|
|
|
|
Vol. 14, Issue 7, 2630-2644, July 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biology, McGill University, Montreal, Quebec, Canada H3A 1B1
Submitted November 8, 2002;
Revised March 13, 2003;
Accepted March 18, 2003
Monitoring Editor: Daniel Goodenough
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Two protein families can form gap junctions: the vertebrate-specific
connexins and the innexins, which are typical to invertebrates. The connexins
form integral membrane protein assemblies, called connexons, consisting of six
subunits. Connexons in adjacent cells interact in the extracellular space to
form the gap junction (Yeager and
Nicholson, 1996
; Unger et
al., 1999
).
Although gap junctions were first characterized in invertebrate organisms
(Furshpan and Potter, 1957
),
the genes that encode their structural proteins were only recently
characterized, mainly because the innexins have no significant sequence
similarity to the connexins (Phelan et
al., 1998a
).
Nevertheless, innexins are both necessary and sufficient to form gap
junctional channels. Innexin mutants lack dye coupling between muscle and
neuronal cells (Starich et al.,
1996
; Todman et al.,
1999
). Moreover, the innexins Ce-inx-3, Dm-inx-2, and
shaking-B can form gap junctional channels when expressed in the
paired Xenopus oocyte system.
(Phelan et al.,
1998b
; Landesman et
al., 1999
; Stebbings
et al., 2000
). Structure predictions based on primary
sequence indicate that, like the connexins, innexins possess four
transmembrane domains with the same overall topology
(Phelan and Starich, 2001
).
Thus, homology between connexins and innexins may be evident at the structural
level.
Both the connexins and innexins constitute large gene families, presumably
reflecting their diverse roles in organisms. About 20 connexins have been
identified in vertebrates (White and Paul,
1999
), 25 innexins in C. elegans, and 8 in
Drosophila (Phelan and Starich,
2001
). Because both connexins
(Nicholson et al.,
1987
) and innexins (Stebbings
et al., 2000
) can form heteromeric channels, the subunit
composition of which can have important effects on the properties of the gap
junction formed, a large number of distinct gap junctional channels could
assemble in vivo.
Several human diseases have been linked to connexin polymorphisms
(Bergoffen et al.,
1993
; Kelsell et al.,
1997
; Shiels et al.,
1998
) and directed mutations in mice have revealed diverse roles
for connexins in transplacental nutrient transfer
(Gabriel et al.,
1998
), ovulation (Simon et
al., 1997
), and cardiac development and function (Cx40, Cx43,
and Cx45) (Kanter et al.,
1994
; Reaume et al.,
1995
; Ewart et al.,
1997
; Simon et al.,
1998
).
Mutations in four innexins have been characterized in Drosophila
(Curtin et al., 1999
;
Bauer et al., 2002
;
Tazuke et al., 2002
).
The shaking-B (lethal) mutation causes animals to die early, possibly
due to feeding defects (Crompton et
al., 1995
), whereas the shaking-B (neural) mutation
disrupts the gap junctions between giant fibers and its postsynaptic
motorneuron partners (Thomas and Wyman,
1984
; Krishnan et
al., 1993
; Phelan et
al., 1996
; Sun and Wyman,
1996
). Ogre mutations lead to defects in optic lobe
development and abnormal electrical activity in the eye
(Lipshitz and Kankel, 1985
;
Watanabe and Kankel,
1990
).
UNC-7 was the first innexin identified in C. elegans, and
mutations in unc-7 cause impaired forward locomotion and ivermectin
resistance. The uncoordinated phenotype could result from the aberrant
formation of an UNC-7-dependent channel or may reflect ectopic electrical
junctions between motorneurons and interneurons in unc-7 mutants
(Starich et al.,
1993
; Dent et al.,
2000
). The mutant phenotype of another innexin gene,
unc-9, is very similar to that of unc-7, indicating that
UNC-9 subunit may partner with UNC-7 to form the functional gap junction
(Barnes and Hekimi, 1997
).
Several C. elegans innexins are expressed in the pharynx
(Phelan and Starich, 2001
),
probably because the control of current flow through coupled muscles requires
gap junctions with diverse properties in this organ. The pharynx is a
neuromuscular pump that has some developmental and functional similarities to
the heart (Haun et al.,
1998
; Maduro et al.,
2001
) and is required for ingesting food
(Figure 4, A and B). The
pharyngeal muscles are extensively gap junctioned so that a pump results in a
compound action potential and simultaneous contraction of most of the
pharyngeal muscles. This compound action potential can be measured by a simple
electrophysiological technique, the electropharyngeogram (EPG)
(Avery and Thomas, 1997
).
|
One explanation for the large number of innexins in the pharynx is that the
control of current flow through coupled muscles requires gap junctions with
diverse properties. eat-5, for instance, is expressed only in the
muscles of the metacorpus and in the muscles of the isthmus, which connects
the metacorpus with the terminal bulb of the pharynx
(Avery, 1993
). A mutation in
eat-5 uncouples the muscles of the terminal bulb from those of the
metacorpus but leaves intermuscular junctions within each bulb intact. In
eat-5 mutants the metacorpus muscles contract in synchrony and the
terminal bulb muscles contract in synchrony but, unlike in wild-type animals,
contraction of the anterior and posterior pharynx is asynchronous
(Starich et al.,
1996
).
To further understand the functions of innexins in C. elegans behavior and development, we characterized a temperature-sensitive mutation of the innexin family member inx-6. inx-6(rr5) mutants are unable to initiate development after hatching at restrictive temperature due to defects in pharyngeal pumping. Our characterization of this mutant suggests that inx-6 is required to couple muscle cells of the anterior pharynx.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The Bristol strain N2 was used as the wild-type throughout. The following strains were also used: Bergerac strain RW7000, DA465 [eat-2(ad465) II], DA491 [dpy-20(e1282) unc-30(e191) IV], DR107 [unc-26(e205) dpy-4(e1166) IV], DR282 [dpy-13(e184) unc-31(e169) IV], JD118 [inx-6(rr5) IV; avr-15(ad1051) V], JD125 [inx-6(rr5) IV; exp-2(sa26ad1426) avr-15(ad1051) V], MT2115 (nDf27/nT1 IV; +/nT1 V), PD4792 (mIs11 IV), and VT765 [unc-36(e251); maIs103 [rnr::GFP unc-36(+)] X].
A Genetic Screen for Temperature-sensitive Mutants Defective in the
Initiation of Postembryonic Development
The strain VT765 [unc-36(e251); maIs103 [rnr::GFP
unc-36(+)]] (Hong et
al., 1998
) was mutagenized with 47 mM ethylmethanesulfonate
as described previously (Brenner,
1974
). To select mutants efficiently, we used a potent inhibitor
of DNA replication, hydroxyurea (HU), as a tool to select against animals that
initiate postembryonic development at 25°C. HU-affected adult animals are
uncoordinated and sterile due to effects on the development of the neuroblast
lineage and germline. However, HU has no effect if worms do not initiate the
cell divisions typical of early postembryonic development. Arrested L1s were
transferred to individual NGM plates without HU and allowed to recover at
15°C for further analysis.
Temperature-Shift Experiments
Mutant embryos were isolated with alkaline/hypochlorite and hatched in M9
buffer (20 mM KH2PO4, 40 mM
Na2HPO4, 85 mM NaCl 85, 1 mM MgSO4). The
hatched L1 larvae were cultured at 15°C and after every 8 h, 50 worms were
transferred to plates that were preequilibrated at 25°C. Animals that grew
to reproductive maturity were scored as a percentage of the total population
present on the plate after 48 h.
Plasmid Constructs
pMR341 contains a 8.2-kb SalI fragment from the cosmid T23F6,
which was subcloned into vector p-Bluescript (Stratagene, La Jolla, CA).
pMR342 contains a 6.2-kb SacII/SmalI fragment from the cosmid T23F6
that was subcloned into p-Bluescript (Stratagene). pMR346
(inx-6::GFP) is a transcriptional green fluorescent protein (GFP)
fusion containing 3 kb of sequence 5' to the XbaI site upstream
of the inx-6 translation start site. pMR347
(inx-6::INX-6::GFP) is a translational GFP fusion containing the same
upstream sequence described above, driving an inx-6 cDNA amplified
from a cDNA library (a gift from Dr. A. La Volpe, International Institute of
Genetics and Biophysics, Napoli, Italy) by using the primers
5'catgtctagaatggcgtcgcaagttggag3' (upstream) and
5'atgggatccagtatgcttaatcgatttgacaaatg3' (downstream) and inserted
in frame into the Fire Lab vector pPD95.77. In pMR348, the inx-6
promoter of pMR342 was removed by digestion with SacII/XbaI
and replaced with a SacII/XbaI fragment of the
myo-2 promoter amplified from the Fire Lab vector pPD30.69 by using
primers 5'catgcatctagaacctttgggtcctttggc3' (upstream) and
5'atatccgcggaggatccccagcttgcat3' (downstream). In pMR350
(inx-6::EAT-5), the coding sequence of inx-6 in pMR342 was
replaced with a XbaI/PstI polymerase chain reaction fragment
containing eat-5 coding sequence.
Germline Transformation
Germline transformation was performed as described previously
(Mello et al., 1991
).
Cosmids and plasmids for rescue experiments were injected at a concentration
of 20 µg/ml, whereas the cotransformation marker pRF4 (rol-6 D)
was injected at a concentration of 100 µg/ml. For rescue experiments,
mutant animals were injected and maintained at 15°C. Adult F2 animals
exhibiting a Rol phenotype were transferred to 25°C, and rescue of L1
arrest of their progeny (F3) was scored.
RNA Interference
inx-6 double-stranded RNA (dsRNA) was produced and injected
according to Fire et al.
(1998
). The gel-purified
template (1 µg) was used for in vitro transcription reactions and the RNA
was then phenol/chloroform extracted, ethanol precipitated, and annealed.
inx-6 dsRNA was injected into N2 or MR127 animals at a concentration
of 1 mg/ml. The injected animals were transferred daily to new plates, and
development of F1 progeny was monitored.
Video Recording and Electropharyngeogram
inx-6(rr5) mutant worms grown at 25°C were incubated in 1 mM
levamisole (to induce paralysis) and 10 mM serotonin (to induce pumping) in M9
buffer for 30 min (both drugs from Sigma-Aldrich, St. Louis, MO). Worms were
mounted in M9 buffer on 35 x 60-mm coverslips. A recording chamber was
created by applying a ring of gasket sealant to the surface of the coverslip
and allowing it to cure overnight. Worms were viewed on an Olympus IX-70
inverted microscope with Nomarski optics and a 40x lens. EPGs were
recorded using 1.2 OD borosilicate suction pipettes pulled on a Sutter P-97
pipette puller (Sutter Instrument, Novato, CA). Recording of EPGs was
essentially as described in Raizen et al. (1994) by using a Warner
Instrument (Hamden, CT), patch-clamp PC-501A with a 1-G
headstage but
without filtering in the amplifier. EPGs were digitized using a Digitdata
1322A and recorded using Clampex 8.1 software (Axon Instruments, Union City,
CA). Recordings were formatted and digitally filtered using a 1-kHz Gaussian
filter with Clampfit 8.1 software (Axon Instruments).
Video images were recorded using a Hitachi KP-M1U charge-coupled device
camera and frames were captured using a Matrox Meteor-II frame grabber (Matrox
Electronic Systems, Dorval, QC, Canada). The EPG signal was used to trigger
the frame grabber to collect 15 frames. To do this, the EPG signal was sent to
the a Digitimer D.130 spike processor (Medical Systems, Great Neck, NY) which,
upon encountering an E-spike, simultaneously sent a signal to the Digidata
1322A and to the frame grabber. The signal to the Digidata initiated the
recording of the EPG and the signal to the frame grabber initiated image
acquisition (acquisition software, written by J.A. Dent with MIL-lite,
available on request). Grabbed images were deinterlaced and digitally
condensed in the x-axis to restore the aspect ratio yielding an image
every
17 ms. By simultaneously recording the EPG in one channel and the
camera synchronization signal in a second channel, it was possible to
correlate in time both the images and the EPG.
Dye Diffusion Experiment
Newly hatched L1 larvae were washed with M9 buffer and soaked in saturated
carboxyfluorescein (Sigma-Aldrich) solution (
20 mM) for at least 3 h. Due
to the pharyngeal abnormalities in inx-6(rr5) animals,
inx-6(rr5) larvae were initially soaked in the carboxyfluorescein
solution at permissive temperature (15°C). Animals were then transferred
to 25°C for 5 h to allow worms to eliminate the wild-type inx-6
gene product before laser treatment. After thoroughly washing with M9 buffer,
animals were mounted on a 2% agarose pad as described with 1 mM levamisole and
10 mM serotonin. Dye was introduced into the pharyngeal muscles by focusing a
low-intensity laser pulse at the posterior edge of the grinder. Images of the
diffusion of the fluorescent dye were captured at 10-s intervals by using
identical exposure time. The dye diffusion pattern was verified 10 min after
the laser treatment to confirm that the dye distribution remained
unchanged.
Microscopy and Image Processing
Light microscopy was performed using a Leica DMR compound microscope with
Nomarski optics. Images were captured with a Hamamatsu C474295 digital
camera. Image processing, analysis and computational deconvolution were
performed using Openlab 3.07 software (Improvision, Lexington, MA) and Adobe
Photoshop.
| RESULTS |
|---|
|
|
|---|
Therefore, rr5 seems to be absolutely required to initiate postembryonic development. Because this allele is temperature sensitive, we sought to determine when rr5 activity was required during development. By down-shifting to permissive or up-shifting to restrictive temperature, respectively, an approximate temporal window can be obtained to describe when a gene product is required for wild-type function. Normally this would be performed by executing an up-shift and a down-shift time course; however, due to the highly penetrant developmental arrest phenotype of rr5 animals at 25°C, only up-shift experiments could be performed (Table 1). By shifting rr5 animals to restrictive temperature at various stages during development, we found that rr5 disrupts a gene that is necessary during the L1 and L2 stages for correct larval development. All post-L2 stage up-shifted animals grew to become fertile at restrictive temperature and produce viable progeny that arrested as hatchlings.
|
rr5 Is a Temperature-sensitive Allele of an unc-7-like Protein
inx-6
To understand how rr5 functions at the molecular level, we mapped
rr5 initially using a sequence-tagged site mapping approach
(Williams et al.,
1992
). Our results indicated that the mutation is on LG IV and to
the left of dpy-20. Further three-point recombination mapping showed
that rr5 is between dpy-20 and unc-31 and close to
unc-31 (
0.03 map units)
(Figure 1A).
|
Six cosmids and one YAC that span this interval were chosen by consulting the C. elegans physical map (Figure 1A). Two cosmids, T23F6 and C36H8, were found to completely rescue the larval arrest phenotype of rr5 at 25°C, suggesting that a common region to both cosmids carried the wild-type rr5 gene product. The 9-kb overlapping region contains two predicted genes that encode a major sperm protein-like product and the innexin gene inx-6, an unc-7 homolog (Figure 1B). These two predicted genes were individually subcloned and injected to test for rescue. Transformation rescue experiments indicated that the inx-6containing construct could fully rescue the mutant phenotype, whereas the second candidate had no effect on the rr5 phenotype (Figure 1C).
To confirm that inx-6 is indeed the mutated gene in rr5,
the inx-6 coding region was frame shifted, and the mutant variant was
assessed for its ability to rescue. The
inx-6 construct could
no longer complement the rr5 mutation, suggesting that rr5
is an allele of inx-6, which we will refer to as
inx-6(rr5).
To address whether inx-6(rr5) is a weak or strong hypomorphic
allele, and/or whether maternal products could rescue embryonic functions in
this mutant background we compared the phenotype of inx-6(rr5) to
that of an inx-6(RNAi) animal. Double-stranded RNA to any gene of
interest can elicit a potent response in C. elegans referred to as
RNA-mediated interference that is mediated by degrading targeted transcripts
posttranscriptionally (Fire et
al., 1998
). In the F1 progeny of wild-type animals injected
with double-stranded RNA corresponding to the inx-6 coding region,
510% animals displayed a postembryonic arrest phenotype very similar to
that observed with inx-6(rr5) at 25°C, albeit at lower
penetrance. To test whether residual wild-type gene activity may be present in
the inx-6(rr5) mutant, we performed a similar RNAi experiment as
described above in an inx-6(rr5) background. The F1 progeny of
injected parents show the identical phenotype, in severity and penetrance, to
the F1 progeny from uninjected inx-6(rr5) mutant parents kept at
25°C. These data suggest that the inx-6(rr5) mutant phenotype at
25°C likely represents a strong hypomorph or the inx-6 null
phenotype. This was further confirmed by placing the inx-6(rr5)
mutant chromosome in trans to a deficiency that uncovers this region
(our unpublished data).
inx-6 Is a Member of a Highly Conserved Protein Family
inx-6 encodes a protein that belongs to the innexin family
(invertebrate connexin analogs), which encode components of
invertebrate gap junctions. The closest homolog to INX-6 is UNC-7 with 33%
identity at the amino acid level. The strongest homology is seen among the
conserved cysteine residues in the extracellular loops and in the
transmembrane domains that play roles in normal channel regulation
(Figure 2).
|
The inx-6 genomic sequence from rr5 was sequenced to
identify a lesion within this gene that would cause the inx-6(rr5)
arrest phenotype. A G/C to A/T transition, typical of EMS-induced lesions was
identified, and caused a P353L change in the INX-6 protein near the C termini.
That a point mutation in the C termini could disrupt the protein function at
the restrictive temperature is consistent with a previous study in which the C
terminus was shown to be very important for the normal channel function of
connexins (Yeager and Nicholson,
1996
; Morley et al.,
1996
; Wang and Peracchia,
1998
).
inx-6 Is Expressed Exclusively in Pharyngeal Tissues
To understand more about how inx-6 affects postembryonic
development, we examined its expression pattern by using GFP reporters. Two
reporter constructs were generated: a transcriptional fusion that consisted of
the inx-6 promoter driving GFP and a translational fusion that fused
the inx-6 promoter to the inx-6 cDNA, which in turn was
fused in frame to GFP. Results from both GFP-expressing transgenes indicated
that inx-6 is first detected during embryogenesis at the comma stage,
in anterior cells that are likely to be the pharyngeal precursors. This
pharynx-specific expression expands during the development of the pharynx to
the end of embryogenesis, whereas inx-6 continues to be expressed in
the corpus muscles and isthmus marginal cells of the pharynx throughout the
larval and adult stages (Figure
3).
|
The translational GFP fusion protein is expressed in a punctate expression
pattern (Figure 3, C and D),
which is very different from the transcriptional fusion
(Figure 3B). Gap junctional
channels often aggregate in plasma membranes to form plaques, an observation
that was confirmed using immunocytochemistry in vertebrate cells
(Kumar and Gilula, 1996
). In
invertebrates, this particular pattern has also been shown by the innexin
protein wEST01007 (INX-3) in C. elegans
(Starich et al.,
1996
). The characteristic expression pattern of INX-6 likely
faithfully represents the normal expression of the INX-6 protein because it
can fully rescue the mutant phenotype, suggesting that the punctate pattern
that we observed for the full-length INX-6::GFP fusion may reflect
the actual subcellular localization of INX-6. We were unable to determine what
membrane surface the plaques associate with. The presence of plaques along the
length of the muscle could indicate that gap junctions are being formed
between the muscle and the intercalated marginal cells
(Albertson and Thomson, 1976
).
However, we cannot rule out that some of the plaques are aggregated proteins
moving between intracellular compartments.
inx-6(rr5) Mutant Pharyngeal Muscles Contract and Respond to Neuronal
Stimuli
If inx-6 is expressed in the pharynx because it is necessary for
efficient pharyngeal pumping, then the inx-6(rr5) mutant might arrest
at the restrictive temperature because it cannot feed. To address this
possibility, we scored the rate of pharyngeal pumping in recently hatched L1
stage larvae at both the permissive and restrictive temperatures. Pumping was
scored by looking at the rhythmic motion of the grinder in the terminal bulb,
the most obvious indicator of muscle contraction. In addition, we scored the
worms both in the presence and absence of serotonin. In adult worms, serotonin
increases pumping from a basal rate of
40 pumps/min to a maximal rate of
250 pumps/min via activation of a pacemaker motor neuron MC. At the
permissive temperature, inx-6(rr5) showed the same pumping rate as
wild-type animals, both in the presence and absence of serotonin, whereas at
the restrictive temperature, its pumping rate was much slower, consistent with
an effect of inx-6(rr5) on pharyngeal function
(Table 2).
|
To see whether the lower pumping frequency of inx-6(rr5)at the
restrictive temperature was sufficient to explain the developmental arrest, we
compared it with an eat-2 mutant. eat-2 encodes a pharyngeal
muscle nicotinic acetylcholine receptor that is necessary for
neurotransmission by the MC pacemaker motor neuron
(Raizen et al.,
1995
). Because neurotransmission from the MC neuron is absent in
the eat-2 mutant, the worms pump at a slow rate and are severely
starved. Nevertheless, eat-2 mutants complete development and are
fertile. Even at the restrictive temperature, inx-6(rr5) mutants pump
faster than the eat-2 mutants, indicating that pumping rate alone is
not sufficient to explain the developmental arrest of rr5. Unlike
eat-2, the inx-6(rr5) mutant still responds to serotonin
with an increased pumping rate, indicating that the MC motor neuron is still
functional, and the pharyngeal muscle is still regulated by the nervous system
(Table 2).
Pharyngeal Muscle Contraction is Unsynchronized in inx-6(rr5)
Mutants
Because differences in pumping rate alone are not sufficient to explain the
developmental arrest of inx-6(rr5), we wanted to know whether there
was a defect in muscle coordination. On closer examination of L1 arrested
inx-6(rr5) larvae, we found that >90% (136/150) of the worms
lacked procorpus contraction when the terminal bulb was contracted compared
with <2% (2/150) of wild-type starvation-arrested L1 worms
(Figure 4). Without procorpus
contraction, no food can enter the pharynx and worms therefore arrest
development as a result of starvation.
The lack of muscle contraction could result from defects in muscle contraction or from defects in electrical excitability. If there were a defect in electrical activity, we should be able to see this in the EPG. Specifically, we hypothesized that inx-6(rr5) affected the flow of excitation from the metacorpus to the procorpus. To test this, we simultaneously recorded video and the EPG of mutant L3-L4 stage larvae that escaped arrest at the restrictive temperature (currents generated by L1 larvae are too small to measure by EPG).
We first examined wild-type L3 stage larvae grown at 25°C, which showed
the muscle motions typical of wild-type adults
(Figure 5, A and B). In
wild-type worms, the radially oriented muscles of the corpus contract slowly
over a period of
200 ms (Avery and
Thomas, 1997
). The contraction pulls the walls of the pharyngeal
lumen open and the opening of the lumen is the most obvious visual
manifestation of muscle contraction. This contraction is terminated by a very
rapid (<20 ms) relaxation of the muscles and closing of the lumen. The
terminal bulb muscles are fully contracted for most of this time, and their
relaxation is delayed slightly relative to corpus relaxation.
|
The timing of muscle relaxation is precisely coordinated with the electrical activity of the pharynx as revealed by the EPG. The EPG is an extracellular recording technique whose trace reflects the time derivative of the muscle membrane potential. In the EPG trace, one or two E spikes correspond to the depolarization of the pharyngeal muscles and one or two R spikes represent the repolarization and return to resting potential. Inhibitory postsynaptic potentials (IPSPs) of the motor neuron M3 usually occur as downward spikes during the plateau phase, which is the period of muscle depolarization delimited by the E and R spikes. Corpus and terminal bulb contraction begin immediately after the E spikes. The corpus muscles are maximally contracted just before the first R spike (R1) and relax immediately after. There is often a much smaller R spike (R2) that follows R1 and precedes terminal bulb relaxation. The only unusual feature of the EPGs we recorded from wild-type L3 stage larvae was the absence of M3 IPSPs during the plateau phase. This is an effect of levamisole, which we used to paralyze the worms for video recording.
Video recording of inx-6(rr5) L3 stage worms confirmed that the coordination of pharyngeal muscle contraction is abnormal. Contraction of the procorpus muscles is weak and their relaxation is premature. As shown in Figure 5C, often the muscles of the procorpus do not contract at all, whereas the muscles of the metacorpus and terminal bulb (not visible) contract almost normally and in synchrony. The EPG trace of the stunted inx-6(rr5) L3 stage worms was faint and difficult to interpret (our unpublished data).
To better understand the effects of inx-6 on the electrical
activity of the pharynx, we examined the somewhat larger L4 and adult
inx-6(rr5) escapers. In spite of the presence of levamisole, we found
negative spikes characteristic of M3 IPSPs in the EPG trace of the
inx-6(rr5) mutants. If these were M3 IPSPs, they would be absent in
an avr-15(ad1051) mutant background because avr-15 encodes a
glutamategated chloride channel subunit that is necessary to form the M3
postsynaptic receptor on the pharyngeal muscle
(Dent et al., 1997
).
However, even in the inx-6(rr5); avr-15(ad1051) double
mutant background, these negative spikes persist
(Figure 5, D and E).
The only other electrical activity known to produce negative spikes is the
spontaneous repolarization of the pharyngeal muscles, mediated in part by the
exp-2 voltage-gated potassium channel
(Davis et al., 1999
).
Usually, there are at most two of these spikes: R1 and R2 (described above).
Because a loss-of-function allele (ad1426) of the exp-2 gene
results in the reduction or absence of negative spikes resulting from muscle
repolarization, we made the inx-6; exp-2 avr-15 triple
mutant. The negative spikes were absent in this triple mutant, indicating that
the spikes in inx-6(rr5) are the result of EXP-2 mediated muscle
repolarization (Figure 5F). The
fact that there are a series of downward spikes in the inx-6(rr5)
single mutant indicates that muscle repolarization is uncoordinated. It is
also interesting to note that whereas in wild-type animals there are one or
two distinct E spikes, initiation of the action potential in
inx-6(rr5) is characterized by a broad upward deflection rather than
a spike, which is consistent with a lack of coordination in muscle
depolarization as well.
The effect of the inx-6(rr5) mutation on the motion of the pharyngeal muscle of L4 stage worms is also consistent with premature and uncoordinated muscle repolarization and relaxation. Instead of a rapid relaxation that occurs immediately after the first R spike, relaxation occurs slowly over a period of 3060 ms beginning shortly after the second negative spike and well before the last spike (Figure 5E). The premature relaxation is evident first in the procorpus, indicating that these muscles are less electrically coupled than the metacorpus.
Cell-Cell Coupling of the Corpus Is Compromised in inx-6(rr5)
Mutants
Because our electrophysiological data indicate that the procorpus of the
inx-6(rr5) mutant has abnormalities in electrical coupling, we
investigated whether inx-6(rr5) may cause gap junction defects. One
effective way to test whether the procorpus of inx-6(rr5) mutants is
appropriately coupled by gap junctions would be to monitor the diffusion of a
fluorescent dye (carboxyfluorescein) among pharyngeal muscles. When animals
are soaked in saturated carboxyfluorescein solution, the dye diffuses into all
the tissues with the exception of the pharyngeal muscles. Instead it
accumulates in the pharyngeal lumen, including the grinder in the terminal
bulb. A single weak laser pulse directed at the posterior edge of the grinder
is enough to perforate the pharyngeal lumen to allow the dye in the grinder to
diffuse into terminal bulb muscles. The dye then diffuses via endogenous
functional gap junctions to progressively more anterior muscles. Because the
laser pulse can sometimes permanently damage the pharynx, we only considered
animals that continued pumping and responded to serotonin appropriately after
laser pulse.
In 100% of the wild-type animals (n >30) that were successfully operated, the dye diffused evenly throughout all pharyngeal muscles within 60 s after the laser pulse (Figure 6, AD). In successfully operated inx-6(rr5) animals, dye spread into the terminal bulb, the isthmus, and the metacorpus at a similar rate as wild type, but failed to diffuse into the procorpus in all cases observed (n >50) (Figure 6, EH). These data are consistent with the inx-6::GFP expression pattern and strongly indicate that the gap junctions required for coupling the procorpus with the metacorpus are functionally compromised in inx-6(rr5) mutants.
|
EAT-5 Can Partially Substitute for INX-6 Function In Vivo
Previous studies showed that the eat-5 mutants also demonstrated a
pharyngeal pumping defect similar to that observed in inx-6(rr5)
mutants. EAT-5 is another C. elegans innexin family member and is a
close homolog to INX-6, sharing >30% sequence identity over the length of
the entire protein.
The inx-6 and eat-5 expression patterns overlap in the pharyngeal muscles of the metacorpus, and they are expressed in adjacent cells (marginal cells and muscles, respectively) of the isthmus. Based on the above-mentioned information, it is possible that inx-6 and eat-5 may function together or have analogous roles in regulating pharyngeal pumping during larval development.
To test whether EAT-5 and INX-6 are functionally interchangeable, we
performed a gene substitution experiment in which the inx-6 promoter
was used to drive the eat-5 coding sequence to induce EAT-5
expression in the region where inx-6 would normally be expressed. The
construct was injected into inx-6(rr5) mutants, and stable transgenic
animals were monitored at restrictive temperature to determine whether the
inx-6::EAT-5 transgene could rescue the inx-6(rr5) mutant
phenotype. Strikingly, we found that the newly hatched transgenic animals
could grow to adulthood at the restrictive temperature
(Table 3). These transgenic
animals are healthy and fertile, although they grow somewhat slower and need
88 h to reach the adult stage compared with
40 h for wild-type
animals at 25°C. The fact that EAT-5 can rescue a mutation in
inx-6(rr5) is strong evidence that inx-6 and eat-5
serve similar but not identical functions in vivo.
|
Ectopic Expression of inx-6 Caused Abnormalities
Because EAT-5 could substitute for INX-6, we were curious whether
ectopically expressed INX-6 would contribute in a benign way to endogenous gap
junctions or whether it might interfere with the proper regulation of
cell-cell coupling. The inx-6 expression pattern showed that
inx-6 is only expressed in the corpus and isthmus tissues, suggesting
that there must be other kinds of gap junction channels in the terminal bulb
muscles to ensure the intact pharyngeal muscle contraction. If the expression
of inx-6 were expanded into the terminal bulb, it could potentially
interact with endogenous innexins and interfere with their functions, or it
could form inappropriate gap junctions between normally isolated cells. To
test this, we used the myo-2 promoter to drive inx-6 coding
sequence in the corpus, isthmus, and the terminal bulb muscles.
The myo-2::INX-6 construct was injected into inx-6(rr5) mutants and wild-type animals. In the F1 generation, most transgenic animals developed relatively normally, including inx-6(rr5) mutants at restrictive temperature, which grew slightly more slowly than wild-type animals. However, in the F2 generation, all the animals expressing the myo-2::INX-6 transgene died as L1 larvae. We found that the pharyngeal lumen of most transgenic animals was wide open due to the hypercontracted pharyngeal muscles (our unpublished data), which presumably rendered the transgenic animals unable to feed. This phenotype is consistent with electrical coupling of cells that are not normally coupled, abnormally increased coupling between cells that are normally coupled, or the formation of open hemichannels on the surface of muscle cells.
| DISCUSSION |
|---|
|
|
|---|
Like connexins, innexins are probably multimeric, although whether
inx-6 forms a homomeric or heteromeric channel remains to be
determined. The precise subunit composition is unknown for any gap junction
formed by innexins, but there are indications that innexins do form
heteromeric channels. UNC-7 and UNC-9 share considerable sequence similarity
and also have similar mutant phenotypes
(Starich et al.,
1993
; Barnes and Hekimi,
1997
). These innexins may associate to form a channel expressed in
the nervous system. Similarly, direct electrophysiological and genetic
evidence indicate that the Drosophila innexins Dm-INX-2 and
Dm-INX-3 form obligate heteromeric channels
(Stebbings et al.,
2000
).
There are several C. elegans innexins expressed in the pharynx
with which inx-6 might associate. For example, inx-6
expression overlaps that of eat-5
(Starich et al.,
1996
). It is interesting, therefore, that eat-5 can
substitute for inx-6, especially because eat-5 does not form
homomeric junctions in Xenopus oocytes
(Landesman et al.,
1999
). It may be that eat-5 can rescue
inx-6(rr5) because it can associate with and stabilize the mutant
INX-6 encoded by rr5. On the other hand, ectopic expression of INX-6
under the myo-2 promoter indicates that it may also form a homomeric
channel. Work in Drosophila showed that expressing one subunit of an
obligate homomer (Dm-inx-2 or Dm-inx-3) has little effect,
but when the two subunits are ectopically coexpressed, they cause severe
developmental defects (Stebbings et
al., 2000
). By analogy, the fact that ectopically expressed
INX-6 has severe effects on the pharynx suggests that either INX-6 is capable
of forming a homomeric channel, or it can associate promiscuously with
endogenous innexin subunits.
Innexin Redundancy in the Pharynx
The temperature-sensitive period (TSP) of inx-6(rr5) suggests that
other innexins may be functionally redundant. Although inx-6 is
expressed from mid-to-late embryogenesis until the adult stage, our TSP
experiments indicated that the inx-6 gene product is only required
for the L1 and L2 larval stages. In spite of its embryonic expression, there
seem to be no abnormalities in the inx-6(rr5) embryos raised at the
restrictive temperature. Therefore, other innexins expressed in the pharyngeal
muscles may act redundantly with inx-6 to ensure pharyngeal
differentiation and morphogenesis. The fact that cell-cell coupling was normal
within the metacorpus in inx-6(rr5) animals, where the
inx-6::GFP is strongly expressed in wild-type may reflect such
redundancy. Other innexin members such as eat-5 in the metacorpus may
form functional gap junctions independent of inx-6, and thereby
permit diffusion of dye and synchronization of action potentials among
metacorpus muscles. That inx-6(rr5) animals can survive at the
restrictive temperature as an adult may also reflect redundancy. However, at
present we cannot exclude that high temperature prevents assembly or transport
of the mutant INX-6 protein, and conversely wild-type protein normally remains
stable and persists.
If innexins are largely redundant, then ectopic expression of an innexin in a wild-type background should have no ill effects. In contrast, we found that ectopic expression of inx-6 in the terminal bulb, not replacing but rather supplementing the innexins that are normally expressed there, causes the pharynx to hypercontract. Although we cannot rule out the possibility that overexpression from the multicopy transgene causes this phenotype, it is unlikely because inx-6::INX-6containing transgenic arrays show no such effect. It is also unlikely that inx-6 is associating with endogenous channels of the terminal bulb and acting as a dominant negative allele because reducing gap junctions should reduce the excitability of muscles, not cause hypercontraction. inx-6, acting alone or in association with endogenous innexins, might increase the degree of coupling. Variations on this model are that ectopically expressed inx-6 is coupling cells that are normally isolated or that it forms permeable hemichannels in the cell membrane. Either way, the severe phenotype of inx-6 expressed in the terminal bulb argues against a simple model of innexin redundancy wherein ectopic expression of an innexin in cells that already have innexins has no effect.
Innexin Specialization and the Role of Gap Junctions in Pharyngeal
Muscle Contraction
The 20 muscle cells of the pharynx must contract with precise timing to
ensure appropriate function of this organ. Thus, electrical coupling of
pharyngeal muscles is of the utmost importance. The need for so many different
innexins in a simple organ such as the pharynx is less clear. Our video,
electrophysiological, GFP reporter expression, and dye-coupling data all
suggest that inx-6 is involved specifically in coupling the
metacorpus to the procorpus. Whence the need for an innexin dedicated to this
task?
One explanation is that the innexin subunits are functionally equivalent and the specialization is in their pattern of expression. By driving eat-5 with the inx-6 promoter, we showed that this transgene could rescue the larval arrest of the inx-6(rr5) mutants but, unlike an inx-6::INX-6 transgene, could not entirely restore wild-type growth rate. Thus, the functional properties of eat-5 and inx-6 must be similar but not identical. Although eat-5 and inx-6 may be redundant in the metacorpus, inx-6 seems to be better suited to couple the pro- and metacorpus.
If the innexin proteins are not perfectly interchangeable, what might be
the properties that make them uniquely suited to couple specific cells? Here,
we can only speculate. Subunit specific properties might include ability to
form heterotypic interactions, voltage sensitivity, or regulation by second
messengers. However, an understanding of the unique requirements of the pro-
to metacorpus gap junctions may inform our speculation. Neuronal control is
necessary for efficient pharyngeal function and the motor neurons seem to
interact primarily with the metacorpus muscles. The motor neurons that
regulate pharyngeal contraction and relaxation, MC and M3, are both corpus
neurons and M3 synapses onto the metacorpus
(Albertson and Thomson, 1976
;
Raizen and Avery, 1994
;
Raizen et al., 1995
).
Presumably, the effects of these neurons on metacorpus muscle membrane
potential must be transmitted to the rest of the pharyngeal muscles to
maintain synchrony. Thus, it seems that eat-5 ensures the posterior
propagation, and inx-6 the anterior propagation, of changes in
membrane potential originating in the metacorpus.
Our results indicate that although the metacorpus drives depolarization of
both the procorpus and terminal bulb, there are different requirements for the
control of current flow in each case. The multiple spikes in the
inx-6(rr5) EPG indicate that when coupling to the metacorpus is
compromised, the procorpus muscles repolarize prematurely. Although we were
not able to correlate these spikes with relaxation of specific muscles, it is
unlikely that these are R2 spikes, because, even in wild-type worms, the R2
spike that corresponds to terminal bulb relaxation is usually smaller that the
R1 spikes seen in the inx-6(rr5) mutant (compare R2 in
Figure 5B to the R spikes in
Figure 5E). Rather, it seems
that in the L4 stage inx-6(rr5) worms the corpus muscles contract
normally (Figure 5D, frame 2)
but that individual procorpus muscles begin relaxing prematurely. Thus, these
spikes likely represent premature procorpus repolarizations. The implication
is that the procorpus needs the metacorpus not only to initiate depolarization
but also to maintain it. In contrast, the repolarization and relaxation of the
terminal bulb muscles lags those of corpus. Moreover, in the eat-5
mutant, uncoupling the corpus from the terminal bulb reveals that the terminal
bulb seems to have its own pacemaker
(Starich et al.,
1996
),
It would make sense then that gap junctions formed by INX-6 would differ from those formed by EAT-5. Assuming that the metacorpus drives both depolarization and repolarization of the procorpus, the INX-6 gap junctions would be relatively passive. However, because (in this model) the metacorpus must drive terminal bulb depolarization but then be immune to the continued depolarization of the terminal bulb after the metacorpus repolarizes and relaxes, one might predict that the gap junction formed by EAT-5 would rectify.
| CONCLUSIONS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
* Corresponding author. E-mail address: richard.roy{at}mcgill.ca.
| REFERENCES |
|---|
|
|
|---|
Avery, L. (1993). The genetics of feeding in Caenorhabditis elegans. Genetics 133, 897917.[Abstract]
Avery, L., and Thomas, J.H. (1997). Feeding and defecation. In: The Nematode C. elegans II. ed. D. Riddle, Cold Spring Harbor, NY: Cold Spring Harbor Press, 679716.
Barnes, T.M., and Hekimi, S. (1997). The Caenorhabditis elegans avermectin resistance and anesthetic response gene unc-9 encodes a member of a protein family implicated in electrical coupling of excitable cells. J. Neurochem. 69, 22512260.[Medline]
Bauer, R., Lehmann, C., Fuss, B., Eckardt, F., and Hoch, M.
(2002). The Drosophila gap junction channel gene innexin
2 controls foregut development in response to Wingless signalling. J.
Cell Sci. 115,
18591867.
Bergoffen, J., Scherer, S.S., Wang, S., Scott, M.O., Bone, L.J.,
Paul, D.L., Chen, K., Lensch, M.W., Chance, P.F., and Fischbeck, K.H.
(1993). Connexin mutations in X-linked Charcot-Marie-Tooth
disease. Science 262,
20392042.
Brenner, S. (1974). The genetics of Caenorhabditis
elegans. Genetics 77,
7194.
Bruzzone, R., White, T.W., and Paul, D.L. (1996). Connections with connexins: the molecular basis of direct intercellular signaling. Eur. J. Biochem. 238, 127.[Medline]
Crompton, D., Todman, M., Wilkin, M., Ji, S., and Davies, J. (1995). Essential and neural transcripts from the Drosophila shaking-B locus are differentially expressed in the embryonic mesoderm and pupal nervous system. Dev. Biol. 170, 142158.[CrossRef][Medline]
Curtin, K.D., Zhang, Z., and Wyman, R.J. (1999). Drosophila has several genes for gap junction proteins. Gene 31, 191201.
Davis, M.W., Fleischhauer, R., Dent, J.A., Joho, R.H., and Avery,
L. (1999). A mutation in the C. elegans EXP-2 potassium
channel that alters feeding behavior. Science
286,
25012504.
Dent, J.A., Davis, M.W., and Avery, L.A. (1997). avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans. EMBO J. 16, 58675879.[CrossRef][Medline]
Dent, J.A., Smith, M.M., Vassilatis, D.K., and Avery, L. (2000). The genetics of ivermectin resistance in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 197, 26742679.
Ewart, J.L., et al. (1997). Heart and neural tube defects in transgenic mice overexpressing the Cx43 gap junction gene. Development 124, 12811292.[Abstract]
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806811.[CrossRef][Medline]
Furshpan, E.J., and Potter, D.D. (1957). Mechanism of nerve-impulse transmission at a crayfish synapse. Nature 180, 342343.[CrossRef][Medline]
Haun, C., Alexander, J., Stainier, D.Y., and Okkema, P.G.
(1998). Rescue of Caenorhabditis elegans pharyngeal
development by a vertebrate heart specification gene. Proc. Natl. Acad.
Sci. USA 95,
50725075.
Hong, Y., Roy, R., and Ambros, V. (1998). Developmental regulation of a cyclin-dependent kinase inhibitor controls postembryonic cell cycle progression in Caenorhabditis elegans. Development 125, 35853597.[Abstract]
Gabriel, H.D., Jung, D., Butzler, C., Temme, A., Traub, O.,
Winterhager, E., and Willecke, K. (1998). Transplacental uptake
of glucose is decreased in embryonic lethal connexin26-deficient mice.
J. Cell Biol. 140,
14531461.
Kanter, H.L., Saffitz, J.E., and Beyer, E.C. (1994). Molecular cloning of two human cardiac gap junction proteins, connexin40 and connexin45. J. Mol. Cell. Cardiol. 26, 861868.[CrossRef][Medline]
Kelsell, D.P., Dunlop, J., Stevens, H.P., Lench, N.J., Liang, J.N., Parry, G., Mueller, R.F., and Leigh, I.M. (1997). Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature 387, 8083.[CrossRef][Medline]
Krishnan, S.N., Frei, E., Swain, G.P., and Wyman, R.J. (1993). Passover: a gene required for synaptic connectivity in the giant fiber system of Drosophila. Cell 73, 967977.[CrossRef][Medline]
Kumar, N.M., and Gilula, N.B. (1996). The gap junction communication channel. Cell 84, 381388.[CrossRef][Medline]
Landesman, Y., White, T.W., Starich, T.A., Shaw, J.E., Goodenough, D.A., and Paul, D.L. (1999). Innexin-3 forms connesin-like intercellular channels. J. Cell Sci. 112, 23912396.[Abstract]
Lipshitz, H.D., and Kankel, D.R. (1985). Specificity of gene action during central nervous system development in Drosophila melanogaster: analysis of the lethal (1) optic ganglion reduced locus. Dev. Biol. 108, 5677.[CrossRef][Medline]
Maduro, M.F., Meneghini, M.D., Bowerman, B., Broitman-Maduro, G.,
and Rothman, J.H. (2001). Restriction of mesendoderm to a single
blastomere by the combined action of SKN-1 and a GSK-3
homolog is
mediated by MED-1 and -2 in C. elegans. Mol. Cell
7,
475485.[CrossRef][Medline]
Mello, C.C., Kramer, J.M., Stinchcomb, D., and Ambrose, V. (1991). Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10, 39593970.[Medline]
Morley, G.E., Taffet, S.M., and Delmar, M. (1996).
Intramolecular interactions mediate pH regulation of connexin43 channels.
Biophys. J. 70,
12941302.
Nicholson, B., Dermietzel, R., Teplow, D., Traub, O., Willecke, K., and Revel, J.P. (1987). Two homologous protein components of hepatic gap junctions. Nature 329, 732734.[CrossRef][Medline]
Phelan, P., Nakagawa, M., Wilkin, M.B., Moffat, K.G., Okane, C.J.,
Davies, J.A., and Bacon, J.P. (1996). Mutations in
Shaking-B prevent electrical synapse formation in the
Drosophila giant fiber system. J. Neurosci.
16,
11011113.
Phelan, P., et al. (1998a). Innexins: a family of invertebrate gap-junction proteins. Trends Genet. 14, 348349.[CrossRef][Medline]
Phelan, P., Stebbings, L.A., Baines, R.A., Bacon, J.P., Davies, J.A., and Ford, C. (1998b). Drosophila shaking-B protein forms gap junctions in paired Xenopus oocytes. Nature 391, 181184.[CrossRef][Medline]
Phelan, P., and Starich, T.A. (2001). Innexins get into the gap.