 1, 317-334.[Abstract]
Sciacco, M., and Bonilla, E. (1996). Cytochemistry and immunocytochemistry of mitochondria in tissue sections. Methods Enzymol. 264, 509-521.[Medline]
Siep, M., van Oosterum, K., Neufeglise, H., van der Spek, H., and Grivell, L.A. (2000). Mss51p, a putative translational activator of cytochrome c oxidase subunit-1 (COX1) mRNA, is required for synthesis of Cox1p in Saccharomyces cerevisiae. Curr. Genet. 37, 213-220.[CrossRef][Medline]
Sikorski, R.S., and Hieter, P. (1989). A system of
shuttle vectors and yeast host strains designed for efficient manipulation of
DNA in Saccharomyces cerevisiae. Genetics
122,
19-27.
Sor, F., and Fukuhara, H. (1982). Identification of
two erythromycin resistance mutations in the mitochondrial gene coding for the
large ribosomal RNA in yeast. Nucleic Acids. Res.
10,
6571-6577.
Sirum-Connolly, K., and Mason, T.L. (1995). The role of nucleotide modifications in the yeast mitochondrial ribosome. Nucleic Acids Symp. Ser. 33, 73-75.
Staples, R.R., and Dieckmann, C.L. (1993). Generation of temperature-sensitive cbp1 strains of Saccharomyces cerevisiae by PCR mutagenesis and in vivo recombination: characteristics of the mutant strains imply that CBP1 is involved in stabilization and processing of cytochrome b pre-mRNA. Genetics 135, 981-991.[Abstract]
ten Berge, A.M., Zoutewelle, G., and Needleman, R.B. (1974). Regulation of maltose fermentation in Saccharomyces carlsbergensis. 3. Constitutive mutations at the MAL6-locus and suppressors changing a constitutive phenotype into a maltose negative phenotype. Mol. Gen. Genet. 131, 113-121.[Medline]
Terpstra, P., Zanders, E., and Butow, R.A. (1979). The
association of var1 with the 38S mitochondrial ribosomal subunit in yeast.
J. Biol. Chem. 254,
12653-12661.
Tzagoloff, A. (1971). Assembly of the mitochondrial
membrane system. Role of mitochondrial and cytoplasmic protein synthesis in
the biosynthesis of the rutamycin-sensitive adenosine triphosphatase.
J. Biol. Chem. 246,
3050-3056.
Tzagoloff, A., Akai, A., and Foury, F. (1976). Assembly of the mitochondrial membrane system XVI. Modified form of the ATPase proteolipid in oligomycin-resistant mutants of Saccharomyces cerevisiae. FEBS Lett. 65, 391-395.[CrossRef][Medline]
Tzagoloff, A., Akai, A., and Needleman, R.B. (1975).
Assembly of the mitochondrial membrane system. Characterization of nuclear
mutants of Saccharomyces cerevisiae with defects in mitochondrial ATPase and
respiratory enzymes. J. Biol. Chem.
250,
8228-8235.
Tzagoloff, A., and Dieckmann, C.L. (1990).
PET genes of Saccharomyces cerevisiae. Microbiol.
Rev. 54,
211-225.
This article has been cited by other articles:
|
|
 |
|
  D. J. Wiley, P. Catanuto, F. Fontanesi, C. Rios, N. Sanchez, A. Barrientos, and F. Verde Bot1p Is Required for Mitochondrial Translation, Respiratory Function, and Normal Cell Morphology in the Fission Yeast Schizosaccharomyces pombe Eukaryot. Cell, April 1, 2008; 7(4): 619 - 629. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. A. Hill, J. Broadhvest, R. K. Kuzoff, and C. S. Gasser Arabidopsis SHORT INTEGUMENTS 2 Is a Mitochondrial DAR GTPase Genetics, October 1, 2006; 174(2): 707 - 718. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Bassler, M. Kallas, and E. Hurt The NUG1 GTPase Reveals an N-terminal RNA-binding Domain That Is Essential for Association with 60 S Pre-ribosomal Particles J. Biol. Chem., August 25, 2006; 281(34): 24737 - 24744. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Anand, S. K. Verma, and B. Prakash Structural stabilization of GTP-binding domains in circularly permuted GTPases: implications for RNA binding. Nucleic Acids Res., January 1, 2006; 34(8): 2196 - 2205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Datta, J. L. Fuentes, and J. R. Maddock The Yeast GTPase Mtg2p Is Required for Mitochondrial Translation and Partially Suppresses an rRNA Methyltransferase Mutant, mrm2 Mol. Biol. Cell, February 1, 2005; 16(2): 954 - 963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Vozza, E. Blanco, L. Palmieri, and F. Palmieri Identification of the Mitochondrial GTP/GDP Transporter in Saccharomyces cerevisiae J. Biol. Chem., May 14, 2004; 279(20): 20850 - 20857. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Towpik, A. Chacinska, M. Ciesla, K. Ginalski, and M. Boguta Mutations in the Yeast MRF1 Gene Encoding Mitochondrial Release Factor Inhibit Translation on Mitochondrial Ribosomes J. Biol. Chem., April 2, 2004; 279(14): 14096 - 14103. |
-mercaptoethanol) and was layered on a 5-ml column of a 10–30%
linear sucrose gradient in AMT buffer. After centrifugation at 65,000 rpm in a
Beckman SW65Ti rotor for 100 min, the gradient was fractionated into 18
fractions. Only fractions containing the large and small subunits were
analyzed as in 
