![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, Issue 7, 2645-2654, July 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biology, The Johns Hopkins University, Baltimore, Maryland 21218
Submitted January 27, 2003;
Revised February 25, 2003;
Accepted February 25, 2003
Monitoring Editor: David Drubin
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
; Goodson and Hawse,
2002). Arps seem to function in heterologous pairs (reviewed in
Schafer and Schroer, 1999)
such as Arp7/Arp9 (Cairns et al.,
1999) or Arp2/Arp3 (Kelleher
et al., 1995), a fact that remains unexplained to date.
Arp functions are as varied as their localization. Nuclear Arps are believed
to play a role in chromatin remodeling
(Peterson et al.,
1998; Boyer and Peterson,
2000; Kato et al.,
2001), whereas cytosolic Arps contribute to actin filament
assembly and organization (Suetsugu et
al., 2001; Weaver et
al., 2001) and intracellular vesicular trafficking
(Holleran et al.,
1998). Arps2 and 3 are important regulators of cytoskeletal
dynamics, but other Arps seem to function primarily as structural
proteins.
In vertebrate cells, the dynein accessory protein dynactin is required for
the processive dynein-based movement of vesicular cargo along microtubules
(Gill et al., 1991;
Schroer and Sheetz, 1991).
Dynactin has also been implicated in cortical anchoring of spindle
microtubules (Busson et al.,
1998), attachment of interphase microtubules to adhesion plaques
(Ligon et al., 2001;
Palazzo et al.,
2001), and microtubule anchoring at centrosomes
(Quintyne et al.,
1999). Dynactin contains two different actin-related proteins,
Arp1 and Arp11. Arp1 forms a short polymer of uniform size that has proteins
bound along its length and at both ends. One end terminates in the
conventional actin capping protein CapZ, suggesting an analogy to the Arp1
filament "barbed" end (Schafer
et al., 1994). The other end of the Arp1 polymer is
associated with a tetrameric protein assembly referred to as the pointed end
complex (Eckley et al.,
1999). This dynactin subcomplex contains Arp11 plus the dynactin
subunits p62, p27, and p25.
Careful analysis of the composition of highly purified dynactin reveals one
monomer of conventional 
-actin in each dynactin molecule
(Schafer et al.,
1994; Bingham and Schroer,
1999), although some dynactin preparations are reported to lack
actin (Holleran et al.,
1996). We assume actin coassembles with Arp1, but its exact
location in the 37-nm minifilament is unknown. Either CapZ or p62 might
interact with actin, because both proteins can bind actin filaments
(Cooper and Pollard, 1985;
Garces et al., 1999).
Because p62 and CapZ are found at opposite ends of the Arp1 minifilament
(Schafer et al.,
1994), a rigorous assignment of actin's location within dynactin
has not been possible. In vitro translated Arp1 has been reported to bind to,
and cycle with, actin (Melki et
al., 1993), suggesting actin may be randomly incorporated in
the Arp1 minifilament. However, if actin's position in the Arp1 minifilament
is fixed, it might provide insight into the assembly pathway of dynactin.
The predicted structure of Arp11 suggests it has the potential to bind
conventional actin or Arp1 and possibly contribute to filament assembly. The
barbed end face of Arp11 is relatively conserved
(Eckley et al.,
1999), suggesting it can interact with filament pointed ends.
Arp11 might function like Arp2/3 complex to nucleate assembly of either actin
or Arp1 filaments. Actin assembly is well known to be governed in this way,
but Arp1 has a vanishingly low critical concentration for polymerization
(<1 nM) and assembles without a lag phase, suggesting nucleation is not
required (Bingham and Schroer,
1999). Interestingly, the filaments formed by pure, isolated Arp1
are variable in length, unlike the Arp1 filaments in dynactin, suggesting that
other dynactin components provide a ruler activity that governs Arp1 assembly.
Arp1 filaments are also able to undergo end-to-end annealing
(Bingham and Schroer, 1999), a
behavior never seen for dynactin. CapZ and subunits of the pointed end complex
are believed to cap the ends of the Arp1 filament and prevent annealing. Of
the four pointed-end complex subunits, Arp11 and p62 are most tightly
associated with dynactin and are therefore the dynactin subunits most likely
to be bound directly to Arp1.
In the present study, we explore the actin-binding properties of Arp11 in copelleting and cycling assays. Fractionation and immunoblot analysis of cultured cells to characterize the subcellular distribution of cytosolic Arp11 reveal that Arp11 is associated exclusively with dynactin. In vitro translated Arp11 and Arp1 can be coprecipitated, suggesting they bind each other. The absence of a free Arp11 pool in cells allowed us to develop an assay for Arp1/Arp11 interactions in vivo. Coexpression of Arp11 and Arp1 decreases the number of Arp1 cables that form when Arp1 is overexpressed in cultured cells. Finally, we showed that a putative fruit fly homolog of Arp11 acts similarly to vertebrate Arp11, verifying its identity as Arp11 and highlighting the significance of the Arp11/Arp1 interaction.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
-actin was kindly provided by S. Lewis and N. Cowan
(Melki et al., 1993)
Human Arp1 was cloned in pET3d as described previously
(Lees-Miller et al.,
1992). To make Arp11, a HindIII fragment from the
full-length Arp11 clone (Eckley et
al., 1999) was cloned into the pRSET-B (Invitrogen, San
Diego, CA) to generate T7-Arp11(23–417). The T7-Arp11 (23–417)
construct was digested with NcoI. The smaller fragment was cloned
into the pR-SET-B NcoI site to generate T7-Arp11 (23–137) and
the larger NcoI fragment was religated to generate T7-Arp11
(138–417). To make a full-length Arp11 construct, we removed upstream,
noncoding sequences from the open reading frame by polymerase chain reaction.
The upstream primer GCGGATCCATGCATCATCATCATCATCATATGCCGCTCTACGAG appends a
6-histidine tag (His tag) to the N terminus of Arp11. Addition of the
downstream primer CCACAATCCAGGACCATGGCCG allowed amplification of a 450-base
pair fragment of Arp11 cDNA, with a His tag. The fragment was cloned into
T7-Arp11 (138–417) by using BamHI and NcoI to generate
T7-His-Arp11 (out of frame). T7-His-Arp11(1–417) was made by digesting
T7-His-Arp11(out of frame) with BamHI, filling in overhangs with
Klenow fragment (New England BioLabs, Beverly, MA) and religating.
T7-His-GFP-Arp11 was made by cloning the appropriate NcoI fragment
from GFP-Arp11 (1–417) into the NcoI site of T7-Arp11
(138–417).
In Vitro Transcription/Translation
Coupled transcription/translation reactions were carried out as directed by
the manufacturer (TnT; Promega). Plasmid DNA and [35S]methionine
were added to TnT mix and the reaction was incubated at 30°C for 90 min.
Test proteins were prepared by 20-fold dilution of each TnT reaction with
G-buffer (2 mM Tris-Cl, pH 8, 0.2 mM ATP, 0.2 mM CaCl2, 0.5 mM
dithiothreitol) followed by a clearing spin to remove aggregates (186k g-hour:
55 krpm, 1 h, 20°C; TLA-55 rotor). In some experiments, 100-µl aliquots
were snap frozen in liquid nitrogen and stored at –80°C until
use.
Actin Copelleting/Cycling
Skeletal muscle actin or cytoplasmic actin (1-mg aliquots) were purchased
from Cytoskeleton (Denver, CO). Actin was diluted in fresh G-buffer to a
concentration of 200 µM and cleared of aggregates (186k g, 1 h) before use.
Binding and cycling experiments were performed using
[35S]D-methionine (PerkinElmer Life Sciences, New
Bedford, MA) labeled test proteins that were freshly prepared or frozen in
aliquots (see above). Actin was added to the precleared test proteins at a
concentration of 5 µM and the sample was split equally into two tubes. Then
10x KMEI (500 mM KCl, 10 mM MgCl2, 10 mM EGTA, 100 mM
imidazole, pH 7.0) was carefully added to final concentration of 1x in
one tube to start actin polymerization; G-buffer was added to the other. After
4 h at 20°C, actin filaments were pelleted by a 186k g-hour spin. The
supernatants were removed and the pellet surfaces gently washed with G-buffer.
Next, the pellets were resuspended in G-buffer and incubated on ice overnight
to depolymerize the actin filaments. The samples were centrifuged for 186k
g-hour to remove insoluble protein aggregates. Then 10x KMEI was added
to the supernatant to induce a second round of polymerization. Finally, actin
filaments were pelleted at 186k g-hour. Aliquots of the supernatants and
pellets from all preceding steps were analyzed by SDS-PAGE and
autoradiography. Pellet resuspension buffer (30 mM Tris-HCl, pH 6.8, 5%
glycerol, 2.5% -mercaptoethanol, 0.5 mM EDTA, 6 M urea) was used to
carefully resuspend each pellet (after a wash with G-buffer) in the exact
volume of the starting supernatant. For actin-binding assays, aliquots of the
pellet and supernatant fractions were analyzed by SDS-PAGE. Gels were fixed
and stained in 0.5 M sodium salicylate in 30% methanol containing 1 mg/ml
Coomassie Blue R-250 for 30 min at room temperature, and then destained in two
changes of 0.5 M sodium salicylate in 30% methanol. Gels were dried, scanned
(Scanmaker III; Microtek, Redondo Beach, CA) to document the behavior of
actin, and exposed to x-ray film for 4–48 h at –80°C with an
intensifying screen.
Bead Precipitation
In vitro-translated proteins were prepared as described above. Test protein
(untagged Arp1) was diluted 1:10 in buffer and precleared with Talon beads (BD
Biosciences Clontech, Palo Alto, CA). The supernatant was used immediately for
precipitation studies. His-Arp11 or His-GFP-Arp11 were mixed with fresh Talon
beads on ice. Arp1 was added to beads alone, or with beads plus tagged Arp11
and allowed to bind for 15 min on ice. The beads were pelleted at 200 x
g for 1 min, the supernatant was removed, and the beads were washed
four times before resuspending in buffer at the original volume of binding
mixture. Then 50% of each pellet sample was boiled in sample buffer and loaded
on a 10% polyacrylamide gel. The gel was processed for autoradiography and
exposed to film, as described above.
Cell Fractionation
Cells were harvested by trypsinzation or scraping with a rubber spatula and
resuspended in cell lysis buffer [10 mM HEPES, pH 7.4, 150 mM NaCl, 1 µg/ml
each leupeptin, pepstatin, N
-p-tosyl-L-arginine methyl ester,
N-benzoyl-L-arginine methyl ester,
N-tosyl-L-phenylalanine chloromethyl ketone,
N-tosyl-L-lysine chloromethyl ketone, and
4-(2-aminoethyl)benzenesulfonyl fluoride]. Cells were pelleted in a Dynac
clinical centrifuge at setting 30% for 5 min. The pellet volume was determined
and an equal volume of buffer was added to resuspend the cells. Cells were
homogenized using a ball bearing homogenizer of inner diameter 8.020 mm
containing a ball bearing of 8.014 mm. A nuclear pellet (P1) was prepared by a
9300-rpm spin in a swinging bucket rotor (Eppendorf 5417; 12-place rotor), for
10 min at 4°C. The supernatant was cleared of all membranes by
ultracentrifugation at 55 krpm for 1 h at 4°C in a Beckman TLA55 fixed
angle rotor. The high-speed cytosol (S2) was saved for further analysis. The
pellets (P1 and P2) were resuspended in cell lysis buffer to the same volume
as the original cell pellet.
Sucrose Gradient Fractionation
Sucrose gradients (5–20% in G-buffer) were prepared using a 15-ml
Hoefer gradient maker and drill-propelled rotary stirrer and pumped into 14
x 89 mm ultraclear tubes. The resulting 11.6-ml gradients were overlaid
with up to 500 µl of sample (e.g., diluted in vitro
transcription/translation mix or S2), and subjected to ultracentrifugation at
34 krpm for 16.5 h at 4°C in an SW41 rotor. A gradient containing
sedimentation standard proteins (thyroglobulin, 18.2S; catalase, 11.6S;
-amylase, 9S; alcohol dehydrogenase, 7.5S; and serum albumin, 4.2S) was
included in every run. Fractions (1 ml) were collected with a pump from the
bottom of each gradient and stored on ice before SDS-PAGE analysis. Pellets
were resuspended in 1 ml of pellet resuspension buffer (see above).
Immunoblotting and Antibodies
Samples were analyzed by SDS-PAGE and transferred to polyvinylidene
difluoride membranes (Immobilon-P; Millipore, Bedford, MA) overnight at 20 V
in Towbin transfer buffer (Towbin et
al., 1979). Transfer was verified by the appearance of
prestained Marker proteins (Bio-Rad, Hercules, CA), Pyronin Y tracking dye
(Sigma-Aldrich, St. Louis, MO) and Ponceau S (Sigma-Aldrich) stain for total
protein. Proteins of interest were detected using monoclonal or polyclonal
antibodies followed by alkaline phosphatase-conjugated secondary antibodies
and chemiluminescence according to the manufacturer's instructions (Tropix,
New Bedford, MA). Dynactin subunits p150Glued and Arp1 were
detected with monoclonal antibodies 150B and 45A
(Schafer et al.,
1994). Monoclonal anti-GFP and antiactin (C4;
Lessard, 1988) antibodies were
purchased from Babco (Berkeley, CA). A polyclonal serum recognizing Arp11
(Michael Way, Imperial Cancer Research Fund, London, United Kingdom) was
generated by immunizing rabbits with synthesized peptides corresponding to the
Arp11 N terminus or C termini.
GFP Fusion Protein Expression
An N-terminal GFP fusion with Arp11 (AA 23–417) was created by
cloning the HindIII fragment from a full-length Arp11 clone
(Eckley et al., 1999)
into the HindIII site of pEGFP-C2 (BD Biosciences Clontech). An
N-terminal fusion of GFP to the complete Arp11 open reading frame (residues
1–417) was generated in a two-step process. First, a
SalI/BstXI fragment from expressed sequence tag (EST)
AA250667
[GenBank]
was ligated into the above-mentioned construct digested with
XhoI and BstXI. Second, a BamHI/BglII
fragment (containing the complete Arp11 open reading frame) was cloned into
pEGFP-C1 (BglII digested) to make GFP-Arp11 (1–417). The
Drosophila melanogaster Arp11 open reading frame (EST LD36140) was
fused downstream of GFP by cloning an EcoRI/XhoI fragment
into pEGFP-C1 digested with EcoRI and SalI.
Electroporation and Immunostaining
Fifteen micrograms of each DNA construct was mixed with 2 x
106 cells in a volume of 400 µl just before electroporation.
HeLa or COS-7 cells were electroporated at 280V, 1600 µF (BTX ECM600) in
4-mm gap cuvettes. Cells were diluted in Opti-MEM (1.5 ml/cuvette) and
incubated at room temperature for 20 min before plating onto coverslips in
complete medium containing serum. Cell cultures were grown overnight at
37°C under 5% CO2 atmosphere. At 18–24 h postplating,
coverslips were fixed for 5 min in –20°C methanol. Fixed cells were
rehydrated by three changes of blocking buffer (phosphate-buffered saline + 1%
bovine serum albumin). Primary antibodies were diluted into blocking buffer
and coverslips were incubated for 30 min at room temperature. After three
washes with blocking buffer, the coverslips were incubated with secondary
antibodies for 30 min at room temperature. Final washes were performed in the
presence of 4,6-diamidino-2-phenylindole (10 ng/ml) to visualize chromatin.
Coverslips were mounted in MOWIOL containing 1 mg/ml N-propyl
gallate. Cells were viewed through an Axiovert microscope (Carl Zeiss, Jena,
Germany) equipped with a 100x Plan-Neofluor objective, numerical
aperture 1.3, and GFP/fluorescein and Texas Red filters (Chroma Technologies,
New Bedford, MA).
Genomic Analysis
Putative dynactin subunit genes were identified by BLAST search of the
predicted gene product database, at the Biotechnology and Biological Sciences
Research Council, Institute for Animal Health Chicken EST repository Web site,
http://www.chick.umist.ac.uk/,
the Berkeley Drosophila Genome project Web site,
http://www.fruitfly.org/,
the Welcome Trust Sanger Institute Web site,
http://www.sanger.ac.uk/Projects/C_elegans/blast_server.shtml,
or the Neurospora crassa database (Munich information centre for
protein Neurospora crassa database),
http://mips.gsf.de/proj/neurospora/.
Direct alignments between imported amino acid sequences representing the mouse
and putative chicken, fly, worm, or fungus dynactin subunits were performed at
the National Center for Biotechnology Information BLAST 2 sequences Web site,
http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html.
Arp1, CapZ , CapZ, p25, p27, Arp11, p62, p150Glued,
p50 (dynamitin), and p24 were found at the following loci, respectively:
D. melanogaster, CG6174, CG17158, CG10540, CG10846, CG17347, CG12235,
CG12042, CG9206, CG8269, and CG9893; and Caenorhabditis elegans,
Y53F4, M106.5, D2024.6, Y71F9AL, Y54E10A, C49H3.9, C26B2.2, ZK593, C28H8.8,
and W02A2.2. Neurospora crassa Arp1 is encoded by Ropy 4, p25 by
Ropy-12, Arp11 by Ropy-7, p62 by Ropy-2, and p150Glued by Ropy-3.
Chicken (Gallus gallus) sequences were identified in the EST
repository except p150Glued and dynamitin whose sequences are
published (Gill et al.,
1991; Quintyne et
al., 1999; Valetti et
al., 1999).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). Sucrose
gradient fractionation of the reticulocyte lysate without added Arp11 cDNA
revealed endogenous dynactin which sedimented at about 18S
(Figure 1A). Before assaying
the interactions of Arp11 with actin, we used velocity sedimentation to
determine how much in vitro translated Arp11 was present in a "free
pool" and how much had been incorporated into reticulocyte dynactin
(Figure 1B). In
vitro-translated Arp1, Arp11, and actin were all found predominately near the
top of the sucrose gradient, suggesting that they were not incorporated into
reticulocyte dynactin during the 90 min required for expression.
|
Next, we tested the ability of in vitro translated Arp11 to coassemble with
purified actin. The behaviors of in vitro-translated Arp1, human -actin,
and luciferase were analyzed as controls. Proteins were mixed with purified
rabbit skeletal muscle actin and subjected to two cycles of actin filament
assembly and disassembly (Figure
2A). That none of the test proteins pelleted in G-buffer (lane 1)
indicates they all were soluble. To verify that the proteins that copelleted
with F-actin (lane 3) were truly coassembled, the resulting F-actin pellet was
depolymerized, cleared of aggregates (lane 5), and the supernatant (lane 6)
subjected to a second round of polymerization. The final pellets (lane 7)
contain proteins that are able to cycle with F-actin. As reported previously
(Melki et al., 1993),
Arp1 cycled with purified actin. Arp11 was also found to cycle with skeletal
muscle actin. A small amount of luciferase was trapped in the initial F-actin
pellet but did not cycle. Similar results were obtained when purified platelet
cytoplasmic actin was used in place of skeletal muscle actin (our unpublished
data).
|
We then mapped the Arp11 domain required for actin binding (Figure 2B). An N-terminal fragment (AA 23–137) could copellet with actin, whereas a nonoverlapping C-terminal fragment (AA 138–417) could not. Thus, a minimal actin-binding domain of Arp11 is present in amino acids 23–137.
Arp11 Is Present in Membrane-associated and Cytosolic Pools
Recombinant Arp1 can bind and coassemble with actin
(Figure 2; Melki et al., 1993)
but Arp1 is not believed to contribute to actin dynamics in vivo because a
free Arp1 pool does not exist in any cell type examined to date
(Paschal et al.,
1993; Echeverri et
al., 1996; Quintyne
et al., 1999; Valetti
et al., 1999). Arp11 can also bind and coassemble with
actin, raising the possibility that it might play a role outside dynactin,
perhaps to regulate the behavior of the actin cytoskeleton. To explore this
possibility, we first assayed cells for a free pool of Arp11. Cytosol prepared
from cultured COS-7 cells was subjected to velocity sedimentation into a
5–20% sucrose gradient and the resulting gradient fractions were
analyzed by immunoblotting (Figure
3A). Most cytoplasmic actin sedimented in the low-density
fractions; notably, a small but detectable pool was found at about 18S. As
expected, the dynactin subunits Arp1 and p150Glued sedimented in a
peak at about 18S, consistent with assembly into a large complex. Arp11
behaved indistinguishably from Arp1 and p150Glued, suggesting that
it, too, is present only in dynactin. Similar results were obtained using HeLa
cytosol (our unpublished data).
|
This and all previously published work on dynactin structure and
composition have focused on the cytosolic pool of dynactin. When we surveyed
different subcellular fractions we found considerable dynactin (i.e.,
p150Glued, Arp1, and Arp11 subunits) in the high-speed membrane
pellet (Figure 3B, P2;
Bingham et al., 1998).
To determine how similar this pool was to cytosolic dynactin, we solubilized
the membrane pellet with nonionic detergent (NP40). NP40 caused complete
release of the dynactin subunits p150Glued and Arp1 from the
residual membrane pellet (our unpublished data). We then sedimented the
resulting NP40-soluble supernatant into a sucrose gradient
(Figure 3B). Arp1 and
p150Glued both sedimented at approximately 18S, similar to their
behavior in NP40 lysates of whole cells
(Echeverri et al.,
1996; Quintyne et
al., 1999; Valetti et
al., 1999). This indicates that NP40 does not significantly
affect the integrity of membrane-associated dynactin and further reveals that
membrane-associated and cytosolic dynactins are similar.
Arp11 Can Bind Arp1 in Solution
The data in Figure 2
indicate clearly that Arp11 can bind and coassemble with conventional actin.
Unfortunately, we could not perform a similar analysis of Arp11/Arp1 binding
owing to the difficulty in obtaining purified Arp1 and the fact that Arp1
polymers do not cycle (Bingham, Ph.D. thesis). In the course of the actin
cocycling experiments, we noted that in vitro cotranslation of Arp1 and Arp11
yields proteins that sediment further into sucrose gradients than the
individual species (Figure 1, compare C and
B). This suggested that Arp1 and Arp11 might form complexes in
solution. We explored this possibility by examining the ability of the two in
vitro translated proteins to be coprecipitated. Arp1 and Arp11 normally
migrate very closely on SDS-PAGE, so to ensure they would be resolved we
engineered two hexahistidine-tagged forms of Arp11 (His-Arp11 and
His-GFP-Arp11). Both were assayed for their ability to coprecipitate untagged
Arp1 (Figure 4). Little, if
any, Arp1 was precipitated by beads alone, but both His-tagged forms of Arp11
coprecipitated Arp1.
|
Arp11 Can Associate with Arp1 in Cultured Cells
We extended our in vitro analysis of Arp1/Arp11 binding by examining the
ability of the two proteins to interact within cells. To do this, we took
advantage of the fact that Arp1 forms organized aggregates when overexpressed
in cultured PtK cells (Holleran et
al., 1996). Arp1 overexpression in HeLa cells yields a
variety of localization patterns (Figure
5). The most prevalent is a punctate distribution with an
accumulation at centrosomes that is similar to untransfected controls
(Figure 5B). However, a subset
of cells (30–40%; Table
1) exhibit a striking phenotype in which Arp1 "cables"
accumulate on or near nuclei (Figure 5, A
and C; Holleran et
al., 1996). Some cells contained large Arp1 aggregates (our
unpublished data), but these were excluded from further analysis.
Arp1-overexpressing cells exhibited variable numbers of cables and the cables
varied in size. Overexpression of GFP-tagged Arp11, in contrast, yielded a
punctate, diffuse pattern (Figure 5,
B' and C') in all cells examined. We confirmed that
GFP-Arp11 is functional by evaluating its incorporation into dynactin.
Sedimentation of a high-speed cytosol into a 5–20% sucrose gradient
revealed a sizeable population of GFP-Arp11 that sedimented at 20S
(Figure 3C), suggesting it can
be assembled into dynactin.
|
|
Our coprecipitation analysis (Figure 4) indicate that Arp1 and Arp11 can interact in a reticulocyte lysate. If overexpressed Arp11 is able to form complexes with overexpressed Arp1 in HeLa cells, this might prevent formation of large Arp1 aggregates. We therefore determined the prevalence of the Arp1 overexpression phenotypes (i.e., punctate staining versus cables) in cells coexpressing both proteins (Table 1). The major consequence of cooverexpression of GFP-Arp11 with Arp1 was the reduction of the percentage of cells exhibiting Arp1 cables and a corresponding increase in the percentage of cells showing a diffuse punctate distribution. In cells that still contained cables, they ranged in both number and length, similar to what we saw in cells overexpressing Arp1 alone. Our results suggest that GFP-Arp11 can interact with overexpressed Arp1 to prevent the formation of organized cables. Preliminary analysis did not reveal a readily discernible increase in slowly sedimenting pool of Arp1 (our unpublished data), so we could not characterize this effect further.
The fly genome contains a possible ortholog of Arp11
(Figure 6), the gene for which
(CG12235; Bourbon et al.,
2002) is essential, as expected for a dynactin subunit
(Spradling et al.,
1999). However, the degree of relatedness to vertebrate Arp11 is
low. CG12235 shares only 40% identity with vertebrate Arp11, compared with the
80% or higher identity seen for fly versus vertebrate Arp1 or -actin
(Table 2). To verify that
CG12235 encodes a true Arp11 homolog we tested its ability to interact with
Arp1 by using the cooverexpression assay described above. Fly Arp11 caused a
decrease in the percentage of cells that contained Arp1 cables
(Table 1), indicating that the
fly and mouse Arp11 proteins are functionally related.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Sequence alignments of Arp11 with conventional actin reveal a conserved
actin fold (Kabsch and Holmes,
1995) that is punctuated with insertions. Purified native Arp11
contains bound ATP (J. Bingham, unpublished observations) suggesting it indeed
folds into an actin-like structure. As in many actin-related proteins
(Schafer and Schroer, 1999),
the insertions in the Arp11 sequence are found in the middle and at both ends
of the protein. All map to sites predicted to be on the surface. We identified
a minimal actin-binding fragment as amino acids 23–137, which
corresponds roughly to subdomains 1 and 2 in conventional actin (residues
17–153; see Eckley et al.,
1999; Holmes et al.,
1990; Kabsch et al.,
1990). If these subdomains of Arp11 are engaged in contacts with
actin or Arp1 it would leave the rest of the protein to bind other proteins
such as the pointed end complex subunits p62, p27, p25, and/or cargo
components.
Like Arp1, Arp11 is incorporated into a large, rapidly sedimenting complex,
most likely dynactin. Biochemical analysis of dynactin subcomplexes allowed
Arp11 to be mapped to the pointed end of the dynactin Arp1 minifilament
(Eckley et al.,
1999). At present, we do not know whether Arp11 binds directly to
Arp1 or actin. The pointed end complex protein, p62, may play a role in the
association of Arp11 with the Arp1 minifilament. Like Arp11, p62 has been
shown to bind to actin (Garces et
al., 1999) and Arp1
(Karki et al., 2000)
in vitro. If p62 and/or Arp11 is bound to actin, this would place actin at the
pointed end of the Arp1 minifilament instead of in association with CapZ as we
suggested previously (Schafer et
al., 1994). However, preliminary chemical cross-linking
experiments (Eckley, unpublished observations) suggest that Arp11 directly
contacts p62 and Arp1 but not actin. At present, we favor a model in which
Arp11 binds Arp1 directly at the filament pointed end to dock the pointed end
complex to the Arp1 filament. Rigorous proof of this will await further
study.
Arp11 might play multiple roles in dynactin. Its predicted structure
suggests it caps the Arp1 filament to disallow further subunit addition or
filament annealing. A potential Arp1 capping activity could not be assayed
directly because purified Arp1 is so difficult to obtain. Native Arp 1 can be
isolated from purified dynactin (Bingham
and Schroer, 1999), but the yield is very low and the resulting
protein is so labile as to preclude detailed analysis. Heterologous expression
of recombinant Arp1 yields insoluble aggregates even in insect cells (Bingham,
Ph.D. thesis). A detailed analysis of the role of Arp11 in Arp1 assembly will
require development of a new purification strategy for recombinant Arp1.
Orthologs of Arp11 can be found in most eukaryotes; however, this branch of
the actin superfamily is considerably more divergent than actin or Arp1
(Table 2). Neurospora
crassa Arp11 (Ropy-7) is barely discernible as an Arp11 ortholog, sharing
only 20% identity with its mouse counterpart. A possible Arp11 ortholog has
also been identified as the Arp10 gene in the budding yeast S.
cerevisiae (Goodson and Hawse,
2002). S. cerevisiae Arp10 was found to interact with
Arp1 in a two-hybrid screen (Uetz et
al., 2000), but Arp10 deletion mutants do not show the
nuclear partitioning defect typical of dynein/dynactin pathway mutants
(Eckley, Hoyt, and Schroer, unpublished observations). This suggests that
S. cerevisiae Arp10 provides a slightly different function than Arp11
in other species. Both S. cerevisiae and Schizosaccharomyces
pombe seem to lack the three other subunits of the pointed end complex
(p62, p27, and p25), indicating that this entire structural element may not be
required for yeast dynactin function. S. cerevisiae dynactin
sediments with a smaller S value than bovine dynactin (15.5S versus 20S;
Kahana et al., 1998),
consistent with a more streamlined structure.
Fungal and metazoan cells share a number of important differences, a major
one being the absence or presence of an open mitosis. Nuclear envelope
breakdown, the defining feature of an open mitosis, is facilitated by dynein
and dynactin. Binding of these proteins to the envelope
(Salina et al., 2002)
allows tension to be exerted on the membrane, which contributes to rupture.
Overexpression of the dynactin subunit, p62, blocks dynein recruitment to
nuclei (Salina et al.,
2002), suggesting that this protein, possibly acting in
conjunction with other pointed end complex subunits (Quintyne, Eckley, and
Schroer, unpublished data), mediates dynactin binding. That budding and
fission yeast lack most pointed end complex proteins is consistent with the
fact that these cells do not accumulate dynactin on their nuclear envelopes
(McMillan and Tatchell, 1994;
Kahana et al., 1998;
Harata et al., 2000).
It is possible that the Arp11 orthologs found in yeasts provide no function
other than to cap the Arp1 filament.
In addition to their supporting role in nuclear envelope breakdown, dynein
and dynactin have been proposed to participate in the long-range movements of
nuclei in cells such as zygotes, neurons, and filamentous fungi (reviewed in
Reinsch and Gonczy, 1998;
Morris, 2000;
Morris, 2003). Mutations in
dynein or dynactin genes in the fungi N. crassa and Aspergillus
nidulans yield the conspicuous "ropy" or "nud"
(nuclear distribution) phenotypes in which nuclear transport into growing
hyphae is blocked (Plamann et
al., 1994; Xiang et
al., 1994; Tinsley et
al., 1996; Xiang et
al., 1999; Lee et
al., 2001). However, the microtubules in these cells are
oriented with their plus ends toward the hyphal tip, the wrong orientation to
support a simple dynein-based transport process. Although N. crassa
contains orthologs of p62 (Ropy-2) and p25 (Ropy-12), Ropy-12 mutants show
apparently normal nuclear migration (Lee
et al., 2001), leaving the function of these pointed end
complex components in filamentous fungi obscure.
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
-actin clone, Drs. Jim Lees-Miller and David Helfman
(Cold Spring Harbor Laboratories, Cold Spring Harbor, NY) for the human Arp1
clone, and Dr. M. Way (Imperial Cancer Research Fund, London) for Arp11
antisera. This work was supported by National Institutes of Health grant
GM-44589 (to T.A.S.). |
Footnotes |
|---|
* Current address: McKusick-Nathans Institute of Genetic Medicine, 850 Ross
Bldg., 720 Rutland Ave., The Johns Hopkins School of Medicine, Baltimore, MD
21205. 
Corresponding author. E-mail address:
schroer{at}jhu.edu.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Bingham, J.B. (1999). Purification and characterization of the actin-related protein, Arpl. Ph.D. thesis, The Johns Hopkins University, Baltimore, MD.
Bingham, J.B., King, S.J., and Schroer, T.A. (1998). Purification of dynactin and dynein from brain tissue. Methods Enzymol. 298, 171–184.[Medline]
Bingham, J.B., and Schroer, T.A. (1999). Self-regulated polymerization of the actin-related protein Arp1. Curr. Biol. 9, 223–226.
Bourbon, H.M., et al. (2002). A P-insertion screen identifying novel X-linked essential genes in Drosophila. Mech. Dev. 110, 71–83.[CrossRef][Medline]
Boyer, L.A., and Peterson, C.L. (2000). Actin-related proteins (Arps): conformational switches for chromatin-remodeling machines? Bioessays 22, 666–672.[CrossRef][Medline]
Busson, S., Dujardin, D., Moreau, A., Dompierre, J., and De Mey, J.R. (1998). Dynein and dynactin are localized to astral microtubules and at cortical sites in mitotic epithelial cells. Curr. Biol. 8, 541–544.[CrossRef][Medline]
Cairns, B.R., Schlichter, A., Erdjument-Bromage, H., Tempst, P., Kornberg, R.D., and Winston, F. (1999). Two functionally distinct forms of the RSC nucleosome-remodeling complex, containing essential AT hook, BAH, and bromodomains. Mol. Cell 4, 715–723.[CrossRef][Medline]
Cooper, J.A., and Pollard, T.D. (1985). Effect of capping protein on the kinetics of actin polymerization. Biochemistry 24, 793–799.[CrossRef][Medline]
Echeverri, C.J., Paschal, B.M., Vaughan, K.T., and Vallee, R.B.
(1996). Molecular characterization of the 50-kD subunit of
dynactin reveals function for the complex in chromosome alignment and spindle
organization during mitosis. J. Cell Biol.
132,
617–633.
Eckley, D.M., Gill, S.R., Melkonian, K.A., Bingham, J.B., Goodson,
H.V., Heuser, J.E., and Schroer, T.A. (1999). Analysis of
dynactin subcomplexes reveals a novel actin-related protein associated with
the arp1 minifilament pointed end. J. Cell Biol.
147,
307–320.
Garces, J.A., Clark, I.B., Meyer, D.I., and Vallee, R.B. (1999). Interaction of the p62 subunit of dynactin with Arp1 and the cortical actin cytoskeleton. Curr. Biol. 9, 1497–1500.[CrossRef][Medline]
Gill, S.R., Schroer, T.A., Szilak, I., Steuer, E.R., Sheetz, M.P.,
and Cleveland, D.W. (1991). Dynactin, a conserved, ubiquitously
expressed component of an activator of vesicle motility mediated by
cytoplasmic dynein. J. Cell Biol.
115,
1639–1650.
Goodson, H.V., and Hawse, W.F. (2002). Molecular
evolution of the actin family. J. Cell Sci.
115,
2619–2622.
Harata, M., Oma, Y., Tabuchi, T., Zhang, Y., Stillman, D.J., and
Mizuno, S. (2000). Multiple actin-related proteins of
Saccharomyces cerevisiae are present in the nucleus. J.
Biochem. 128,
665–671.
Holleran, E.A., Karki, S., and Holzbaur, E.L. (1998). The role of the dynactin complex in intracellular motility. Int. Rev. Cytol. 182, 69–109.[Medline]
Holleran, E.A., Tokito, M.K., Karki, S., and Holzbaur, E.L.
(1996). Centractin (ARP1) associates with spectrin revealing a
potential mechanism to link dynactin to intracellular organelles. J.
Cell Biol. 135,
1815–1829.
Holmes, K.C., Popp, D., Gebhard, W., and Kabsch, W. (1990). Atomic model of the actin filament. Nature 347, 44–49.[CrossRef][Medline]
Kabsch, W., and Holmes, K.C. (1995). The actin fold. FASEB J. 9, 167–174.[Abstract]
Kabsch, W., Mannherz, H.G., Suck, D., Pai, E.F., and Holmes, K.C. (1990). Atomic structure of the actin:DNase I complex. Nature 347, 37–44.[CrossRef][Medline]
Kahana, J.A., Schlenstedt, G., Evanchuk, D.M., Geiser, J.R., Hoyt,
M.A., and Silver, P.A. (1998). The yeast dynactin complex is
involved in partitioning the mitotic spindle between mother and daughter cells
during anaphase B. Mol. Biol. Cell
9,
1741–1756.
Karki, S., Tokito, M.K., and Holzbaur, E.L. (2000). A
dynactin subunit with a highly conserved cysteine-rich motif interacts
directly with Arp1. J. Biol. Chem.
275,
4834–4839.
Kato, M., Sasaki, M., Mizuno, S., and Harata, M. (2001). Novel actin-related proteins in vertebrates: similarities of structure and expression pattern to Arp6 localized on Drosophila heterochromatin. Gene 268, 133–140.[CrossRef][Medline]
Kelleher, J.F., Atkinson, S.J., and Pollard, T.D.
(1995). Sequences, structural models, and cellular localization
of the actin-related proteins Arp2 and Arp3 from Acanthamoeba. J. Cell
Biol. 131,
385–397.
Lee, I.H., Kumar, S., and Plamann, M. (2001). Null
mutants of the neurospora actin-related protein 1 pointed-end complex show
distinct phenotypes. Mol. Biol. Cell
12,
2195–2206.
Lees-Miller, J.P., Helfman, D.M., and Schroer, T.A. (1992). A vertebrate actin-related protein is a component of a multisubunit complex involved in microtubule-based vesicle motility. Nature 359, 244–246.[CrossRef][Medline]
Lessard, J.L. (1988). Two monoclonal antibodies to actin: one muscle selective and one generally reactive. Cell Motil. Cytoskeleton 10, 349–362.[CrossRef][Medline]
Ligon, L.A., Karki, S., Tokito, M., and Holzbaur, E.L. (2001). Dynein binds to beta-catenin and may tether microtubules at adherens junctions. Nat. Cell Biol 3, 913–917.[CrossRef][Medline]
McMillan, J.N., and Tatchell, K. (1994). The JNM1 gene
in the yeast Saccharomyces cerevisiae is required for nuclear migration and
spindle orientation during the mitotic cell cycle. J. Cell
Biol. 125,
143–158.
Melki, R., Vainberg, I.E., Chow, R.L., and Cowan, N.J.
(1993). Chaperonin-mediated folding of vertebrate actin-related
protein and gamma-tubulin. J. Cell Biol.
122,
1301–1310.
Morris, N.R. (2000). Nuclear migration. From fungi to
the mammalian brain. J. Cell Biol.
148,
1097–101.
Morris, N.R. (2003). Nuclear positioning: the means is at the ends. Curr. Opin. Cell Biol. 15, 54–59.[CrossRef][Medline]
Palazzo, A.F., Joseph, H.L., Chen, Y.J., Dujardin, D.L., Alberts, A.S., Pfister, K.K., Vallee, R.B., and Gundersen, G.G. (2001). Cdc42, dynein, and dynactin regulate MTOC reorientation independent of Rho-regulated microtubule stabilization. Curr. Biol. 11, 1536–1541.[CrossRef][Medline]
Paschal, B.M., Holzbaur, E.L., Pfister, K.K., Clark, S., Meyer,
D.I., and Vallee, R.B. (1993). Characterization of a 50-kDa
polypeptide in cytoplasmic dynein preparations reveals a complex with
p150GLUED and a novel actin. J. Biol. Chem.
268,
15318–15323.
Peterson, C.L., Zhao, Y., and Chait, B.T. (1998).
Subunits of the yeast SWI/SNF complex are members of the actin-related protein
(ARP) family. J. Biol. Chem.
273,
23641–23644.
Plamann, M., Minke, P.F., Tinsley, J.H., and Bruno, K.S.
(1994). Cytoplasmic dynein and actin-related protein Arp1 are
required for normal nuclear distribution in filamentous fungi. J. Cell
Biol. 127,
139–149.
Quintyne, N.J., Gill, S.R., Eckley, D.M., Crego, C.L., Compton,
D.A., and Schroer, T.A. (1999). Dynactin is required for
microtubule anchoring at centrosomes. J. Cell Biol.
147,
321–334.
Reinsch, S., and Gonczy, P. (1998). Mechanisms of nuclear positioning. J. Cell Sci. 111, 2283–2295.[Abstract]
Salina, D., Bodoor, K., Eckley, D.M., Schroer, T.A., Rattner, J.B., and Burke, B. (2002). Cytoplasmic dynein as a facilitator of nuclear envelope breakdown. Cell 108, 97–107.[CrossRef][Medline]
Schafer, D.A., Gill, S.R., Cooper, J.A., Heuser, J.E., and Schroer,
T.A. (1994). Ultrastructural analysis of the dynactin complex: an
actin-related protein is a component of a filament that resembles F-actin.
J. Cell Biol. 126,
403–412.
Schafer, D.A., and Schroer, T.A. (1999). Actin-related proteins. Annu. Rev. Cell Dev. Biol. 15, 341–63.[CrossRef][Medline]
Schroer, T.A., and Sheetz, M.P. (1991). Two activators
of microtubule-based vesicle transport. J. Cell Biol.
115,
1309–1318.
Spradling, A.C., Stern, D., Beaton, A., Rhem, E.J., Laverty, T.,
Mozden, N., Misra, S., and Rubin, G.M. (1999). The Berkeley
Drosophila Genome Project gene disruption project: single P-element insertions
mutating 25% of vital Drosophila genes. Genetics
153,
135–177.
Studier, F.W. (1991). Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J. Mol. Biol. 219, 37–44.[CrossRef][Medline]
Suetsugu, S., Miki, H., Yamaguchi, H., Obinata, T., and Takenawa, T. (2001). Enhancement of branching efficiency by the actin filament-binding activity of N-WASP/WAVE2. J. Cell Sci. 114, 4533–4542.
Tinsley, J.H., Minke, P.F., Bruno, K.S., and Plamann, M. (1996). p150Glued, the largest subunit of the dynactin complex, is nonessential in Neurospora but required for nuclear distribution. Mol. Biol. Cell 7, 731–742.[Abstract]
Towbin, H., Staehelin, T., and Gordon, J. (1979).
Electrophoretic transfer of proteins from polyacrylamide gels to
nitrocellulose sheets: procedure and some applications. Proc. Natl.
Acad. Sci. USA 76,
4350–4354.
Uetz, P., et al. (2000). A. comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 403, 623–627.[CrossRef][Medline]
Valetti, C., Wetzel, D.M., Schrader, M., Hasbani, M.J., Gill, S.R.,
Kreis, T.E., and Schroer, T.A. (1999). Role of dynactin in
endocytic traffic: effects of dynamitin overexpression and colocalization with
CLIP-170. Mol. Biol. Cell 10,
4107–4120.
Weaver, A.M., Karginov, A.V., Kinley, A.W., Weed, S.A., Li, Y., Parsons, J.T., and Cooper, J.A. (2001). Cortactin promotes and stabilizes Arp2/3-induced actin filament network formation. Curr. Biol. 11, 370–374.[CrossRef][Medline]
Xiang, X., Beckwith, S.M., and Morris, N.R. (1994).
Cytoplasmic dynein is involved in nuclear migration in Aspergillus
nidulans. Proc. Natl. Acad. Sci. USA
91,
2100–2104.
Xiang, X., Zuo, W., Efimov, V.P., and Morris, N.R. (1999). Isolation of a new set of Aspergillus nidulans mutants defective in nuclear migration. Curr. Genet. 35, 626–630.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  S. W. Clark and M. D. Rose Arp10p Is a Pointed-End-associated Component of Yeast Dynactin Mol. Biol. Cell, February 1, 2006; 17(2): 738 - 748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Muller, Y. Oma, L. Vallar, E. Friederich, O. Poch, and B. Winsor Sequence and Comparative Genomic Analysis of Actin-related Proteins Mol. Biol. Cell, December 1, 2005; 16(12): 5736 - 5748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Clark and M. D. Rose Alanine Scanning of Arp1 Delineates a Putative Binding Site for Jnm1/Dynamitin and Nip100/p150Glued Mol. Biol. Cell, September 1, 2005; 16(9): 3999 - 4012. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Hodgkinson, C. Peters, S. A. Kuznetsov, and W. Steffen Three-dimensional reconstruction of the dynactin complex by single-particle image analysis PNAS, March 8, 2005; 102(10): 3667 - 3672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Spudich Two important polymers cross paths PNAS, November 9, 2004; 101(45): 15825 - 15826. [Full Text] [PDF]
|
|
|
|
|
|
S. J. King, C. L. Brown, K. C. Maier, N. J. Quintyne, and T. A. Schroer Analysis of the Dynein-Dynactin Interaction In Vitro and In Vivo Mol. Biol. Cell, December 1, 2003; 14(12): 5089 - 5097. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||
