![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, Issue 7, 2781-2792, July 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*Centre de Recherches de Biochimie
Macromoléculaire, CNRS FRE 2593, IFR24, Montpellier, France; and
Department of Veterinary Molecular Biology,
Montana State University, Bozeman, Montana 59717
Submitted September 5, 2002;
Revised February 13, 2003;
Accepted February 25, 2003
Monitoring Editor: Richard Assoian
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). Ran or Rab proteins mediate two very
specific cellular events, i.e., nucleocytoplasmic shuttling and vesicular
transport, respectively. In contrast, the Rho GTPases affect various cellular
functions (Bishop and Hall,
2000) including cytoskeleton rearrangement, cell motility, cell
growth, or cytokinesis (Takai et
al., 2001). Importantly, they play a role in embryogenesis
(Settleman, 2001).
The Rho GTPases work as molecular switches to transduce intracellular
signals from growth factors or G protein coupled receptors. The role of these
GTPases in cardiac cell differentiation and heart function is not well
understood. Recent in vitro studies indicate that RhoA and Rac may mediate the
hypertrophic responses of agonists binding to seven transmembrane domains
receptors (Sah et al.,
2000). However, increased expression of RhoA in heart leads to a
conduction abnormality and in turn to ventricular failure with no sign of
hypertrophy (Sah et al.,
1999). Transgenic mice overexpressing a dominant positive mutant
of Rac1 developed cardiac hypertrophy within weeks after birth, and this was
associated with an alteration of focal adhesions. These animals featured a
dilated cardiomyopathy accompanied with a decreased myofibril density and
changes in cell adhesion structures
(Sussman et al.,
2000). Wei et al.
(2002) reported a crucial role
of RhoGTPases in fetal cardiac cell proliferation in mice expressing
RhoGDI.
Rho GTPases mediate signals from growth factors such as TGF
(Mucsi et al., 1996;
Atfi et al., 1997), a
key cardiogenic factor. Yet, their specific role in early events of cardiac
cell proliferation and differentiation is not known. Little information as to
this issue can be obtained from transgenic mice, because the 
-MHC
promoter most often used to generate these genetically modified animals is
mainly turned on at birth, at a time when myocytes became postmitotic cells.
Similarly, RhoGDI overexpressing mice did not allow determination of the role
of a specific Rho GTPase.
In this study, we investigated the role of Rac in mouse embryonic stem (ES)
cell differentiation as a model of cardiac cell differentiation, which
recapitulates the early stages of the complex program of mouse embryogenesis
(Leahy et al., 1999).
We show that Rac effects depend on the stage of cell differentiation and that
Rac GTPase activity inhibits cardiac cell differentiation at very early stages
and then later promotes proliferation and myofibrillogenesis of
cardiomyocytes
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
).
ES cells were infected with retrovirus overnight. cDNAs encoding RacV12,
RacN17, and RacF28 were also subcloned in a bicistronic vector (pIRES2GFP) in
which the CMV promoter sequence was excised and replaced by the 250-base pair
sequence of MLC2v promoter (Meyer et
al., 2000). The linearized plasmid DNAs were electroporated
into CGR8 ES cells according to standard protocol
(Meyer et al., 2000).
The ES clones were propagated in the presence of LIF-conditioned medium
obtained from LIF-D cells and selected for 10 d by incubation with G418 (250
µg/ml) and further screened by PCR. Individual ES cell clones were screened
by PCR for expression of GTPases. At least three independent cell clones were
used for each GTPase. cDNA encoding MLC2v was subcloned into pEGFP-N1 using the restriction sites Sal/BamH1 to generate the expression vector encoding MLC2v-GFP fusion protein.
Rac Mutation
A PCR-driven amplification approach was used to generate a point mutation
in the cDNA encoding RacL61 (Freeman
et al., 1996) to obtain a constitutively active mutant,
which lost the ability to activate the membrane NADPH oxidase
(Nisimoto et al.,
1997). Aspartate at position 38 was replaced by a lysine. A first
PCR fragment of 500 base pairs was amplified using a forward primer including
the mutation (5'-GCTGAAGGAGGAGAAGCTGACT-3') and a reverse
primer in the 3' region of RacL61
(5'-GCTCGAGCTACAACAGGCATTTTC-3') including a BamH1
restriction site. The PCR fragment was used as a reverse primer in the second
PCR round together with a forward primer in the 5' region of the vector
(5'-GGAATTCATGCATGCAGGCCATCAAGTG-3') including an EcoRI
site. Mutation was checked by sequencing the cDNA encoding RacL61D38, which
was subcloned into pIRES2-EGFP vector (Clontech, Palo Alto, CA) using the
BamH1 and EcoRI sites.
ES Cell Differentiation
ES cells (CGR8) were propagated in BHK21 medium supplemented with pyruvate,
nonessential amino acids, mercaptoethanol, 7.5% fetal calf serum, and
LIF-conditioned medium obtained from preconfluent LIF-D cells stably
transfected with a plasmid encoding LIF. The cells were trypsinized and
replated every 2 d. Differentiation was carried out using the hanging drop
method. Briefly, embryoid bodies (EBs) were formed in hanging drops of
differentiation medium (BHK21 medium supplemented with pyruvate, nonessential
amino acids, mercaptoethanol, and 20% fetal calf serum without LIF) for 2 d
(D0–2). Then, the EBs were incubated for 3 d in suspension (D2–5)
and for at least 7 d on gelatin-coated dishes or laminin-coated glass
coverslips (D6–12; Meyer et
al., 2000).
Isolation of ES-derived Cardiomyocytes
To isolate ES-derived cardiomyocytes, EBs were detached from dishes at day
10 by incubation for 1 min with 0.05% trypsin at 37°C (in
phosphate-buffered saline, 1 mM EDTA). Embryoid bodies were dissociated with 1
mg/ml collagenase (CLSII, Worthington, Lake-wood, NJ) and 0.25 mg/ml
pancreatin in a buffer containing (in mmol/L) NaCl 117, HEPES 20,
NaH2PO4 1.2, KCl 5.4, MgSO4 1, glucose 5
(adjusted to pH 7.35). Cells were separated by centrifugation through a
discontinuous two-layer Percoll gradient. Stem cell–derived
cardiomyocytes were present at the interface between the two layers. They were
collected and immediately plated on gelatin-coated glass dishes.
Transfection of Neonatal Rat and ES-derived Cardiomyocytes
Ventricular myocytes were isolated from 2–3-d-old rats and plated for
24 h in DMEM/M199 medium. Neonatal rat cardiomyocytes were then cotransfected
with plasmids encoding RacL61D38 mutant and the red fluorescent protein
(pCMVDsRed, Clontech) using Effectene (QIAGEN, Courtaboeuf, France) as
previously described (Bony et al.,
2001). The same transfection protocol was used to transfect
plasmids encoding the GTPases or MLC2vGFP in ES-derived cardiomyocytes.
Measurement of Reactive Oxygen Species in Neonatal Rat
Cardiomyocytes
To monitor ROS production, myocytes were loaded for 20 min with 10 µM
2', 5-(and-6)-chloromethyl-2',7'-dichlorodihydrofluorescein
diacetate, acetyl ester (DCHF; Molecular Probes, Leiden, The Netherlands).
After washing, cells then were transferred to the stage of an inverted
epifluorescence Leica DMRA microscope (Rueil-Malmaison, France) equipped with
a 63x objective. Transfected cells were selected by RFP expression using
a set of rhodamine filter (excitation 545 ± 10, emission 625 ±
15 nm) and fluorescence of DCHF was measured using a set of FITC filters
(excitation 485 ± 10 and emission at 535 ± 20 nm) using a
MicroMax 1300 Y/HS CCD camera (Princeton Instruments, Princeton, NJ) driven by
Metamorph (Universal Imaging Corporation, Roper Scientific, Evry, France).
Mouse Embryos
Mouse embryos were collected from mice at days 6, 9, and 11 postcoitum. RNA
was isolated from total heart, ventricle or atria using a standard protocol
(Chomczynski and Sacchi, 1987).
After reverse transcription, encoding sequence of Rac1 was amplified from the
cDNA using a specific set of primers (sense:
5'-TGGGAGACGGAGCTGTTGGTAAAACC-3' and antisense
5'-ACTTGGCATCAAATGCG-3').
Cell Immunofluorescence microscopy
EBs (D12–14) were fixed in 3% paraformaldehyde for 30 min and
permeabilized for 30 min with 1% Triton X-100. The ES-derived isolated
cardiomyocytes were fixed in 3% paraformaldehyde for 10 min and permeabilized
for 10 min with 0.5% Triton X-100. Immunostaining was performed as previously
described with polyclonal anti-MLC2a and anti-MLC2v antibodies
(Meyer et al., 2000).
Monoclonal mouse antiactinin, monoclonal rat anti-Ki67, or polyclonal
anti-MEF2C antibodies were purchased from Sigma (Saint Quentin Fallavier,
France), Dako (Trappes, France), and Cell Signaling, (Ozyme, Saint-Quentin,
France) respectively.
Cell Imaging
Images of EBs or isolated cells were acquired with a Leica DMRA microscope
equipped with a 40x or 100x objective mounted on a piezo-electric
step motor. To visualize in situ immunostaining of MLC2v, optical
z-sectioning of EBs was carried out using a 0.4-µm step. To detect
ECFP fluorescence, EBs or isolated cells were illuminated at 400 ± 20
nm and the CFP fluorescence recorded with a X114–2 CFP Leica filter cube
that consists of a dichroic mirror DM 455 and an emission filter at 480
± 30 nm. Images were acquired with a MicroMax 1300 Y/HS CCD camera
(Princeton) and stored as a volume file ("stack" of
z-sections images) using Metamorph Digital restoration to remove
noise, background, and blur of "stacks" of images was carried out
using Huygens software (Huygens 2.3.9; Scientific Volume Imaging, Hilvesum,
The Netherlands) run on a dedicated double O 200 SGI (Silicon Graphics
Industries, Mountain View, CA) and visualized using Imaris (Bitplane, Zurich,
Switzerland). Beating activity was monitored by videomicroscopy using the
stream acquisition mode, and beating areas were measured using the region
measurement option of Metamorph. The latter were normalized to the total
mesoderm area.
RT-PCR and Real-Time Quantitative PCR
Total RNA was prepared from 10 EBs after cell lysis in guanidinium
thiocyanate–containing buffer using a modified phenol chloroform
extraction (Chomczynski and Sacchi,
1987). After reverse transcription, 100–300 ng cDNA was used
for semiquantitative PCR to stay within the linear range of amplification. PCR
was carried out using a set of gene specific primers as previously described
(Meyer et al., 2000).
Rho A and RhoG were amplified for 36 cycles using the following primers, RhoA:
forward TGGAGCTTGTGGTAAGACATGC and reverse AGAATCCCCCAAGGAACTCG; RhoG: forward
GTGCTTAACCCAACACC and reverse CACATCTTTC TTCTCA. Rac 1 was amplified using the
primers described in the embryo section. Tubulin, MHC, GATA4, and MLC2v
cDNAs were amplified for 30 cycles. Nkx2.5 and MEF2 cDNA were amplified for
30–36 cycles and the reaction run in agarose electrophoresis. The amount
of PCR product was quantified for comparison by scanning photographs of
ethidium bromide–fluorescent cDNA bands using a CCD camera and the NIH
Image J 1.01 software.
MEF2C expression was measured using real-time quantitative PCR. After
reverse transcription, 10 ng cDNA was used for real-time quantitative PCR,
performed with a light cycler and the SYBR Green fast start kit (Roche,
Meylan, France). The following primers were used for a real-time PCR: MEF2C
forward 5'-AGATACCCACAACACACCACG-CGCC-3' and reverse
5'-ATCCTTCAGAGAGTCGCATGCGCTT-3'; -tubulin forward
5'-CGGACAGTGTGGCAACCAGATCGG-3'and reverse 5'-TGG
CCAAAAGGACCTGAGCGAACGG-3'. The 12-µl reaction mix contained 1 µl
of Master SYBR Green I mix, including Taq DNA polymerase, buffer,
deoxynucleoside trisphosphate mix, SYBR Green I dye, 3 mM MgCl2,
and 0.5 µM of each primer. Two microliters of 30-fold diluted cDNA was
added to the mixture. Relative concentrations of mRNA were established by a
standard curve using sequential dilutions of gene-specific PCR fragments. Data
were normalized using RT-PCR of the -tubulin mRNA as an index of cDNA
content after reverse transcription. Amplification included initial
denaturation at 95°C for 8 min, and 45 cycles of denaturation at 95°C
for 3 s, annealing at 60–65°C for 8–10 s, and extension at
72°C for 7–10 s. The temperature transition rate was 20°C/s.
Fluorescence was measured at the end of each extension step. After
amplification, a melting curve was acquired by heating the product at
20°C/s to 95°C and then cooling it at 20°C/s to 70°C. The
reaction was maintained at 70°C for 20 s followed by slow heating at
0.3°C/s to 95°C. Melting curves were used to determine the specificity
of PCR products, and they were further confirmed by gel electrophoresis.
Rac GTPase Activity and Western Blot Analysis
Rac activity was measured with an assay activity kit (Upstate
Biotechnology, Euromedex, Muldosheim, France) using a GST-conjugated PAK-1
protein-binding domain according to manufacturer's instructions. Proteins were
extracted from EBs in NET (NaCl, EDTA, Tris) buffer containing 1% NP40
(Bony et al., 2001).
Proteins were assayed using the Bradford reagent, and the same amount per well
was run in 12% SDS-PAGE and transferred to a nitrocellulose membrane as
previously described. Blots were probed with a polyclonal anti-Rac (Santa Cruz
Biotechnology, Santa Cruz, CA), anti-gp91phox, or anti-p67phox
(De Leo et al., 1996)
and polyclonal anti -tubulin as indicated, and a secondary
peroxidase-conjugated antibody. Immunoreactive proteins were revealed by ECL
(Bony et al.,
2001).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
Constitutively Active Rac1 Impairs Cardiac Differentiation of ES
Cells
To determine the role of the Rac GTPase in cardiac cell differentiation of
ES cells, we generated an ES cell line expressing a constitutively active or a
dominant negative mutant of Rac (RacV12 or RacN17, respectively). In RacV12
EBs, Rac activity was increased by 5 ± 0.8-fold (n = 3), whereas Rac
activity was abolished in RacN17 cell line (our unpublished results). The
RacV12 cell line was then tested for its ability to differentiate into
functional cardiomyocytes. Because the RacV12 expression vector contained an
ubiquitous promoter, Rac was broadly expressed after differentiation in most
cells of the three layers (i.e., ectoderm, mesoderm, endoderm) of the EB. The
cardiac phenotype of EBs (i.e., structure and function of ES-derived
cardiomyocytes) expressing RacV12 was compared with that of EBs overexpressing
other constitutively active mutants of RhoGTPases, namely RhoAV14 and RhoGV12
(Figure 2, inset).
|
Beating activity of EBs generated from RhoAV14, RhoGV12 ES cells showed
that these cells differentiated into cardiac cells as well as MLCECFP ES
cells, a control cell line expressing ECFP under the control of the
ventricular myosin light chain 2 (MLC2v) promoter
(Meyer et al., 2000;
Figure 2). In contrast,
although RacV12 EBs displayed the three-layer structure (our unpublished
results), they lost their ability to beat, indicating a potential defect in
cardiac differentiation and/or excitation-contraction coupling of ES-derived
cardiomyocytes.
Mechanism Underlying RacV12-induced Impairment of Cardiac Cell
Differentiation
To understand the mechanism of inhibition of beating activity in RacV12
EBs, mRNAs encoding cardiac transcription factors were amplified by PCR after
reverse transcription of RNA extracted from EBs at day 5. Expression of Nkx2.5
or GATA4 mRNA in RacV12 EBs was not different from that in EBs expressing
RhoGV12 or ECFP. In contrast, MEF2C expression was dramatically decreased in
RacV12 EBs (Figure 3A). To
confirm this result, real-time quantitative PCR was performed. This more
quantitative approach revealed that MEF2c mRNA expression was eight times
lower in RacV12 EBs, compared with controls
(Figure 3B). Furthermore, we
were also not able to detect MEF2C protein in RacV12 EBs using Western blot or
immunofluorescence (our unpublished results).
|
Expression of genes encoding constitutive contractile proteins such as
MLC2v and myosin heavy chain (-MHC) was also determined in EBs
expressing constitutively active Rho GTPases.
Figure 4 shows that in RacV12
EBs but not in any other EBs, the level of expression of MLC2v gene was
significantly reduced, whereas expression of -MHC
(Figure 4A) and MLC2a (our
unpublished results) was not affected. MLC2v expression and incorporation into
the sarcomeres was evaluated by immunofluorescence of EBs or ES-derived
cardiomyocytes isolated from EBs expressing dominant active GTPase mutants. In
RacV12 EBs, fewer MLC2v positive ventricular cardiomyocytes were observed
compared with control (i.e., MLCECFP clone;
Figure 4B, left panel). At high
magnification, images of stained actinin showed a lack of sarcomeric units
(Figure 4B, right panel). This
was further confirmed in cardiomyocytes isolated from RacV12 EBs. RacV12
cardiomyocytes, stained with specific anti-MLC2 antibodies, revealed that the
ventricular light chain of myosin was weakly expressed and not incorporated
into sarcomeric units. In contrast, the atrial myosin light chain was normally
expressed (Figure 4C).
|
The reduced expression of MEF2C in RacV12 EBs may be responsible for impaired expression of MLC2v. To test this hypothesis, we attempted to rescue the RacV12 EB phenotype by overexpressing MEF2C in the RacV12 ES cell line (Figure 5A). Differentiation of RacV12/MEF2C ES cells revealed that the level of Rac expression was comparable in RacV12 EBs and RacV12/MEF2C EBs (Figure 5B, inset). Figure 5B shows that beating activity of RacV12/MEF2C EBs was restored and was comparable to control EBs. MLC2v expression and sarcomerogenesis were also both restored in RacV12/MEF2C EBs (Figure 5, C and D).
|
Reactive Oxygen Species Trigger Downregulation of MEF2C Expression
and Accounts for the Phenotype of RacV12 ES-derived Cardiomyocytes
We next addressed the mechanism of downregulation of the MEF2C gene in
RacV12 EBs. One important and specific effector of Rac is a
membrane-associated NADPH oxydase, which generates reactive oxygen species
(ROS; Babior, 1999). ROS are
known to repress the activity of promoters for several genes including myoD
and -actin (Morel and Barouki,
1999). Thus, we evaluated the role of ROS in cardiac
differentiation of ES cells by incubating EBs with 100 nM
H2O2 from days 0 to 7. For these experiments, we used
cells expressing ECFP under control of the -actin promoter
(Behfar et al., 2002)
to track the cardiomyocytes at an early stage of differentiation.
Figure 6A shows that clusters
of ECFP expressing cells were detected as early as day 5 in control EBs,
whereas no fluorescence could be observed in EBs treated with
H2O2. Furthermore, H2O2
dramatically prevented beating activity of EBs
(Figure 6B) and decreased MEF2C
expression (Figure 6C). This is
reminiscent of the RacV12 EB phenotype. When added from days 7 to 12,
H2O2 did not longer decrease beating activity of EBs
(our unpublished results).
|
Essential NADPH oxydase components, namely the membrane gp91phox and Rac-regulated p67phox, are expressed in EBs as early as days 5–7 (Figure 6D). To further investigate the role of ROS in ES cell differentiation, we generated a stable ES cell line expressing a constitutively active Rac mutant (L61D38), which has lost the ability to activate the membrane NADPH oxydase and, therefore, the ability to generate ROS. To check that the constitutively active mutant L61D38 was deficient in NADPH oxydase activity in cardiac cells, neonatal rat cardiomyocytes were transiently transfected with RacV12 or RacL61D38. Loading the cells with DCHF, a ROS-sensitive fluorescent probe, revealed that RacV12-transfected cells generated ROS normally. In contrast, cells expressing RacL61D38 did not produce any ROS (Figure 7A), even though the level of overexpression of RacL61D38 in EBs was similar to that of RacV12ES cells (inset). Cardiomyocytes differentiated from RacL61D38 ES cells were indistinguishable from wild-type myocytes, and MEF2C expression was not affected by expression of RacL61D38 (our unpublished results). More interestingly, the beating activity of EBs and the number of cardiomyocytes with sarcomeric actinin within the EBs was increased (Figure 7, B and D) compared with RacV12 EBs (Figure 4). As an alternative approach, we reasoned that if Rac-induced activation of NADPH oxydase impaired cardiac cell differentiation, a scavenger of ROS should relieve this effect. Thus, we added in the differentiation medium of RacV12 EBs 1000 U/ml catalase. Added at day 5, catalase partially rescued beating activity of RacV12 EBs. Added as early as day 2, the ROS scavenger fully restored beating activity of EBs (Figure 7C). In the same line MEF2C mRNA content and in turn MLC2v expression were restored in racV12 EBs (MEF2C mRNA at day 5 [in a.u.], 1 ± 0.1 in wt day 5 EBs vs. 0.1 ± 0.05 in RacV12 vs. 1.2 ± 0.1 in RacV12 treated with catalase from day 2, n = 3). Myofibrillogenesis visualized by actinin decoration of EBs was then normal in RacV12 EBs cultured in the presence of catalase (Figure 7D).
|
Inhibition of Endogenous Rac Impaired Beating Activity of Embryoid
Bodies
We then allowed an ES cell clone expressing a dominant negative mutant of
rac (RacN17) to differentiate. Inhibition of Rac as early as in ES cells did
not affect the process of cardiac differentiation as revealed by normal
expression of the transcription factors Nkx2.5 and MEF2C, or of the
constitutive cardiac genes, MHC or MLC2v
(Figure 8A). However,
spontaneous activity of EBs was severely impaired
(Figure 8B). Actinin staining
of EBs revealed the presence of cardiomyocytes
(Figure 8C) but a poor
myofibrillogenesis. Indeed sarcomeric units of ES-derived cardiomyocytes were
not fully organized (Figure
8D).
|
Late and Cardiac-restricted Expression of RacV12 Improves
Cardioblasts Proliferation and Myofibrillogenesis
To further investigate the specific role of Rac in cardiac differentiation,
we generated a DNA vector including the MLC2v promoter to exclusively express
a dominant negative (RacN17), a fast cycling (RacF28;
Lin et al., 1999), or
a dominant active (RacV12) Rac mutant in ES-derived ventricular cells.
Furthermore, this approach allowed us to bypass early expression of RacV12.
Indeed, when RacV12 was expressed under the control of MLC2v promoter, the
GTPase was overexpressed only in ES-derived ventricular cardiomyocytes from
days 5 to 7 of differentiation when the MLC2v promoter was turned on as
visualized by GFP expression in beating cells
(Meyer et al., 2000).
Cardiac differentiation of these cells was greatly improved within the EBs, as
shown by the beating activity of EBs
(Figure 9A) and MEF2C
expression in cardiac mesodermal area of EBs (right panel). Moreover, the
percentage of the mesoderm (i.e., median layer) featuring a beating activity
was significantly increased when compared with control EBs (60 ± 5% vs.
28 ± 4%, n = 5). A similar phenotype was obtained when RacF28, a fast
cycling mutant of Rac, was expressed under control of the MLC2v promoter. In
contrast, cardiac differentiation was impaired in RacN17 EBs, and only 10
± 3% (n = 5) of the mesoderm was beating. Under control of the MLC2v
promoter, RacV12 did not affect MEF2C expression. -actinin and
-MLC2v staining of EBs revealed that myofibrillar strands were more
abundant in MLCRacV12 than in MLCRacN17 ES-derived mesoderm
(Figure 9B). In addition,
RT-PCR of RNA extracted from MLC2RacV12 or MLCR-acN17 EBs at days 7 or 9 did
not show any significant difference in expression of cardiac transcription
factors (Nkx2.5, MEF2C, or GATA4), when compared with MLCECFP EBs used as
control (our unpublished results).
|
To further investigate the nontranscriptional mechanism of improvement or
impairment of beating activity in MLCRacV12 and MLCRacN17 EBs, respectively,
we conducted experiments designed to look at myofibrillogenesis of ES-derived
cardiomyocytes. Cardiomyocytes were isolated from wild-type EBs at day 9 and
transfected with plasmids encoding RacV12-GFP or RacN17-GFP, together with a
DNA vector encoding the fusion protein MLC2vGFP. In wild-type or
RacV12-transfected cells, MLC2vGFP formed aligned and well-defined sarcomeric
units, and this process was accomplished more rapidly than in wild-type cells.
In contrast, in RacN17-transfected cells, MLC2vGFP failed to fully incorporate
into sarcomeres (Figure 9C) as
previously found in CMVRacN17 ES-derived cardiomyocytes
(Figure 8D). Next, we isolated
ES-derived cardiomyocytes from MLCRacV12 or MLCECFP EBs and plated them in
culture. Using both an antibody raised against Ki67, a proliferative marker
expressed in any stage of cell cycle of mitotic cells but G0
(Scholzen and Gerdes, 2000),
BrdU revealed that ES-derived cardiomyocytes expressing RacV12 were still
proliferating at day 3 postisolation, whereas most of the cardiomyocytes
expressing ECFP exited the cell cycle
(Figure 9D).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Among the constitutively active Rho GTPase mutants expressed as early as in
undifferentiated stem cells, Rac conferred a unique cardiac phenotype.
Although early expression of constitutively active mutants of RhoA or RhoG
improved cardiac differentiation of ES cells, the constitutively active mutant
of Rac seriously impaired the process. In RacV12ES-derived cardioblasts,
downregulation of the cardiac-specific transcription factor MEF2C, a factor
that tightly regulates numerous cardiac-specific genes
(Harvey, 1999), resulted in a
poor expression of MLC2v, which compromised the organization of myofibrils.
This would be expected, based on the key role of this protein in the formation
of sarcomeres (Chen et al.,
1998). Restoration of both sarcomerogenesis and beating activity
by overexpression of MEF2C in RacV12 ES-derived cardiomyocytes demonstrates
that lack of expression of the transcription factor is at the origin of the
defect in cardiac cell differentiation of RacV12 ES cells.
Searching for the mechanism underlying the impaired expression of MEF2C in
RacV12ES cells, we reasoned that such a mechanism should be specific of RacV12
because MEF2C was expressed to the same extent in ES-derived cardiomyocytes
expressing constitutively active mutants of other RhoGTPases (i.e., RhoG,
RhoA) as in control MLCECFP cells. Therefore, we looked for a Rac-specific
effector. The membrane NADPH oxidase is a major and specific Rac1/Rac2
effector enzyme (Babior, 1999;
Archer and Bar-Sagi, 2002). The
NADPH oxidase is comprised of five components (p40phox,
p47phox, p22phox,
p67phox, and gp91phox) and generates
ROS. Rac1 and Rac2 can both bind to p67phox
(Nisimoto et al.,
1997) and, thereby, activate the NADPH oxydase.
Gp91phox, p22phox, and
p67phox are highly expressed in embryonic tissues,
including the heart, and in early differentiation stages of ES-derived EBs
(Sauer et al., 2000;
Cheng et al., 2001;
Figure 6D). Because ROS repress
expression of numerous cardiac genes
(Morel and Barouki, 1999), we
evaluated the involvement of ROS in the repression of MEF2C expression by
studying the propensity of ES cells expressing a constitutively activated
mutant of Rac (RacL61D38), which lost the ability to bind
p67phox and in turn to activate the NADPH oxidase
(Nisimoto et al.,
1997), to differentiate into cardiac cells
(Figure 7). Such cells
expressed normal levels of MEF2C, featured regular sarcomeres, and thus
differentiated normally into functional beating cardiac cells. Furthermore,
day-to-day addition of 100 nM H2O2 at early stage of
differentiation (days 0–7), at a concentration expected from RacV12
activity within differentiating cells
(Price et al., 2002),
to the EBs also severely impaired cardiac differentiation of ES cells, as
shown by the lack of both transactivation of the MEF2C-dependent -actin
promoter and beating activity of EBs. On the other hand, the ROS scavenger,
catalase added to the culture medium of EBs rescued MEF2C expression,
myofibrillogenesis and in turn beating activity of RacV12 EBs. Together, these
findings demonstrate the crucial deleterious role of Rac-induced ROS
generation in early stages of cardiac cell differentiation.
Limitations of our cell model include the noncell type- or time-restricted
expression of RacV12, because the mutant was driven by an ubiquitous promoter
leading to a strong overexpression (Figure
5, inset) of a GTPase switched in constitutively activated and
nonregulated conformation. Besides MEF2C downregulation, the cardiac phenotype
of RacV12 EBs may be aggravated by ROS generation in any cell type that
differentiated within EBs. Rac-generated ROS may induce a loss of
cadherin-mediated cell-cell connection
(van Wetering et al.,
2002), a process required for early cardiac development
(Linask et al.,
1997). Therefore, to provide more insight into the role of Rac in
cardiac differentiation, we used the ventricular myosin light chain 2 promoter
to specifically drive expression of GTPase mutants in ES-derived ventricular
cells (Meyer et al.,
2000). Under such cardiac- and time-restricted expression, RacV12
significantly improved or accelerated the process of cardiac differentiation,
as visualized by the extent of beating areas within EBs as soon as the MLC2v
promoter was turned on at day 7 (Meyer
et al., 2000; Figure
9). A similar effect was observed with the fast cycling mutant
RacF28, a more physiological way to increase Rac activity that can still be
endogenously regulated. Furthermore, such an extensive beating area within the
mesoderm of MLC2RacV12 EBs is similar to the one obtained in
TGF-treated, ES-derived cardiomyocytes
(Behfar et al., 2002),
as expected from activation of Rac by the growth factor
(Atfi et al., 1997).
In contrast, the dominant negative mutant RacN17 prevented cardiac
myofibrillogenesis. Thus when expressed only in ventricular cells and at a
stage of differentiation when cardiac transcription factors has already
reached maximal level of expression (Meyer
et al., 2000), Rac GTPase activity turns out to be
required for terminal differentiation of cardiac precursors.
Two explanations are suggested to account for the great propensity of
MLC2RacV12 ES cells to differentiate into contractile cardiomyocytes. First,
Rac improves myofibrillogenesis of cardioblasts, as shown by a complete
incorporation of MLC2vGFP into sarcomeric units of ES-derived cardiomyocytes
expressing RacV12 and an inhibition of the process in cells early or lately
expressing RacN17. This effect is likely to depend on lamellipodia generated
at the membrane by Rac. These actin structures serve as a niche for the
setting of the first contractile proteins within the z-bodies
(Sanger et al.,
2000). Second, Rac prolongs proliferation of cardioblasts, as
shown by both Ki67 and BrdU staining
(Figure 9). This result is in
line with the cardiac phenotype of RhoGDI-overexpressing mice
(Wei et al., 2002)
and with the expected effect of Rac on cyclin D1
(Coleman and Marshall, 2001),
E2F stimulation and pRb hyperphosphorylation
(Gjoerup et al.,
1998).
Rac delays cardiac differentiation by repressing expression of a major
cardiac transcription factor, MEF2C. At very early stages of differentiation
and during gastrulation, the GTPase may thus be critical to facilitate
proliferation and migration of cells, including muscle precursors
(Sugihara et al.,
1998; Settleman,
1999,
2000,
2001;
Knight et al., 2000),
while preventing cell differentiation of one of the earliest cell types
developing in the embryo, namely, the cardioblast. This could be mediated
partially by ROS and NF
B pathways
(Joneson and Bar-Sagi, 1998;
Babior, 1999;
Joyce et al., 1999).
Rac-induced ROS may also be critical for the physiological apoptotic process
that occurs during early stages of embryogenesis
(Pampfer, 2000;
Poelmann et al.,
2000). At later stages, Rac activated by cardiogenic factors such
as TGF (Mucsi et al.,
1996; Atfi et al.,
1997) becomes essential in the process of cardioblast
proliferation and myofibrillogenesis of cardiomyocytes.
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
Footnotes |
|---|
Corresponding author. E-mail address:
puceat{at}crbm.cnrsmop.fr.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Atfi, A., Djelloul, S., Chastre, E., Davis, R., and Gespach, C.
(1997). Evidence for a role of Rho-like GTPases and
stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) in
transforming growth factor beta-mediated signaling. J. Biol.
Chem. 272,
1429–1432.
Babior, B.M. (1999). NADPH oxidase: an update.
Blood 93,
1464–1476.
Behfar, A., Zingman, L., Hodgson, D., Rauzier, J., Kane, G.,
Terzic, A., and Pucéat, M. (2002). Stem cell
differentiation requires a paracrine pathway in the heart. FASEB
J. 16,
1558–1566.
Bishop, A.L., and Hall, A. (2000). Rho GTPases and their effector proteins. Biochem J. 348(Pt 2): 241–255.
Bony, C., Roche, S., Sasaki, T., Crackowe, M., Penninger, J., Mano,
H., and Pucéat, M. (2001). A specific role of
phosphatidylinositol 3-kinase 
: a regulation of autonomic
Ca2+ oscillations in cardiac cells. J. Cell
Biol. 152,
717–728.
Chen, J., Kubalak, S.W., Minamisawa, S., Price, R.L., Becker, K.D.,
Hickey, R., Ross, J., and Chien, K.R. (1998). Selective
requirement of myosin light chain 2v in embryonic heart function. J.
Biol. Chem. 273,
1252–1256.
Cheng, G., Cao, Z., Xu, X., van Meir, E.G., and Lambeth, J.D. (2001). Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5. Gene 269, 131–140.[CrossRef][Medline]
Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162, 156–159.[Medline]
Coleman, M.L., and Marshall, C.J. (2001). A family outing: small GTPases cyclin' through G1. Nat. Cell Biol. 3, E250–E251.[CrossRef][Medline]
De Leo, F.R., Ulman, K.V., Davis, A.R., Jutila, K.L., and Quinn,
M.T. (1996). Assembly of the human neutrophil NADPH oxidase
involves binding of p67phox and flavocytochrome b to a common functional
domain in p47phox. J. Biol. Chem.
271,
17013–17020.
Freeman, J.L., Abo, A., and Lambeth, J.D. (1996). Rac
"insert region" is a novel effector region that is implicated in
the activation of NADPH oxidase, but not PAK65. J. Biol. Chem.
271,
19794–19801.
Gjoerup, O., Lukas, J., Bartek, J., and Willumsen, B.M.
(1998). Rac and Cdc42 are potent stimulators of E2F-dependent
transcription capable of promoting retinoblastoma susceptibility gene product
hyperphosphorylation. J. Biol. Chem.
273,
18812–18818.
Harvey, R. (1999). Seeking a regulatory roadmap for heart morphogenesis. Semin. Cell Dev. Biol. 10, 99–107.
Joneson, T., and Bar-Sagi, D. (1998). A Rac1 effector
site controlling mitogenesis through superoxide production. J. Biol.
Chem. 273,
17991–17994.
Joyce, D. et al. (1999). Integration of
Rac-dependent regulation of cyclin D1 transcription through a nuclear
factor-kappaB-dependent pathway. J. Biol. Chem.
274,
25245–25249.
Knight, B., Laukaitis, C., Akhtar, N., Hotchin, N.A., Edlund, M., and Horwitz, A.R. (2000). Visualizing muscle cell migration in situ. Curr. Biol. 10, 576–585.[CrossRef][Medline]
Leahy, A., Xiong, J.W., Kuhnert, F., and Stuhlmann, H. (1999). Use of developmental marker genes to define temporal and spatial patterns of differentiation during embryoid body formation. J Exp Zool. 284, 67–81.[CrossRef][Medline]
Lin, R., Cerione, R.A., and Manor, D. (1999). Specific
contributions of the small GTPases Rho, Rac, and Cdc42 to Dbl transformation.
J. Biol. Chem. 274,
23633–23641.
Linask, K.K., Knudsen, K.A., and Gui, Y.H. (1997). N-cadherincatenin interaction: necessary component of cardiac cell compartmentalization during early vertebrate heart development. Dev. Biol. 185, 148–164.[CrossRef][Medline]
Meyer, N., Jaconi, M., Ladopoulou, A., Fort, P., and Puceat, M. (2000). A fluorescent reporter gene as a marker for ventricular specification in ES-derived cardiac cells. FEBS Lett. 478, 151–158.[CrossRef][Medline]
Morel, Y., and Barouki, R. (1999). Repression of gene expression by oxidative stress. Biochem. J. 342(Pt 3): 481–496.
Mucsi, I., Skorecki, K.L., and Goldberg, H.J. (1996).
Extracellular signal-regulated kinase and the small GTP-binding protein, Rac,
contribute to the effects of transforming growth factor-beta1 on gene
expression. J. Biol. Chem. 271,
16567–16572.
Nisimoto, Y., Freeman, J.L.R., Motalebi, S.A., Hirshberg, M., and
Lambeth, J.D. (1997). Rac binding to p67(phox). Structural basis
for interactions of the Rac1 effector region and insert region with components
of the respiratory burst oxidase. J. Biol. Chem.
272,
18834–18841.
Pampfer, S. (2000). Apoptosis in rodent peri-implantation embryos: differential susceptibility of inner cell mass and trophectoderm cell lineages—a review. Placenta 21(Suppl A): S3–S10.
Poelmann, R.E., Molin, D., Wisse, L.J., and Gittenberger-de Groot, A.C. (2000). Apoptosis in cardiac development. Cell Tissue Res. 301, 43–52.[CrossRef][Medline]
Price, M.O., Atkinson, S.J., Knaus, U.G., and Dinauer, M.C. (2002). Rac activation induces NADPH oxidase activity in transgenic COSphox cells and level of superoxide production is exchange factor-dependent. J. Biol. Chem. 27, 19220–19228.
Roux, P., Gauthier-Rouviere, C., Doucet-Brutin, S., and Fort, P. (1997). The small GTPases Cdc42Hs, Rac1 and RhoG delineate Raf-independent pathways that cooperate to transform NIH3T3 cells. Curr. Biol. 7, 629–637.[CrossRef][Medline]
Sah, V.P., Minamisawa, S., Tam, S.P., Wu, T.H., Dorn, G.W., 2nd, Ross, J., Jr., Chien, K.R., and Brown, J.H. (1999). Cardiac-specific overexpression of RhoA results in sinus and atrioventricular nodal dysfunction and contractile failure. J. Clin. Invest. 103, 1627–1634.[Medline]
Sah, V.P., Seasholtz, T.M., Sagi, S.A., and Brown, J.H. (2000). The role of Rho in G protein-coupled receptor signal transduction. Annu. Rev. Pharmacol. Toxicol. 40, 459–489.[CrossRef][Medline]
Sanger, J.W., Ayoob, J.C., Chowrashi, P., Zurawski, D., and Sanger, J.M. (2000). Assembly of myofibrils in cardiac muscle cells. Adv. Exp. Med. Biol. 481, 89–102; discussion 103–105.[Medline]
Sauer, H., Rahimi, G., Hescheler, J., and Wartenberg, M. (2000). Role of reactive oxygen species and phosphatidylinositol 3-kinase in cardiomyocyte differentiation of embryonic stem cells. FEBS Lett. 476, 218–223.[CrossRef][Medline]
Scholzen, T., and Gerdes, J. (2000). The Ki-67 protein: from the known and the unknown. J. Cell. Physiol. 182, 311–322.[CrossRef][Medline]
Settleman, J. (1999). Rho GTPases in development. Prog. Mol. Subcell. Biol. 22, 201–229.[Medline]
Settleman, J. (2000). Getting in shape with Rho. Nat. Cell Biol. 2, E7–E9.[CrossRef][Medline]
Settleman, J. (2001). Rac'n Rho: the music that shapes a developing embryo. Dev. Cell 1, 321–331.[CrossRef][Medline]
Sugihara, K. et al. (1998). Rac1 is required for the formation of three germ layers during gastrulation. Oncogene 17, 3427–3433.[CrossRef][Medline]
Sussman, M.A., Welch, S., Walker, A., Klevitsky, R., Hewett, T.E., Price, R.L., Schaefer, E., and Yager, K. (2000). Altered focal adhesion regulation correlates with cardiomyopathy in mice expressing constitutively active rac1. J. Clin. Invest. 105, 875–886.[Medline]
Takai, Y., Sasaki, T., and Matozaki, T. (2001). Small
GTP-binding proteins. Physiol. Rev.
81,
153–208.
Van Aelst, L., and D'Souza-Schorey, C. (1997). Rho
GTPases and signaling networks. Genes Dev.
11,
2295–2322.
van Wetering, S., van Buul, J.D., Quik, S., Mul, F.P., Anthony,
E.C., ten Klooster, J.P., Collard, J.G., and Hordijk, P.L.
(2002). Reactive oxygen species mediate Rac-induced loss of
cell-cell adhesion in primary human endothelial cells. J. Cell
Sci. 115,
1837–1846.
Wei, L., Imanaka-Yoshida, K., Wang, L., Zhan, S., Schneider, M.D.,
DeMayo, F.J., and Schwartz, R.J. (2002). Inhibition of Rho family
GTPases by Rho GDP dissociation inhibitor disrupts cardiac morphogenesis and
inhibits cardiomyocyte proliferation. Development
129:
1705–1714.
This article has been cited by other articles:
|
|
 |
|
  M.-H. Lee, Y. S. Cho, and Y.-M. Han Simvastatin Suppresses Self-Renewal of Mouse Embryonic Stem Cells by Inhibiting RhoA Geranylgeranylation Stem Cells, July 1, 2007; 25(7): 1654 - 1663. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kapur and K. Banach Inositol-1,4,5-trisphosphate-mediated spontaneous activity in mouse embryonic stem cell-derived cardiomyocytes J. Physiol., June 15, 2007; 581(3): 1113 - 1127. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Bedard and K.-H. Krause The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology Physiol Rev, January 1, 2007; 87(1): 245 - 313. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Li, M. Stouffs, L. Serrander, B. Banfi, E. Bettiol, Y. Charnay, K. Steger, K.-H. Krause, and M. E. Jaconi The NADPH Oxidase NOX4 Drives Cardiac Differentiation: Role in Regulating Cardiac Transcription Factors and MAP Kinase Activation Mol. Biol. Cell, September 1, 2006; 17(9): 3978 - 3988. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Veracini, M. Franco, A. Boureux, V. Simon, S. Roche, and C. Benistant Two distinct pools of Src family tyrosine kinases regulate PDGF-induced DNA synthesis and actin dorsal ruffles J. Cell Sci., July 15, 2006; 119(14): 2921 - 2934. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Brown, D. P. Del Re, and M. A. Sussman The Rac and Rho Hall of Fame: A Decade of Hypertrophic Signaling Hits Circ. Res., March 31, 2006; 98(6): 730 - 742. [Abstract] [Full Text] [PDF] |
0.001). The inset show the overexpression of the GTPases in
day 5 EBs assessed by RT-PCR.
) or RacL61D38 EBs (
). *Significantly different from control; p
) or 5
(
) with 1000 U/ml catalase. *Significantly different from control; p
