|
|
|
|
Vol. 14, Issue 7, 2793-2808, July 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



*Institut Curie, UMR144 CNRS, 75248 Paris Cedex
05 France;
Department of Molecular, Cellular,
and Developmental Biology, University of Colorado, Boulder, Colorado
80309-0347; and ¶Department of Microbiology,
Columbia University, New York, New York 10032
Submitted October 17, 2002;
Revised February 28, 2003;
Accepted March 3, 2003
Monitoring Editor: Tim Stearns
| ABSTRACT |
|---|
|
|
|---|
cdc31 cells and cdc31 conditional mutant cells arrest
in mitosis with a monopolar mitotic spindle organized from a single SPB. EM
analysis demonstrates that mutant cdc31 cells fail to duplicate the
SPB. In addition, cdc31p exhibits genetic interactions with the SPB component
sad1p and is required for sad1p localization. Finally, cdc31 mutant
can undergo single or multiple rounds of septation before the exit from
mitosis, suggesting that cdc31p activity or SPB duplication may be required
for the proper coordination between the exit from mitosis and the initiation
of septation. | INTRODUCTION |
|---|
|
|
|---|
In fission yeast, the SPB is a nuclear-associated organelle composed of a
layered cytoplasmic part and an electron dense nuclear part separated by the
nuclear envelope. An electron dense particle, lying on the nuclear envelope
beside the layered cytoplasmic part of the SPB, has been proposed to be
analogous to budding yeast half-bridge. Fission yeast SPB duplication is
thought to occur in the cytoplasm in late G2 when the single SPB structure is
replaced by two smaller structures connected by an electron dense bridge. No
intermediate state in SPB duplication such as the formation of a satellite has
been described to date. At the onset of mitosis, the SPBs are inserted into
the nuclear envelope and organize the assembly of an intranuclear spindle
(Ding et al.,
1997
).
Molecular mechanisms that underline centrosome duplication process are
still poorly understood. However, molecular characterization of centrosomes
has revealed that key components controlling centrosome functions have been
conserved despite the large structural diversity of centrosomes among
eukaryotes. For instance, a gamma-tubulin containing complex controlling
microtubule nucleation has been characterized both in yeast and in animal
cells (for reviews see Tassin and Bornens,
1999
and Knop et al.,
1999
; see also Vardy et
al., 2002
). Molecular mechanisms controlling the centrosome
duplication process may have also been conserved because orthologues of genes
required for SPB duplication in budding yeast also appear to regulate
centrosome duplication in Schizosaccharomyces pombe or in animal
cells (Baum et al.,
1986
; Winey et al.,
1993
; West et al.,
1998
; Middendorp et
al., 2000
).
One of the budding yeast genes implicated in SPB duplication,
CDC31, encodes a Ca2+-binding protein of the
centrin family (Baum et al.,
1986
). It is a component of the half-bridge structure of the SPB
(Spang et al., 1993
).
Analysis of thermosensitive mutants has demonstrated that this essential gene
is required in an early stage of SPB duplication because formation of the
satellite does not occur in these mutants
(Byers, 1981
;
Schild et al., 1981
).
ScCdc31p association with the half-bridge depends on another half-bridge
component Kar1p (Biggins and Rose,
1994
; Spang et al.,
1995
). How ScCdc31p mediates the formation of the satellite at the
end of the half-bridge remains completely unknown.
Human centrin 3 (CTN3 gene in human genome database) belongs to
the same subfamily of centrins as ScCdc31p and is concentrated at the
centrosome in the distal lumen of centrioles
(Middendorp et al.,
1997
). Functional experiments have shown that expression of
HsCen3p has a dominant negative effect on centrosome duplication both in yeast
and in Xenopus eggs (Middendorp
et al., 2000
), suggesting the HsCen3p participate in
centrosome duplication in human cells and shares a common function with
ScCdc31p.
Here, we report the characterization of ScCDC31/HsCen3 orthologue in fission yeast. We demonstrate that S. pombe cdc31p is a component of the half-bridge of the SPB required for SPB duplication. In addition, our data suggest that cdc31p and sad1p, another SPB component required for bipolar spindle formation, may act in the same pathway. Finally, because cdc31 cells blocked in mitosis proceed to septation and display a multiseptation phenotype, we propose that cdc31p activity or SPB duplication may be required for the proper coordination between the exit from mitosis and the initiation of septation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains and Genetic Methods
Standard S. pombe genetic techniques and cultures were performed
as described at
http://wwww.bio.uva.nl/pombe/handbook/.
All S. pombe strains were isogenic to 972 and are listed in
Table 1. Yeast transformations
were performed by electroporation (Kelly
et al., 1993
) or by the lithium acetate-DMSO method for
integration of linear DNA (Bahler et
al., 1998b
).
|
Cloning of cdc31, HsCen3, and ScCDC31
To clone cdc31, a 780-base pair (bp) fragment of DNA containing
cdc31 ORF was amplified by PCR from genomic DNA (forward oligo:
cacactcgagGTCATGTAAATACTCACACAC; reverse oligo:
ttggatccGTAAATTAGCATGTGTTCTCC).
After purification of the fragment (PCR purification kit, Qiagen, Valencia,
CA), fragment ends were digested by XhoI and BamH1 (sites
added on oligos) and ligated at same sites in pREP41X
(Forsburg, 1993
) to generate a
LEU2+ pnmt*-cdc31 plasmid (pAP 80). Absence of PCR-induced mutations was
checked by sequencing. Then, an XhoI-BamH1 fragment from
pAP80 was subcloned at XhoI and BglII sites of pSLF273 and
pSLF173 (Forsburg and Sherman,
1997
) to generate ura4+ pnmt*-cdc31 and pnmt-cdc31 plasmids
(pAP101 and pAP123), respectively.
To generate an in frame N-terminal fusion of GFP with cdc31p a NotI-BamH1 fragment including cdc31 ORF was amplified from genomic DNA using oligonucleotides ggaagaattgcggccgcATGTTTGCTAACGCACGGG and ttggatccGTAAATTAGCATGTGTTCTCC. This fragment was ligated to NotI and BglII sites in pSGP573 (generous gift from S. Forsburg) to obtain pAP81. Finally, nmt promoter was replaced by nmt* promoter from pREP41X plasmid using the PstI and XhoI sites to obtain a ura4+ pnmt*-GFPcdc31 plasmid (pAP83). pnmt-HA3cdc31 plasmid (pAP158) was obtained by subcloning a NotI-SacI fragment from pAP81 into pSLF173.
For expression of HsCen3 and ScCDC31 in fission yeast, an
SalI-BamHI fragment from pUF10 (gift from E. Schiebel)
containing ScCDC31 complete ORF was subcloned in pSLF273 at
XhoI and BglII sites to obtain plasmid pnmt*-ScCDC31
(pAP103). A XhoI-BamHI fragment encoding HsCen3p was
amplified by PCR from HsCen3 pBS-KS plasmid
(Middendorp et al.,
1997
) using oligos cacactcgagatgagtttagctctgagaagtg and
ttggatccttaaatgtcaccagtcataatagc and ligated in pSLF273 at XhoI and
BglII sites to obtain pnmt*-HsCen3 plasmid (pAP100).
All fragments amplified by PCR were checked by sequencing (Genomexpress, Meylan, France).
Deletion of cdc31, Tetrad Analysis, and Germination of Random
Spores
Deletion of cdc31 ORF was achieved by homologous recombination
according to Bahler et al.
(1998b
): KanMX cassette was
amplified by PCR from kanMX4 plasmid using a forward oligonucleotide
corresponding to 80 bp right upstream of cdc31 ATG codon and a
reverse oligonucleotide corresponding to 80 bp right downstream of
cdc31 stop codon and transformed into the diploid strain FC584.
Stable transformants were then selected to obtain a
cdc31/cdc31+ strain (AP54). Presence of the
cdc31 allele was confirmed by PCR.
To analyze the progeny of the
cdc31/cdc31+ strain,
sporulation was induced on ME plates (BIO 101, Carlsbad, CA) for 2 d and
tetrads dissected using an automated tetrad dissector (MSM, Singer
Instruments, Somerset, UK). Spores were allowed to germinate and form colonies
at 25°C on YE5S medium. Finally, colonies were replicated on YE5S plates
containing 50 mg/l G418. Or, to generate random spores, parental diploid cells
were digested by overnight treatment with 5 µl/ml glusulase (NEN, Boston,
MA) in H2O. Germination was then allowed by incubation of spores in
YE5S liquid medium at 25°C for 15 h.
Production of Conditional cdc31 Mutants
A point mutation leading to an E-to-K substitution at position 147 of
cdc31p was first introduced in cdc31 sequence by double PCR: in a
first round, a 660-bp 5' fragment was amplified by PCR from pAP80 using
oligos cacactcgagGTCATGTAAATACTCACACAC and GTCGATGTTTTCATTAAGCTC. A 140-bp
3' fragment containing the mutation and overlapping the 5'
fragment on 20 base pairs was amplified by PCR using oligos
GAGCTTAATGAAAACATCGACGATCAGAAATTGGAAGC and ggatccGTAAATTAGCATGTGTTCTCC. The
full-length E147K-cdc31 fragment was obtained in second round of PCR
using the purified 5' and 3' fragments and oligos
ctcgagGTCATGTAAATACTCACACAC and ggatccGTAAATTAGCATGTGTTCTCC and cloned at
XhoI-BamH1 sites in pREP41X to obtain pRH3. Presence of the
mutation was checked by sequencing.
The mutated construct or wild-type cdc31 were then cloned in integrative
plasmid JK148 (Keeney and Boeke,
1994
) together with nmt* promoter and nmt termination sequence
from pREP41X in two steps: A PstI-BamH1 fragment from pAP80
containing nmt*promoter and cdc31 was cloned at similar sites in pJK148. Then
a SacI-SacI fragment from pAP80 or pRH3 containing the
wild-type or mutated 3' of cdc31 and nmt* termination sequence was
cloned in the resulting plasmid to obtain pRH19 and pRH20.
Plasmids pRH19 and pRH20 were linearized in leu1 sequence using
NruI and transformed into AP274 strain (
cdc31 +
pAP101). Stable integrants were selected. Finally, pAP101 plasmid
(ura4+) was lost spontaneously after three rounds of growth in patches on
plates of minimum medium containing adenine and uracil, resulting in strains
AP388 (pnmt*-E147Kcdc31 mutant) and AP390 (pnmt*cdc31
mutant).
Production of sad1-1 pnmt*-E147Kcdc31 and alp4-1491 pnmt*-E147Kcdc31
Double Mutants
Strain IH274 was first crossed to strain FC420 to obtain an h+
sad1-1 strain (strain AP600). Strain AP600 was then crossed to strain
AP388 (
cdc31 + pnmt*-E147Kcdc31 integrated). No
double mutant was recovered but strain AP607 (sad1-1 +
pnmt*-E147Kcdc31 integrated) was selected and further crossed to
strain AP388 transformed by pAP101 (pnmt*-cdc31 ura4+ plasmid) to complement
cdc31 function. Finally, strains AP662 and AP666 (sad1-1
cdc31 + pnmt*-E147Kcdc31 integrated and
cdc31 + pnmt*-E147Kcdc31 integrated) were obtained
from two strains selected from this cross submitted to two successive
incubations on EMM plates containing 1 mg/ml 5FOA, 50 mg/l uracil, and 225
mg/l adenine at 25°C to induce the loss of pAP101 plasmid.
Strain DH1891 (alp4-1891 leu1-32 h-; generous gift from T. Toda)
was crossed to strain FC420 to obtain an h+ alp4-1891 strain
(AP837). Strain AP837 was then crossed to AP388 transformed by pAP101 to
obtain strains AP899 (alp4-1891 + pnmt*-E147Kcdc31
integrated), AP900 (alp4-1891
cdc31 +
pnmt*-E147Kcdc31 integrated), and AP901 (
cdc31 +
pnmt*-E147Kcdc31 integrated) after incubation on 5FOA as described
above.
Analysis of Growth after Serial Dilutions and Growth in Liquid
Culture
Growth of mutant strains AP388, AP390, AP607, AP662, AP666, AP899, AP900,
and AP901 was evaluated after serial 1/10 dilutions of exponentially growing
cultures at OD 595 nm 0.3. Drops of 5 µl were deposited on
plates of minimum medium containing uracil, adenine, 0.250 ml/l YE-phloxin B
solution (BIO101, Carlsbad, CA) with or without 5 µg/ml thiamine and
incubated at 30 or 36°C until the colony formed. Growth of strains
overexpressing cdc31p or HA3cdc31p (AP360, AP555, AP634, AP633,
AP635, AP681, AP843, AP846, AP890, AP893, and AP 896) was evaluated
similarly.
For cytological studies, pnmt*-E147Kcdc31 cells were grown in exponential phase in liquid EMM supplemented with adenine and uracil at 25°C and shifted to 36°C in presence of 0.5 µg/ml thiamine.
Western Blots
Anti-HsCen3p Igs were produced as follows: 6 Histidine-tagged HsCen3p was
produced in bacteria, purified on nickel columns, and injected to rabbits. For
purification of specific Igs, 6 Histidine-tagged HsCen3p was coupled to
sepharose (Aminolink plus coupling gel, Pierce). Igs adsorbed on the column in
PBS buffer were eluted in 100 mM glycine, pH 2.7, immediately neutralized by
addition of 1 M Tris, pH 8.9, dialyzed, and concentrated to 1 mg/ml in
PBS.
Total extracts were prepared as follows: exponentially growing cells were centrifuged and concentrated in 250 µl PBS containing 2 mM EDTA, 1 mM PMSF, 10 µg/ml aprotinin, and 1 µg/ml pepstatin and leupeptin. Two hundred fifty microliters acid-washed glass beads (Sigma, St. Louis, MO) were added and tubes submitted to 15 min of vortexing at maximum speed on a IKA-vibrax VXA shaker. After addition of 250 µl of 2x sample buffer (125 mM Tris, pH 6.8, containing 6% SDS, 10% 2-mercaptoethanol and 20% glycerol), extracts were boiled for 5 min, centrifuged at 10,000 x g for 15 min, and supernatants were recovered.
Protein concentration was assayed by Coomassie blue staining. Equal amounts
of extracts were loaded on 12% SDS-PAGE and blotted on nitrocellulose
according to Towbin et al.
(1979
). Proteins were fixed on
nitrocellulose by a 15-min incubation in TBS containing 0.2% glutaraldehyde.
cdc31p was revealed using anti-HsCen3p affinity-purified Igs (1:250),
peroxidase-coupled anti-rabbit Igs (1: 10,000; Jackson ImmunoResearch, West
Grove, PA) and a chemoluminescent revelation kit (Pierce, Rockford, IL).
Immunofluorescence and Microscopy
For immunofluorescence, cells were fixed by plunging cells in
20°C methanol after filtration on a HVLP 0.45-µm filter
(Millipore, Bedford, MA). Cells were incubated in methanol for 5 min before
rehydratation in PEM buffer (0.1 M NaPipes, pH 6.8, 1 mM EGTA, 1 mM
MgCl2). Cells were further processed as described (Snell and Nurse,
1993). Anti-HsCen3p affinity-purified Igs were used (1:100) together with a
Cy3-conjugated anti-rabbit secondary antibody (1:1000; Jackson
ImmunoResearch). Tubulin was stained using mAb TAT1 (1:10; generous gift of K.
Gull) and an Oregon Green 488-coupled anti-mouse antibody (1:200; Molecular
Probes, Eugene, OR).
For
-tubulin, sad1p, MTs, or mid1p stainings, cells were fixed with
4% formaldehyde for 1 h by addition of a 2:1 mix of 16% EM-grade formaldehyde
(Electron Microscopy Sciences, Ft. Washington, PA) and PEM buffer and further
processed as described (Snell and Nurse, 1993). Sad1 serum was diluted 1:3 and
TAT1 1:10.
-tubulin mAb (Sigma) was diluted 1/100.
Anti-mid1p antibody was obtained by monthly injection of a rabbit (BabCo,
Tucson, AZ) with 150 µg GST-mid1 (aa 309505) fusion protein produced
in XL1blue bacteria from pGex-Dmf1 plasmid
(Sohrmann et al.,
1996
; generous gift from V. Simanis) and purified by SDS-PAGE from
the Triton-insoluble fraction. Serum was affinity-purified by retroelution on
a His3-tagged mid1p fragment (aa 300506) as described in
Paoletti and Chang (2000
),
except that elution was performed at pH 2.2. Purified Igs were diluted 1:5.
Secondary antibodies were respectively Cy3-conjugated anti-rabbit secondary
antibody (1:1000, Jackson ImmunoResearch) and Oregon Green 488-coupled
anti-mouse antibody (1:200, Molecular Probes).
Cell wall and septum staining was performed as reported for calcofluor staining in Paoletti et al. (2000), using 2 µg/ml fluostain I (Sigma). For nuclei staining, cells were fixed in formaldehyde 4% for 5 min, permeabilized in PEM containing 1% Triton X-100, and stained with DAPI (1 µg/ml). Two microliters of stained cells was mounted between slide and coverslip and readily observed.
Images were acquired with a DMZ Leica microscope and a Hamamatsu CCD
camera. For electron microscopy cells were prepared as previously described
(Giddings et al.,
2001
). Briefly, cells were rapidly frozen by high-pressure
freezing (BAL-TEC HPM-010, Technotrade International, Manchester, NH),
freeze-substituted at 90°C in 2% osmium tetroxide plus 0.1% uranyl
acetate in acetone followed by embedding in Epon-Araldite. Serial sections (60
nm) were cut on an Ultracut E microtome (Leica Microsystems, Bannockburn,
IL.), poststained with uranyl acetate and lead citrate, and imaged in a
Philips CM10 electron microscope operating at 80 kV. For immunolocalization,
cells were frozen as above and then freeze substituted in 0.25% glutaraldehyde
plus 0.05% uranyl acetate in acetone and then embedded in Lowicryl HM20 resin
and UV-polymerized at 35°C. Embedded cells were sectioned as above
and immunostained as previously described using anti-HsCen3p Igs (1:100) and
secondary antibodies conjugated to 10-nm colloidal gold (BB International,
Cardiff, UK). Immunostained sections were poststained and imaged as above.
Synchronization of pnmt*-E147K cdc31 Mutant
To synchronize pnmt*-E147Kcdc31 mutant, cells were grown
exponentially at 30°C in EMM medium complemented with adenine and uracil
and shifted at 36°C in presence of 0.5 µg/ml thiamine and 11 mM
hydroxyurea (HU; Sigma) for 3 h. Cells were then filtered on 0.2-µm HVLP
filters (Millipore) to remove HU, resuspended in fresh medium containing
thiamine equilibrated at 36°C (see t = 0 in
Figure 10), and further
incubated at 36°C. The percentage of cells with a bipolar or monopolar
spindle was determined from MT staining on 400 cells at each time point.
Percentage of cells with a monopolar spindle and a septum or short separated
cell with a monopolar spindle was determined on 200 cells presenting a
monopolar spindle according to mid1p staining. Percentage of cells with a
normal septum or multiple or abnormal septa was determined on 400 cells
stained with fluostain I.
|
| RESULTS |
|---|
|
|
|---|
|
An immunoblot of total S. pombe protein extract with an anti-HsCen3p affinity-purified antibody revealed a protein of 23 kDa, suggesting that the antibody was able to cross-react with the product of S. pombe cdc31 gene (Figure 1C). To test whether this cross-reacting protein was cdc31p, we placed the cdc31 gene alone, or in frame with the GFP coding sequence, under the control of the nmt* thiamine-sensitive promoter (pnmt*-cdc31 and pnmt*-GFPcdc31 plasmids; see MATERIAL AND METHODS). Plasmids were transformed into wild-type cells and expression of cdc31p or GFPcdc31 fusion protein was induced by removal of thiamine from the medium for 16 h. Anti-HsCen3p Igs revealed an increased 23-kDa band in extracts from cells transformed with the pnmt*-cdc31 plasmid. In the case of the pnmt*-GFPcdc31 plasmid, a 50-kDa band, corresponding to the expected molecular weight of the GFPcdc31 fusion protein was observed as well as a degradation pattern underneath (Figure 1C).
These results indicate that cdc31 gene encodes a 23-kDa protein that is recognized by the anti-HsCen3p Igs.
cdc31p Is a Component of the Half-bridge of the Spindle Pole
Body
To determine the subcellular localization of cdc31p, we performed
immunofluorescence experiments on wild-type cells fixed in 20°C
methanol using anti-HsCen3p Igs and antitubulin mAb TAT1
(Figure 2A). Cdc31p was present
in one or two bright juxta-nuclear spots. Interphase cells exhibited a single
cdc31p spot associated with one bundle of microtubules, whereas mitotic cells
exhibited two bright spots at the poles of the mitotic spindle. In postmitotic
cells presenting a postanaphase array of MTs, a single spot was associated
with each nucleus. In addition, an irregular background was consistently
observed all over the cell, suggesting that the protein may also be present in
other cellular compartments as reported for centrins in animal cells
(Paoletti et al.,
1996
). No specific staining was found at the equatorial MTOCs
during septation nor at interphase MTOCs on the nuclear envelope.
|
This data suggested that the protein was concentrated at the SPB. To
further test the colocalization of cdc31p with the SPB, we stained a strain
expressing a cam1-GFP fusion protein that localizes to the SPB
(Moser et al., 1997
)
with anti-HsCen3p Igs. cdc31p and cam1-GFP clearly colocalized at the SPB
(Figure 2B).
Finally, to determine the ultrastructural localization of the protein, we
performed immunogold labeling of cdc31p on wild-type cells. Clusters of gold
particles were found on adjacent serial sections in association with an
electron-dense appendage corresponding to the half-bridge of the SPB
(Figure 3, A2A4, and B3
and B4). No gold particle was detected on the SPB-layered structure
(Figure 3, arrows in
AC). cdc31p was also detected in the bridge connecting the two
duplicated SPBs (Figure 3C) and
on the side of spindle poles during mitosis
(Figure 3D). Interestingly,
gold beads were distributed throughout the half-bridge appendage rather than
on the nuclear facing surface. Therefore, cdc31p association with the
half-bridge is unlikely to depend on a membrane spanning protein as reported
for ScCDC31 in budding yeast
(Spang et al., 1993
,
Biggins and Rose, 1994
; see
DISCUSSION).
|
cdc31 Is an Essential Gene Required for Bipolar Spindle
Formation
To determine the function of cdc31 in fission yeast, we deleted in
a diploid strain one copy of the whole gene and replaced it by homologous
recombination by the kanMX cassette conferring resistance to G418 (strain
AP54; Figure 4A and
Table 1). After sporulation,
tetrads were dissected and spores allowed to germinate and form colonies on
YE5S plates at 25°C. Only two spores per tetrad gave rise to colonies.
These colonies were not resistant to G418, indicating that none of the
cdc31 segregants were viable
(Figure 4B). We thus conclude
that cdc31 is an essential gene.
|
Random spores were then produced from the diploid strain and allowed to
grow in liquid YE5S medium for 15 h, fixed in 20°C methanol, and
processed for immunofluorescence with anti-HsCen3p Igs and antitubulin mAb
TAT1. Two populations of cells were observed: cdc31+ cells with a
cdc31p staining on the SPB and
cdc31 cells with no cdc31p SPB
staining. The
cdc31 cells exhibited abnormal aster or V-shaped
microtubule structures likely representing monopolar spindles and
hypercondensed chromosomes (Figure
4C). This phenotype suggested that cdc31 is necessary for
bipolar spindle formation.
HsCen3p Expression in Fission Yeast Is Toxic
We next investigated the ability of genes of the centrin 3/Cdc31p subfamily
of centrins to complement cdc31 deletion in S. pombe. We
found that neither ScCdc31p, nor HsCen3p expression, could complement
cdc31 deletion in a plasmid loss assay (our unpublished results).
Then, we examined the effect of overexpressing Spcdc31p or expressing
HsCen3p or ScCdc31p in fission yeast from the medium strength nmt* promoter.
cdc31p overexpression from nmt* promoter did not affect growth
(Figure 5, A and B), nor from
the full-strength nmt promoter (see Figure
9C). ScCdc31p expression had no effect either. In contrast,
HsCen3p production inhibited colony formation. Analysis of cells expressing
HsCen3p by immunofluorescence revealed an accumulation of cells with monopolar
spindles (Figure 5C). This
suggests that HsCen3p has a dominant negative effect on SPB duplication in
fission yeast as reported in budding yeast
(Figure 5A;
Middendorp et al.,
2000
). These results also indicate that ScCdc31p and HsCen3p
cannot carry out S. pombe cdc31p function.
|
|
Construction of cdc31 Conditional Mutants
To further characterize cdc31 function in fission yeast, we
generated conditional cdc31 mutants. These mutants were obtained by
stable integration in a
cdc31 strain of plasmids in which
wild-type cdc31 or mutated E147Kcdc31 were placed under the
control of the repressible nmt* promoter (E147K mutation is analogous to the
mutation present in cdc312 thermosensitive mutant in
Saccharomyces cerevisiae; Biggins
and Rose, 1994
).
Growth of these mutant strains (AP390 and AP388 hereafter named pnmt*-cdc31 and pnmt*-E147Kcdc31 mutants) was analyzed on plates after serial dilutions of exponentially growing liquid cultures (Figure 6A). In thiamine-free medium, both strains grew similarly to wild-type cells at 30 or 36°C. But both strains were thiamine sensitive: pnmt*-cdc31 mutant turned pink on minimum medium containing phloxin and thiamine, and pnmt*-E147Kcdc31 mutant was not able to form colonies. For this strain, any residual growth was abolished when cells were grown at 36°C in the presence of thiamine.
|
Expression levels of the mutant protein E147Kcdc31 were then analyzed by Western blotting. At 30°C in absence of thiamine E147Kcdc31p was slightly less expressed than cdc31p in wild-type cells. Depletion of E147Kcdc31p could readily be observed 24 h after addition of thiamine at 36°C. Almost no protein was detected from 6 h on. Comparable levels of expression were observed in pnmt*-cdc31 mutant.
In conclusion, E147K point mutation, does not confer a thermosensitive phenotype when expressed at endogenous levels, and depletion of cdc31p by addition of thiamine in pnmt*-cdc31 mutant is not sufficient to stop growth. However, combining E147K mutation and depletion effectively abolishes cdc31 function.
Two other strains carrying point mutations in cdc31 (A62T and
P108S; corresponding to cdc31-1, cdc315 mutants in S.
cerevisiae; Biggins and Rose,
1994
) behaved similarly to pnmt*-E147Kcdc31 mutant (unpublished
data) and displayed similar phenotypes (see below).
Chromosome Segregation Defects and Monopolar Spindle Formation in
Conditional cdc31 Mutant
Because the growth of pnmt*-E147Kcdc31 mutant was completely
abolished in thiamine at 36°C, we choose these experimental conditions to
further analyze the function of cdc31 gene. Cells were grown in
exponential phase in absence of thiamine and shifted to 36°C in presence
of thiamine for 212 h, fixed in formaldehyde, and stained with DAPI.
Various abnormal nuclear structures were observed after 6 h. These include
hypercondensed chromosomes, nuclei cut by a septum, missegregated nuclei, and
cells with disrupted nuclei (Figure
6C). These events started to accumulate 6 h after the shift at
36°C in presence of thiamine and affected the whole population (>90%)
after 12 h.
Thus, pnmt*E147-cdc31 mutants exhibit strong defects in chromosome
segregation. We then looked at SPBs and spindle formation in
pnmt*-E147cdc31 mutant. For that purpose, cells were fixed after 8 h
at 36°C in presence of thiamine and double-stained for MTs and nuclei or
-tubulin and nuclei (Figure
7). We could observe that 30% of cells presented monopolar
spindles and hypercondensed chromosomes, indicating that they were blocked in
mitosis (Figure 7A). In these
cells, a single dot of gamma-tubulin was observed
(Figure 7B).
|
These data show that cdc31 mutant cells arrest in mitosis with a
monopolar spindle, consistent with
cdc31 spore germination
experiments, and further suggest that a single SPB structure is present at the
spindle pole.
Absence of SPB Duplication in pnmt*-E147Kcdc31 Mutants
To test whether this spindle assembly defect may be a consequence of a
failure in SPB duplication, ultrastructural analysis of the mutant cells was
performed after 8 h of growth at 36°C in presence of thiamine. Cells
presenting a monopolar spindle were analyzed by serial sectioning (n = 9). All
exhibited a single SPB structure (Figure 8,
A1A6). Some cells exhibited MTs that emanated from the SPB,
reached the opposite surface of the nucleus, and induced deformations in the
nuclear envelope. In addition, some cells exhibited an incomplete septum (n =
4, Figure 8A), which could cut
the nucleus (n = 2). One cell exhibited three incomplete septa. This suggested
that some cells had proceeded to septum formation while blocked in
mitosis.
|
In conclusion, this analysis clearly indicates that cdc31p is required in an early stage of SPB duplication and further suggests that the control of septation initiation is perturbed in the mutant.
Genetic Interactions between sad1 and cdc31
We also looked at the distribution of sad1p, another SPB component required
for bipolar spindle formation (Hagan and
Yanagida, 1995
) using anti-sad1p antibody.
pnmt*-E147Kcdc31 or wild-type cells were grown at 30°C for 18 h
in presence of thiamine and triple-stained for sad1p, MTs, and DNA.
Surprisingly, sad1p was found in multiple spots in pnmt*-E147Kcdc31
cells, instead of being concentrated in a single spot at the SPB like in
wild-type cells (Figure 9A).
These data suggest that cdc31p is required for the localization or
concentration of sad1 protein at the SPB.
Next, we compared the growth rates of single or double sad1-1 and pnmt*-E147Kcdc31 mutants in permissive conditions (30°C without thiamine). We found that the double mutant grew more slowly and exhibited more cell death compared with the single mutants, indicating a synthetic effect between the mutations (Figure 9B).
Finally, we compared the effect of overexpressing a nonfunctional dominant negative HA3cdc31 fusion protein in wild-type cells and in sad1-1 mutant grown at permissive temperature. We found that HA3cdc31p expression at low levels in presence of thiamine (nmt full-strength promoter) severely affected colony number and size in sad1-1 mutant, whereas it had no effect on wild-type cells. Moreover, high expression in absence of thiamine was lethal in sad1-1 strain and only mildly perturbed growth in a wild-type background, indicating that HA3cdc31p is hyper-toxic in sad1-1 strain (Figure 9C). Immunofluorescence analysis of sad1-1 cells expressing HA3cdc31p revealed the presence of cells blocked in mitosis with monopolar spindles (Figure 9D).
To check whether this effect was specific to sad1-1 strain or
could be observed in any SPB mutant, HA3cdc31p was also expressed
in alp4-1891, alp6-719 (Vardy and
Toda, 2000
), alp16
(Fujita et al.,
2002
), cam1-E14
(Moser et al., 1997
),
and cut121 (Bridge et
al., 1998
) strains. None of the strains grown at permissive
temperature was affected by low levels of expression. At high levels of
expression, HA3-cdc31 was slightly more toxic than in wild-type
cells but not lethal like in sad1-1 strain
(Table 2). In addition, double
alp4-1491 pnmt*-E147Kcdc31 (Figure
9C) and double alp6-719 pnmt*-E147Kcdc31 mutants (our
unpublished results) grew as well as single mutants.
|
These results indicate that cdc31p may interact directly or indirectly with sad1p and regulate its localization and function.
Mis-timing of Septum Formation before Mitosis Exit in
pnmt*-E147Kcdc31 Mutants
Because ultrastructural analysis suggested that septum formation may occur
untimely in pnmt*-E147Kcdc31 mutant (see above), we monitored septum
formation.
First, cells were grown in exponential phase in absence of thiamine and
shifted to 36°C in presence of thiamine for 212 h and stained for
septa. Abnormal septa including multiple or misshaped septa started
accumulating 8 h after shift and reached
40% of the population after 12 h
(Figure 10, A and B), indicating that abnormal septation events occur after the formation of
monopolar spindles.
Second, to test if septation did occur in cells blocked in mitosis and evaluate the timing of septation events, cells were synchronized in S phase by incubation for3hinHUat36°Cin presence of thiamine. After HU washout, cells were further incubated at 36°C in presence of thiamine, fixed every 20 min, and stained for MTs, DNA, and mid1p, a protein that colocalizes with the contractile ring in mitosis until it starts contracting in late anaphase. Synchronized cells performed a normal first round of mitosis and septation (Figure 10C, t = 80 and 100 min, and D and E). Cells assembled monopolar spindles in the second round of mitosis and proceeded to septation 2040 min later (Figure 10C, t = 180 and 220 min, and D and E) despite a sustained mitotic block as judged by the presence of long septated cells with monopolar spindles and of short cells with monopolar spindles after sister cell separation. In these cells, hypercondensed chromosomes were missegregated or "cut" by the septum. In addition, these cells maintained a strong mid1p staining in the septum region or at the new end, a situation never observed in the first round of normal mitosis and septation (see t = 100 in Figure 10C), nor in wild-type cells (Sorhmann et al., 1996; Paoletti et al., 2000). Additional rings or strands of mid1p were also sometimes observed next to the septum (see left cell t = 220), suggesting that multiseptation events that accumulate after the second round of mitosis (see Figure 10C) may arise from continuous induction of septation in cells blocked in mitosis that form supernumerary cytokinetic rings.
Our results indicate that cdc31p is required for the proper coordination between mitotic exit and septation.
| DISCUSSION |
|---|
|
|
|---|
cdc31p resides in a cytoplasmic electron dense appendage on the side of the
SPB called the half-bridge by functional analogy with S. cerevisiae
half-bridge or bridge, which connects the two duplicated SPBs
(Byers and Goetsch, 1974
;
Ding et al., 1997
).
The comparison of fission yeast cdc31p and ScCdc31p localizations highlights
the structural differences between the half-bridges in the two yeasts: whereas
the ScCdc31p resides on a thin layer tightly associated with the nuclear
envelope, fission yeast cdc31p is distributed throughout a thick electrondense
appendage, which transiently dissociate from the nuclear envelope in early
mitosis when duplicated SPBs are inserted into the nuclear envelope
(Ding et al.,
1997
).
It has been shown that ScCdc31p association with the half-bridge depends on
another half-bridge component, Kar1p, which is directly anchored to the
nuclear envelope via its C-terminal domain
(Biggins and Rose, 1994
;
Spang et al., 1995
).
Because cdc31p distribution is not restricted to the nuclear side of the
half-bridge, it seems unlikely that cdc31p anchoring to the half-bridge is
mediated by a membrane-associated protein like Kar1p in S. pombe.
Accordingly, no gene homologous to KAR1 has been described in S.
pombe genome. It will be of great interest in the future to determine how
cdc31p association with the half-bridge is mediated in S. pombe.
A number of other mutants in which bipolar spindle formation is compromised
because of perturbations of SPB function have been described previously in
fission yeast. These include mutants in components of the fission yeast
gamma-tubulin complex alp4p and alp6p
(Vardy et al., 2002
),
calmodulin (Moser et al.,
1997
), cut11p (West et
al., 1998
), cut12p (Bridge
et al., 1998
), and sad1p
(Hagan and Yanagida, 1995
).
pnmt*-E147Kcdc31 is the first mutant in which spindle defects result
from a complete lack of SPB duplication. Because we observed that in
cdc31 mutant, the single SPB was properly inserted into the nuclear
envelope, we can also infer from our data that SPB duplication is not a
prerequisite for SPB insertion into the nuclear envelope in fission yeast.
Conservation of a Network of Genes Controlling Centrosome
Duplication
Our data on cdc31p indicate that the key factors controlling the initiation
of SPB duplication have been conserved between the two distantly related
yeasts and further illustrate the important function of the centrin 3/Cdc31p
family in the control of centrosome reproduction. However, our attempts to
complement cdc31 deletion by the expression of HsCen3p or ScCdc31p
failed. Moreover, HsCen3p expression was toxic, as reported previously for
HsCen3 expression in budding yeast
(Middendorp et al.,
2000
). This suggests that partners of the three proteins may have
diverged more than centrins during evolution.
How members of the centrin 3/Cdc31p family may trigger centrosome
duplication remains poorly understood. In S. cerevisiae, a network of
SPB duplication genes including CDC31, KAR1, and two ubiquitin like
genes, DSK2 and RAD23 acting upstream of CDC31
(Biggins et al., 1996
)
has been described. Recent data also indicate that this network may be
regulated by the PKC1 pathway
(Khalfan et al.,
2000
). As mentioned above, no gene homologous to KAR1 has
been identified in S. pombe genome, but S. pombe genes
homologous to DSK2 and RAD23 have been characterized
(dph1 and rhp23, respectively;
He et al., 1998
;
Elder et al., 2002
).
These genes are not essential and direct evidence for their implication in SPB
duplication is lacking. However, the fact that overexpression of dph1
induces monopolar spindle formation like DSK2
(He et al., 1998
)
suggests that dph1 and DSK2 may share a conserved function
in SPB duplication.
Our studies suggest that sad1p is a potential downstream target of cdc31p.
sad1p is similar to C. elegans Unc-84
(Malone et al.,
1999
). A sad1-1 mutant exhibits a monopolar spindle
phenotype like cdc31 mutant
(Hagan and Yanagida, 1995
).
Ultrastructural localization of sad1p is not known, although sad1p is likely
anchored to the nuclear envelope because it contains a putative transmembrane
domain and overexpression leads to an accumulation on the nuclear envelope
(Hagan and Yanagida, 1995
). We
observed that sad1p localization at the SPB is compromised in
pnmt*-E47Kcdc31 mutant, whereas cdc31p is still concentrated at the
SPB in the sad1-1 mutant (unpublished data). This suggests that
cdc31p may control the accumulation of sad1p at the SPB. We also found that
the two genes display extensive genetic interactions. In budding yeast, there
is no sad1 homologue, and no gene acting directly down-stream of
CDC31 has been identified, although CDC31 interacts
genetically with SPB satellite components such as Spc29p
(Adams and Kilmartin, 1999
;
Elliott et al.,
1999
).
An Additional Function for cdc31 in Regulating the Septation
Initiation Network?
In budding yeast, it has been shown that ScCDC31p has additional functions
independent of SPB duplication (Sullivan
et al., 1998
;
Ivanovska and Rose, 2001
). In
particular, ScCDC31p is required for KIC1 kinase activity, which plays a role
in the maintenance of cellular integrity. In pnmt*-E147Kcdc31 mutant,
corresponding to cdc312 allele in S. cerevisiae, we
did not observe any cell lysis phenotype nor in two other mutants
corresponding, respectively, to cdc31-1 and cdc315
(pnmt*-A42Tcdc31 and pnmt*-P108Scdc31; unpublished
data).
In pnmt*-E147Kcdc31 mutant, we observed cells displaying multiple or aberrant septation events as well as cells containing both mitotic spindles and septa. In synchronous cultures, cells blocked in mitosis with a monopolar spindle proceeded to septation in less than an hour. Cells even maintained a mitotic state after full separation of sister cells.
This suggests that spindle checkpoints controlling mitotic exit are
functioning normally in pnmt*-E147Kcdc31 strain, but that septation
is allowed to occur before mitosis completion. Accordingly, the strain is not
hypersensitive to thiabendazole (our unpublished results) as reported for
strains defective in spindle checkpoints (He et al.,
1997
,
1998
). This situation also
differs from what has been described in APC mutants cut9665
and lid16 in which delayed septation events are preceded by
cdc2p inactivation (Chang et al.,
2001
).
Induction of septation depends on a signaling cascade called the SIN
(septation initiation network; see Le Goff
et al., 1999
;
Balasubramanian et al.,
2000
; Sawin, 2000
;
and McCollum and Gould, 2001
for reviews). Activation of the cascade occurs in mitosis when the small
GTP-binding protein spg1p switches from the GDP to the GTP-bound form
(Schmidt et al.,
1997
). However, activation of the last steps in the SIN requires
the inactivation of cdc2p at the exit of mitosis, ensuring that septation does
not take place before chromosome segregation is achieved
(Guertin et al.,
2000
; Chang et al.,
2001
). This requirement seems to be abolished in the
pnmt*-E147Kcdc31 mutant.
Because several components of the SIN network including the small
GTP-binding protein spg1 (Schmidt et
al., 1997
), the GAPs controlling its activity
(Cerutti and Simanis, 1999
;
Li et al., 2000
) and
downstream kinases of the SIN (Sohrmann et al., 1998; Sparks et
al., 1999; Guertin et al.,
2000
) are permanently or transiently located at the SPB, one
intriguing possibility is that the localization of SIN components is defective
in cdc31 mutant and allows the last steps of SIN to occur before cdc2
inactivation.
Untimely activation of septation before mitosis exit as well as a
multiseptation phenotype have recently been reported for alp4-1891
mutant (Vardy et al.,
2002
), and a novel role for the
-tubulin complex in
inhibiting the SIN activation during mitosis has been proposed. However,
because
-tubulin is still associated with the spindle pole in
pnmt*-E147Kcdc31 mutant, it seems unlikely that the septation defects
are caused solely through the
-tubulin complex.
It will be important to determine whether the septation defects result from an independent function of cdc31 in regulating the initiation of septation or are a consequence of the absence of SPB duplication. Characterization of the behavior of various components of the SIN in pnmt*-E147Kcdc31 strain and of additional alleles of cdc31 will help to distinguish these possibilities.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Abbreviations used: HU, hydroxyurea; MTs, microtubules; MTOC, microtubule organizing center; SPB, spindle pole body.
Present address: Institut de Biochimie et Génétique
cellulaires, UMR 5095 CNRS 1, rue Camille Saint-Saëns 33077 Bordeaux
cedex. ![]()
Corresponding author. E-mail address:
paoletti{at}curie.fr.
| REFERENCES |
|---|
|
|
|---|
Adams, I.R., and Kilmartin, J.V. (2000). Spindle pole body duplication: a model for centrosome duplication? Trends Cell Biol. 10, 329335.[CrossRef][Medline]
Bahler, J., Wu, J.Q., Longtine, M.S., Shah, N.G., McKenzie, A. r., Steever, A.B., Wach, A., Philippsen, P., and Pringle, J.R. (1998b). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943951.[CrossRef][Medline]
Balasubramanian, M.K., McCollum, D., and Surana, U. (2000). Tying the knot: linking cytokinesis to the nuclear cycle. J. Cell Sci. 113, 15031513.[Abstract]
Baum, P., Furlong, C., and Byers, B. (1986). Yeast
gene required for spindle pole body duplication: homology of its product with
Ca2+- binding proteins. Proc. Natl. Acad. Sci. USA
83,
55125516.
Biggins, S., and Rose, M.D. (1994). Direct interaction
between yeast spindle pole body components: Kar1p is required for Cdc31p
localization to the spindle pole body. J. Cell Biol.
125,
843852.
Biggins, S., Ivanovska, I., and Rose, M.D. (1996).
Yeast ubiquitin-like genes are involved in duplication of the microtubule
organizing center. J. Cell Biol.
133,
13311346.
Bridge, A.J., Morphew, M., Bartlett, R., and Hagan, I.M.
(1998). The fission yeast SPB component Cut12 links bipolar
spindle formation to mitotic control. Genes Dev.
12,
927942.
Byers, B., and Goetsch, L. (1974). Duplication of spindle plaques and integration of the yeast cell cycle. Cold Spring Harbor Symp. Quant. Biol. 38, 123131.
Byers, B. (1981). Cytology of the yeast life cycle. In: The Molecular Biology of the Yeast Saccharomyces: Life cycle and Inheritance, eds. J.N. Strathern, E.W. Jones, and J.R. Broach, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 5996.
Cerutti, L., and Simanis, V. (1999). Asymmetry of the spindle pole bodies and spg1p GAP segregation during mitosis in fission yeast. J. Cell Sci. 112, 23132321.[Abstract]
Chang, L., Morrell, J.L., Feoktistova, A., and Gould, K.L.
(2001). Study of cyclin proteolysis in anaphase-promoting complex
(APC) mutant cells reveals the requirement for APC function in the final steps
of the fission yeast septation initiation network. Mol. Cell.
Biol. 21,
66816694.
Ding, R., West, R.R., Morphew, D.M., Oakley, B.R., and McIntosh, J.R. (1997). The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Mol. Biol. Cell 8, 14611479.[Abstract]
Elder, R.T., Song, X.Q., Chen, M., Hopkins, K.M., Lieberman, H.B.,
and Zhao, Y. (2002). Involvement of rhp23, a Schizosaccharomyces
pombe homolog of the human HHR23A and Saccharomyces cerevisiae RAD23
nucleotide excision repair genes, in cell cycle control and protein
ubiquitination. Nucleic Acids Res.
30,
581591.
Elliott, S., Knop, M., Schlenstedt, G., and Schiebel, E.
(1999). Spc29p is a component of the Spc110p subcomplex and is
essential for spindle pole body duplication. Proc Natl Acad Sci
USA, 96,
62056210.
Forsburg, S.L. (1993). Comparison of
Schizosaccharomyces pombe expression systems. Nucleic Acids
Res. 21,
29552956.
Forsburg, S.L., and Sherman, D.A. (1997). General purpose tagging vectors for fission yeast. Gene 191, 191195.[CrossRef][Medline]
Fujita, A., Vardy, L., Garcia, M.A., and Toda, T.
(2002). A fourth component of the fission yeast gamma-tubulin
complex, Alp16, is required for cytoplasmic microtubule integrity and becomes
indispensable when gamma-tubulin function is compromised. Mol. Biol.
Cell 13,
23602373.
Giddings, T.H., Jr., O'Toole, E.T., Morphew, M., Mastronarde, D.N., McIntosh, J.R., and Winey, M. (2001). Using rapid freeze and freeze-substitution for the preparation of yeast cells for electron microscopy and three-dimensional analysis. Methods Cell Biol. 67, 2742.[Medline]
Guertin, D.A., Chang, L., Irshad, F., Gould, K.L., and McCollum, D. (2000). The role of the sid1p kinase and cdc14p in regulating the onset of cytokinesis in fission yeast. EMBO J. 19, 18031815.[CrossRef][Medline]
Hagan, I., and Yanagida, M. (1995). The product of the
spindle formation gene sad1+ associates with the fission yeast spindle pole
body and is essential for viability. J. Cell Biol.
129,
10331047.
He, X., Patterson, T.E., and Sazer, S. (1997). The
Schizosaccharomyces pombe spindle checkpoint protein mad2p blocks anaphase and
genetically interacts with the anaphase-promoting complex. Proc. Natl.
Acad. Sci. USA 94,
79657970.
He, X., Jones, M.H., Winey, M., and Sazer, S. (1998). Mph1, a member of the Mps1-like family of dual specificity protein kinases, is required for the spindle checkpoint in S. pombe. J. Cell Sci. 111, 16351647.[Abstract]
Ivanovska, I., and Rose, M.D. (2001). Fine structure
analysis of the yeast centrin, Cdc31p, identifies residues specific for cell
morphology and spindle pole body duplication. Genetics
157,
503518.
Keeney, J.B., and Boeke, J.D. (1994). Efficient targeted integration at leu1-32 an