![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, Issue 7, 2972-2983, July 2003
* Department of Molecular Biosciences, The University of Kansas, Lawrence,
Kansas 66045;
University of Tokushima, Tokushima 770-8503 Japan;
Howard Hughes Medical Institutes and Department of Cell Biology, University of
Massachusetts Medical School, Worcester, Massachusetts 01605; and
|| Department of Embryology, Carnegie Institution of Washington, Baltimore,
Maryland 21210
Submitted January 7, 2003;
Revised March 13, 2003;
Accepted March 14, 2003
Monitoring Editor: Marvin Wickens
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
; Tuschl et al.,
1999; Klink and Wolniak,
2000) and thus can effectively silence full gene expression at the
posttranscriptional level. This genetic interference effect (termed RNA
interference, RNAi) is temporary and the effect is dosage dependent. RNAi has
been observed in many cell types from divergent eukaryotes, including
protozoa, fungi, plants, invertebrates, and mammals
(Hannon, 2002). Additionally,
RNAi is part of a larger network of "RNA silencing" mechanisms
(Baulcombe, 2002;
Wassenegger, 2002).
RNAi phenotypes have generally been elicited in Caenorhabditis
elegans and other nonvertebrate species by using dsRNA molecules that are
rather long (>100 base pairs). Once inside cells, long dsRNA molecules are
cleaved into double-stranded small interfering RNAs (siRNAs) that are
21–25 base pairs in length by an enzyme with RNaseIII-like activity
(Dicer) (Hamilton and Baulcombe,
1999; Parrish et al.,
2000; Yang et al.,
2000; Bernstein et
al., 2001; Grishok et
al., 2001; Ketting et
al., 2001; Knight and
Bass, 2001). Cleavage into siRNAs is an early step in the RNAi
silencing mechanism (Elbashir et
al., 2001b; Parrish and
Fire, 2001; Klahre et
al., 2002), and the rde-4 gene product in C.
elegans likely influences Dicer-dependent cleavage of dsRNAs as evidenced
by observations 1) that rde-4 mutant animals injected with long
dsRNAs do not accumulate siRNAs and do not exhibit an RNA silencing response;
2) that RDE-4 is found in tight physical association with DICER; and 3) that
the RNA silencing defects in rde-4 mutant animals can be overcome by
injection of precleaved siRNAs into mutant animals
(Tabara et al., 1999;
Parrish and Fire, 2001;
Tabara et al., 2002).
Although RNAi can be triggered by long dsRNAs or by siRNAs in C.
elegans, the key to effective RNAi responses in mammalian systems has
been the use of siRNAs (Elbashir et
al., 2001a; Caplen et
al., 2001). siRNAs are long enough to mediate
sequence-specific mRNA cleavage, yet are short enough to avoid activation of
nonsequence specific dsRNA responses (such as interferon responses) that exist
in mammalian systems.
dsRNAs that are delivered into extracellular spaces can elicit systemic RNA
silencing in diverse organisms, including C. elegans, planaria,
Coleoptera, cnidaria, and plants (Palauqui
et al., 1997; Fire
et al., 1998; Lohmann
et al., 1999; Sanchez
Alvarado and Newmark, 1999;
Bucher et al., 2002),
as evidenced by observations of RNA silencing in cells that are far removed
from the initial site of dsRNA delivery. In C. elegans, four methods
are available for delivery of dsRNA into the organism: 1) injection of dsRNA
into any site of the animal (Fire et
al., 1998; Grishok et
al., 2000), 2) feeding animals with bacteria engineered to
express dsRNA (Timmons et al.,
2001), 3) soaking animals in dsRNA
(Tabara et al.,
1998), and 4) in vivo transcription of dsRNA from transgene
promoters (Tabara et al.,
1999; Tavernarakis et
al., 2000). Injection, feeding, and soaking can result in
RNAi in all cells of the treated animal and its progeny, an indication that
the RNAi signal is mobile and can be taken up by different tissues. The mobile
behavior of the RNA silencing signal could reflect a combination of different
transport mechanisms, including cellular uptake of dsRNA from the coelomic
fluid, exit of dsRNA from cells, direct intercellular trafficking of dsRNA
between coupled cells, and/or partitioning of the dsRNA pool upon cell
division. Because RNAi and related mechanisms are thought to be an organismal
response to challenge from viral and transposon parasites (reviewed in
Plasterk, 2002), we reasoned
that the systemic character of the response might depend rather specifically
on physiological conditions.
It is conceivable that systemic RNAi in C. elegans might involve a
rather simple and broadly active mechanism of dsRNA uptake by individual
cells. C. elegans does not have an active circulatory system;
instead, dsRNA may gain direct access to cells via the coelomic fluid.
(Similarly, in other organisms, dsRNA may gain access to cells via the
circulatory system, culture fluid, etc.) In injection, needle-mediated tissue
disruption undoubtedly facilitates access to the coelomic fluid. In delivery
by feeding and soaking, dsRNA may be distributed to cells from the gut in the
same manner as nutrients. It is also conceivable that dsRNA residing in
"infected" cells could undergo successive rounds of cellular exit
and re-entry into adjacent "uninfected" cells, culminating in a
systemically affected animal. The latter assumes that dsRNA can exit as well
as enter cells, and raises questions about the cellular autonomy of dsRNA
effects. Although there is considerable evidence for an ability of animal
cells to import dsRNA, there is little data that supports the notion of robust
cellular exit of dsRNA in animal systems. This question is particularly
intriguing given that transport of an RNA silencing signal between host and
graft has been demonstrated in plants
(Palauqui et al.,
1997), whereas there remains a lack of conclusive evidence for
movement of RNA molecules between cells in multicellular animals. Addressing
the ability of dsRNA to exit cells is important not only in elucidating the
full mechanism of RNAi but also in understanding how dsRNA can elicit
biologically significant systemic responses (e.g., a systemic antiviral
response in an organism after localized infection).
In an effort to more fully understand the nature of systemic RNA silencing
in a complex, multi-tissue animal, we are assessing the ability of in
vivo-delivered dsRNA molecules to elicit systemic RNA silencing. We have
introduced transgenes into C. elegans that express dsRNA under the
direction of tissue-specific promoters in one type of cell. We note that
although transgene-mediated delivery of dsRNA is effective in eliciting
tissue-specific RNA silencing, robust systemic RNA silencing was not observed.
Unexpectedly, we have found that exogenous delivery of unrelated dsRNA
molecules to these same transgenic strains can elicit a detectable systemic
RNA silencing phenotype. We have also observed that animals defective for
fed-1 or fed-2 are unable to mount a robust systemic
silencing response to ingested dsRNAs, yet these mutants can display systemic
silencing in response to tissue-specific transcription of dsRNAs from
transgenes. While both sid-1 mutants
(Winston et al.,
2002) and fed mutants fail to respond to ingested dsRNA,
sid-1 mutants, but not fed mutants, fail to exhibit systemic
silencing in response to silencing signals transcribed within cells. These
observations demonstrate a capability for dsRNA export by cells, highlight the
complexity of the systemic silencing mechanisms in multicellular animals and
raise the possibilities of multiple and/or tissue-specific mechanisms for
cellular uptake and export of RNA silencing signals.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
),
vit-2 in the gut during vitellogenesis
(MacMorris et al.,
1994), and unc-119 in neurons
(Maduro and Pilgrim, 1995).
These promoters are well characterized, generate abundant transcript, are
particularly tissue specific, and activate transcription relatively late in
development. DNA upstream of myo-3 (2300 bp) was obtained from
plasmid L2534 by using standard cloning techniques; 250 bp of vit-2
promoter was amplified from genomic DNA by using oligonucleotides LT095
(tgctctagagatccaactgtattacttgaa) and LT096 (cggggtaccggctgaaccgtgattggactg);
and 1200 bp of DNA upstream of unc-119 was obtained from plasmid
pBY103 (generously provided by M. Maduro and D. Pilgrim, University of
Alberta, Calgary, AB, Canada). The promoters were fused to two copies of
green fluorescent protein DNA in inverted repeat orientation
separated by 900 base pairs of nonrelated spacer sequence
(Timmons et al.,
2001). RNA transcribed from this sequence has the capacity to fold
back into a hairpin double-stranded RNA. This same inverted repeat sequence
has been used in the feeding protocol and was functional in eliciting RNAi
(our unpublished data). The myo-3 promoter was fused to the gfp
hairpin DNA sequence to generate pLT98, the vit-2 promoter
sequence was used similarly to generate pLT156, and the unc-119
promoter for pLT164. We similarly configured two additional versions of
gfp hairpin DNA under the transcriptional regulation of these worm
promoters in hopes of better cytoplasmic accumulation of dsRNA: 1) the
original version does not have introns in either gfp repeat and has a
900-base pair spacer between inverted repeats; as described 2) a second
version replaces the spacer sequence with intronic sequences that should
splice out when expressed in the worm, leaving behind a perfect hairpin RNA
with no spacer (Smith et al.,
2000); and 3) a third configuration contains four introns in the
first gfp repeat sequence and also an intronic spacer sequence. The
results obtained using intron-containing gfp hairpin RNAs were
similar to the results obtained in Figure
1 by using configurations without introns (our unpublished
data).
|
For dsRNA Production. The nonsequence related dsRNA was
derived from a plasmid (pLT190) containing 1 kb of sequence corresponding to
the bacterial tetracycline resistance gene
(Peden, 1983). This sequence
has no homology to gfp nor to C. elegans genes. dsRNA was
transcribed from pLT190 by using an in vitro transcription kit (Ambion,
Austin, TX). A 400-base pair fragment of the rde-1 gene was subcloned
into a plasmid with opposable T7 promoter sites (L4440) and was used as a
template for in vitro transcription (Ambion). Doubly transgenic animals were
soaked in this solution, and progeny animals were monitored for loss of
fluorescence. Plasmid pPD128.110 (Timmons
and Fire, 1998) was used to transcribe dsgfp RNA used in
soaking experiments.
Soaking Conditions
For Induced Export. Animals were soaked in several
different control solutions, including water, M9 media, injection buffer
(Stinchcomb et al.,
1985), M9 media/50 mM NaCl, 0.5 mg/ml dsDNA oligonucleotides in
water, and 0.5 mg/ml plasmid DNA in water
(Tabara et al.,
1998). Animals were also soaked in dstetA RNA in
injection buffer or water (Mello et
al., 1991) 4 h overnight at 15°C in Eppendorf tubes.
Concentrations of dstetA RNA were 0.5–2 µg/µl. Animals
were allowed a 4-h recovery period before examination. Recovered animals were
incubated at 15°C, 20°C, and 25°C to test for temperature effects
of induced systemic silencing. Temperature did not influence the degree to
which systemic silencing could be induced by exogenous dsRNA delivery, nor did
daily heat pulses of 37°C for 30 min (our unpublished data).
rde-1(ne300) and sid-1(qt2) mutant animals containing the
trigger and target transgenes were soaked in 2 mg/ml concentrations of
dstetA RNA as described, allowed to recover, and 50 treated animals
harboring both transgenes were scored for systemic silencing on the day of
recovery and on two subsequent days. Systemic silencing effects were not noted
in any of the soaked animals harboring these mutations. We also monitored
treated animals for phenotypes associated with RNAi silencing defects such as
germline desilencing of transgenes (green fluorescent protein [GFP] expression
in the germline) and increased frequency of nondisjunction (presence of males)
(Kelly et al., 1997).
None of these phenotypes was observed. Control soaking conditions (without
dsRNA) did not elicit systemic silencing.
For RNAi. Animals were soaked in injection buffer or water by using dsRNA concentrations of 1–2 mg/ml at 15°C overnight. GFP expression levels were monitored in recovered animals and their progeny.
C. elegans Strains
Two C. elegans strains harboring chromosomally integrated
transgenes (PD7325 and PD8160) were used. Both these strains stably and
reproducibly express GFP in the nuclei of all somatic cells. (The GFP harbors
a nuclear localization signal.) The transgene in PD7325
(dpy-20(e1282); ccIn7325[BK48+pMH86]) expresses gfp
from a let-858 promoter (Kelly
et al., 1997). Strain PD8160 (provided by J. Fleenor,
Carnegie Institution) harbors a ccIn8160 transgene that drives GFP
from a ribosomal protein L28 promoter
(Consortium, 1998). Strain
PD4251 contains an integrated array of myo-3::GFP and stably
expresses GFP in muscle nuclei. The ccIn8160 insertion, gfp hairpin
transgene array, and sid-1(qt2) mutant were brought together into the
same strain (YY304) by standard genetic manipulation. The ccIn8160 insertion,
gfp hairpin transgene array, and each fed mutant were
brought together to produce strains YY216 and YY209. Other strains used in
these experiments include: sid-1(qt2); fed-1(ne309)III, and
fed-2(ne319)IV. None of the fed loci correspond to
sid-1 or to the sid-1-related locus that encodes the ZK721.1
protein. In some cases we have used the following protocol to minimize
contaminations of our stocks: ampicillin (100 µg/ml), tetracycline (10
µg/ml), and kanamycin (10 µg/ml) was added to freshly thawed stocks that
were recovered onto normal growth media seeded with wild-type OP50 bacteria.
After recovery from freezing, animals were moved to fresh plates, and the
population was allowed to increase over the course of a few days. The animals
were then collected and lysed in a solution of 10% bleach/1 N NaOH. The
embryos that survived this treatment were washed with water and plated. The
resulting L1-L3 larvae were then soaked in solutions of antibiotics in M9
media overnight and replated.
Generation of Additional C. elegans Stocks
The gfp hairpin plasmids described above were injected into
wild-type N2 worms along with the dominant rol-6 transformation
marker (Mello et al.,
1991), and heritable transgenic lines were established. The
gfp hairpin transgenes were maintained as extrachromosomal arrays.
These are lost at some frequency during meiotic and mitotic cell divisions
(Stinchcomb et al.,
1985). Doubly transgenic animals were generated by crossing worms
harboring a gfp hairpin array with worms harboring a GFP-expressing
array using standard genetic manipulations. Six different myo-3::gfp
hairpin lines were generated. All were analyzed in an rpL28::GFP
background, and three of these were analyzed in a let-858::GFP
background. Four vit-2::gfp hairpin lines were generated. All were
analyzed in a let-858::GFP background; three were crossed into
rpL28::GFP. One unc-119::gfp hairpin line was established
for each GFP reporter. The GFP fluorescence in ventral nerve cord and nerve
ring (the major neuropils) was not significantly reduced in these lines.
Additionally, GFP fluorescence in neurons was not reduced in
unc-119::gfp reporter lines harboring the unc-119::gfp
hairpin. These observations are in agreement with previous reports of a
more limited capacity for RNA silencing of some genes in C. elegans
neurons (Timmons et al.,
2001; Simmer et al.,
2002).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
An RNAi phenotype (loss of GFP fluorescence) was observed in tissues where
transcription of the gfp hairpin was expected, demonstrating the
effectiveness of the constructs in delivering dsRNA to cells
(Figure 1). For example, the
GFP fluorescence level in muscle cells of animals harboring a
myo-3::GFP reporter was reduced, as expected, when a myo-3::gfp
hairpin transgene was crossed into the strain
(Figure 1a, compare left and
right panels). The loss of fluorescence observed in muscle cells was dependent
on an intact RNAi mechanism: when doubly transgenic animals (accumulating GFP
in muscle nuclei and gfp hairpin in muscle) were injected with dsRNA
corresponding to the rde-1 gene or were crossed into an
rde-1 mutant background, no loss of fluorescence was observed in
muscle (our unpublished data). Similarly, the gfp hairpin was
effective in gut cells: the fluorescence intensity was reduced in gut nuclei
of doubly transgenic animals (accumulating GFP in nuclei of all cells and
gfp hairpin in gut; Figure
1d), although with fewer animals exhibiting effects in comparison
with animals silenced from a myo-3::gfp hairpin transgene. The
gfp hairpin driven from an unc-119 promoter was not
effective in eliciting RNAi in neurons; this tissue has previously been noted
to be refractory to dsRNA for some genes in wild-type C. elegans
(Timmons et al.,
2001; Simmer et al.,
2002).
We then explored the possibility that RNA silencing signals might move bidirectionally across cell membranes (Figure 2). Clearly, dsRNA can be taken up by C. elegans cells when delivered by injection, feeding, or soaking; however, the ability of animal cells to export RNA silencing signals has not been fully investigated. We tested for this capacity by observing whether gfp hairpins expressed in specific tissues could elicit ectopic silencing phenotypes (in cells that do not transcribe the gfp hairpin). Doubly transgenic strains were generated that express GFP in all cells and gfp hairpin RNA in a tissue-restricted manner, and all cells were monitored for RNAi (loss of GFP fluorescence) (Figure 2). With respect to the two GFP-expressing transgenes used as RNAi targets in our experiments (rpL28::GFP and let-858::GFP; see MATERIALS AND METHODS) each was maintained as a chromosomal insertion and GFP fluorescence in all cells was consistent and uniform in the absence of the second gfp hairpin transgene.
The RNA silencing phenotypes observed in doubly transgenic animals remained restricted to mostly those cells previously demonstrated to respond to the tissue-specific promoter (Figure 2). Robust systemic RNA silencing was not observed for any of the combinations of GFP-expressing and gfp hairpin-expressing transgenes. (Figure 2; our unpublished data). Specifically, the animals we observed exhibited interference with GFP expression in those tissues that expressed the interference trigger (the gfp hairpin), but were not substantially silenced for GFP in other tissues.
Systemic RNA Silencing from a gfp hairpin Can Be Induced
We considered several explanations for lack of systemic RNA silencing in
our doubly transgenic animals: cells may lack any mechanism for dsRNA exit,
our experimental conditions may be unfavorable for observation of dsRNA
export, or a generalized alarm signal may be needed to trigger dsRNA export.
In the latter two cases, we might expect that our doubly transgenic animals
could be induced to elicit systemic RNA silencing. In particular, we reasoned
that exposure to high concentrations of dsRNA might affect the mobility of an
intracellular dsRNA by titrating out mechanisms that confine dsRNA within
cells, by titrating mechanisms that convert dsRNAs to unexportable forms, by
titrating mechanisms that eliminate the dsRNA character of the trigger, or by
specifically activating dsRNA export systems. The complexity of the injected
material can also affect the RNA silencing response in many systems, including
C. elegans. RNAi exhibits premature saturation when several dsRNA
sequences are introduced to the organism simultaneously, resulting in
attenuated RNAi phenotypes for each of the dsRNAs
(Gonczy et al., 2000;
Parrish et al.,
2000). The experiments below derive from a hypothesis that the
introduction of a second species of dsRNA to doubly transgenic animals might
stimulate saturation in the cell where the gfp hairpin was
transcribed, and that gfp hairpin molecules not engaged in RNA
silencing mechanisms might freely exit that cell. Thus, one possible outcome
from exposure of these animals to external dsRNA was that cells might be
induced to export an RNAi silencing signal.
In our initial tests of saturation-induced systemic RNA silencing, doubly transgenic animals (expressing a gfp hairpin in a tissue-specific manner and a GFP reporter in all cells) were injected with a solution of dstetA RNA. The bacterial tetA region used in our experiments does not have homology to worm sequences or to GFP. All combinations of doubly transgenic strains were tested by injection, and we observed reduced levels of GFP fluorescence in some of the injected animals and in their progeny (our unpublished data). We considered that the reduced fluorescence might be a result of tissue disruption from the injection needle. We next used the soaking method to deliver dstetA RNA to doubly transgenic animals (Figure 3). Again, we noted a reduced fluorescence in the treated animals and in their progeny.
|
|
). The dependence on a functional Sid-1 protein demonstrates
that this inducible system relies on endogenous mechanisms for dissemination
of RNA silencing signals.
We monitored RNA silencing phenotypes in the progeny of treated, doubly
transgenic animals. The doubly transgenic animals give rise to two classes of
progeny: doubly transgenic progeny (with GFP- and gfp
hairpin-expressing transgenes) and singly transgenic progeny (with a
GFP-expressing transgene only, but lacking the hairpin transgene).
Extrachromosomal arrays, such as the transgene expressing the gfp
hairpin, are generally lost at some frequency during meiosis (and
occasionally during mitosis) in worms
(Stinchcomb et al.,
1985; Mello et al.,
1991). Because we monitored RNA silencing in progeny of treated
animals, our results provide direct evidence of some deposition of mobile
silencing signals to the germline. This is demonstrated in the class of singly
transgenic progeny that carried only the GFP reporter transgene, but which
were the progeny of animals also expressing the gfp hairpin
(Figure 3 and
Table 1). Because this class of
progeny no longer has a transcriptional supply of gfp hairpin, the
RNA silencing phenotypes observed were likely derived from maternal deposition
of gfp hairpin. These progeny animals showed a decrease in the level
of GFP fluorescence, depending (as described above) on the presence in the
parent of the gfp hairpin transgene and exogenous dsRNA. (We verified
that these animals were lacking transgene sequences and were not mosaics by
recovering affected animals after photomicroscopy and by monitoring the
progeny for the absence of the transformation marker phenotype.) By using
polymerase chain reaction-based assays to assess gfp hairpin
transgene inheritance patterns, we had previously demonstrated that
myo-3::gfp hairpin lines do produce a few animals (<10% of
progeny) that do not express the transformation marker (roller) phenotype but
are in fact mosaics. These mosaic animals generally gave rise to some progeny
with the roller phenotype (our unpublished data). The silencing phenotypes in
singly transgenic progeny were not as expressive nor as penetrant as observed
in doubly transgenic progeny, and silencing was not observed in subsequent
generations.) These experiments suggest an induced release of a mobile
silencing trigger from cells in the parent, followed by entry of the silencing
trigger into the germline, and subsequent, albeit limited, RNA silencing in
progeny.
We noted promoter-dependent differences in the extent of systemic silencing
elicited by the gfp hairpin in response to exogenous dsRNA. Animals
expressing a gfp hairpin in muscle from the myo-3 promoter
exhibited the most extensive silencing in affected animals. Animals expressing
a gfp hairpin in gut from the vit-2 promoter and in neurons
from the unc-119 promoter exhibited a comparatively weaker systemic
silencing. Although the induced systemic silencing phenotype from the
vit-2::gfp hairpin is striking in some cells of injected animals, the
penetrance of induced systemic silencing within the progeny of treated animals
is lower in comparison to the myo-3::gfp hairpin system. Most likely
this difference is a reflection of the dynamic nature of the vit-2
promoter transgene (MacMorris et
al., 1994) and that the vit-2 promoter drives
expression of the gfp hairpin in fewer cells than the myo-3
promoter. The promoter-specific differences with respect to inducible RNA
silencing may also be attributed to differential transcriptional abilities of
the promoters, to differences in frequency of mosaicism of the gfp
hairpin transgene, or may reflect genuine cell type-specific differences
in dsRNA exit machinery.
Systemic Silencing from RNA Silencing "Triggers"
Synthesized within Cells Is Regulated by Multiple Cellular Factors
Our observations suggesting cellular entry and exit of dsRNA in C.
elegans led us to apply genetic analyses in an effort to identify
components of the import-export system. The different dsRNA delivery methods
allowed us to anticipate and define potentially distinct dsRNA uptake routes.
Defects for any of these uptake pathways would lead to predictable,
tissue-specific patterns of RNAi insensitivity. For example, animals exposed
to dsRNA by using ingestion-based delivery protocols might use an
environmental uptake pathway to take up dsRNA from the environment via the
gut. If so, the ingestion-based delivery methods would allow us to isolate
mutants that are defective in this form of uptake.
We obtained mutants defective in environmental uptake from the same genetic
screen that generated RNAi-defective (rde) animals
(Tabara et al.,
1999). dsRNA was delivered to animals by allowing them to feed on
bacteria overexpressing dsRNA, and mutants were isolated based on their
failure to exhibit RNAi. Unlike the rde mutant animals, the mutants
we selected still exhibit silencing phenotypes when dsRNA is injected into
them (Figure 4A, d). At least
two different mechanistic defects could lead to this method of
delivery-dependent RNAi phenotype: a defect in dsRNA uptake or a hypomorphic
defect in the RNAi mechanism. Mutations at the fed-1 locus give rise
to phenotypes that seem to fit the former description.
|
fed-1(ne309) mutants are defective in their response to dsRNA introduced from the environment, as evidenced by the failure of even high doses of dsRNA delivered by soaking to induce RNAi in any cell of the animal (Figure 4A, h). However, with respect to the relative ability to respond to injected dsRNA, the cells of fed-1 mutants, including gut cells, are comparable to the cells of wild-type animals. Most fed-1 cells, including gut, exhibit RNAi when dsRNA is delivered by injection (Figure 4A, d); in contrast, no cells of fed-1 mutants, including gut cells, exhibit RNAi when dsRNA is delivered by ingestion. The developing germline of fed-1 mutants also has the capacity for dsRNA uptake: the progeny of fed-1 mutants that were injected into the gut with dsRNA exhibit RNA silencing (Figure 4A, d).
The capacity to disseminate RNA silencing signals throughout the animal is not defective in fed-1 mutants: a myo-3::gfp hairpin dsRNA expressed within muscle cells is capable of eliciting systemic RNAi in this mutant (Figure 4B). Interestingly, systemic silencing seems more robust in this mutant compared with wild-type. The expressivity of the systemic RNA silencing phenotype is not equal for all affected mutants within the population. (This was also observed in the progeny of soaked wild-type animals.) Some doubly transgenic fed-1 mutants have little GFP fluorescence (as in Figure 4B), most have some GFP fluorescence (fluorescence in roughly 30–60% of nonneuronal cells), and a few animals express GFP in most cells (>60% of nonneuronal cells). Again, as was observed for systemically affected (soaked) wild-type animals, expressivity of systemic silencing is not a heritable attribute: When fed-1(ne309) doubly transgenic animals were reared individually, each animal gave rise to doubly transgenic progeny exhibiting the described distribution of GFP intensities, irrespective of whether the parent animal exhibited a strong degree of systemic silencing or a weak amount of systemic silencing: 5–25% of the singly transgenic progeny derived from cloned doubly transgenic animals exhibited a loss of GFP fluorescence in 20–40% of nonneuronal cells, suggesting that silencing signals in a fed-1 mutant can be distributed to progeny, most likely via germline import of GFP signals from somatic cells of the expressing parent. The silenced state of these singly transgenic animals was not transferred to subsequent generations: silenced singly transgenic fed-1 animals gave rise to fully unaffected progeny (our unpublished data). [Singly transgenic animals that exhibited silencing were carefully assayed for array mosaicism.] We have developed polymerase chain reaction-based assays to detect the presence of the gfp hairpin transgene and have observed that nonroller animals in this stock that harbor the transgene (mosaics) generally gave rise to some progeny that exhibit the roller phenotype (100/100; our unpublished data). Most (>90%) of the fed-1 singly transgenic animals that exhibited systemic silencing and that were the progeny of doubly transgenic animals did not give rise to roller progeny, confirming that the gfp hairpin array in silenced animals was lost during parental meiosis and not during embryonic mitosis.
We note similar phenotypic responses to dsRNA in a second and distinct mutant that we have termed fed-2. fed-2 mutants also fail to respond robustly to dsunc-22 RNA or dspos-1 RNA when delivered by feeding, but do respond to dsunc-22 RNA and dspos-1 RNA when delivered by injection, and do exhibit systemic RNA silencing phenotypes from a cell-intrinsic gfp hairpin (our unpublished data). Unlike wild-type animals (Figure 3), RNA silencing triggered by gfp hairpin expression in fed mutants is not influenced by ingestion of exogenous dsRNAs. The collective phenotypic observations imply that fed mutants are defective in mechanisms that allow dissemination of RNA silencing signals from dsRNAs imported by gut cells.
Although our data provides evidence of machinery for cellular export of RNA
silencing signals, the nature of the exported signal is not apparent. dsRNAs
undergo processing intracellularly into 
22 nucleotide dsRNA fragments
(siRNAs) that are sufficient to mediate silencing
(Hamilton and Baulcombe, 1999;
Parrish et al., 2000;
reviewed in Tuschl, 2001), and
siRNAs are capable of entering cells and eliciting RNAi phenotypes. In
vivo-transcribed dsRNAs also undergo processing into siRNAs. Thus, a systemic
gfp silencing signal might be exported in the form of long dsRNA,
siRNAs, or an as-yet-unidentified molecule. (In plants, two distinct
populations of siRNAs have been observed in tissues undergoing RNA silencing,
and one class correlates with systemic RNA silencing;
Hamilton et al.,
2002.) Long dsRNAs (100 base pairs) injected into worms can
enter cells and elicit RNAi in treated animals and progeny, but the ability of
long, intact molecules to act systemically has not been fully investigated.
Systemic phenotypes might arise as a consequence of organismal trafficking of
long dsRNAs through the circulatory system and uptake by each cell.
Alternatively, systemic phenotypes might result from a relay mechanism where
signaling molecules (such as siRNAs) are generated within cells and are
transferred to nearby cells.
We can address the ability of long dsRNA to act systemically by monitoring
for RNA silencing in the progeny of animals treated with long dsRNA. dsRNA
injected into the body cavity of wild-type animals can elicit RNAi in F1
progeny (Fire et al.,
1998), indicating that the oocyte/germline has the capacity to
take up dsRNA. Because wild-type animals process dsRNAs into siRNAs, both size
species may travel to and be taken up by the developing germline cells.
(Previously, siRNAs have been demonstrated to elicit RNA silencing in progeny
of injected worms; Parrish and Fire,
2001; Simmer et al.,
2002). In contrast, homozygous rde-4 mutant animals
injected with dsRNA do not accumulate siRNAs
(Parrish and Fire, 2001;
Tabara et al., 2002),
are defective for RNA silencing, and produce homozygous rde-4 progeny
that are also defective in RNA silencing. RNA silencing is not defective in
rde-4/+ heterozygous animals and this provides a means to examine the
ability of large dsRNAs to act systemically: Large dsRNA molecules were
introduced into rde-4 homozygotes by injection into the gut (or
germline); the treated animals were crossed to wild-type males; and the
resulting rde-4/+ heterozygous progeny were monitored for RNAi
phenotypes (Figure 5). RNA
silencing was observed in the heterozygous progeny of rde-4
homozygotes injected with dsRNA into the gut or germline. Given an inability
to process large dsRNAs into siRNAs in the rde-4/rde-4 animals, these
results suggest that unprocessed dsRNAs can elicit systemic RNA silencing.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). A different test of systemic silencing consists of
intracellular (transgene-driven) dsRNA expression within a subset of cells,
followed by assays for interference in the neighboring cells that lack
transgene. In plant systems, this type of protocol has been shown to produce a
remarkable degree of spreading of a silencing signal from transgene-expressing
host to a transgene-free graft (Boerjan
et al., 1994;
Palauqui et al.,
1997; Palauqui and Balzergue,
1999; Fagard et al.,
2000). In contrast, experiments in animal systems have revealed
some degree of cell autonomy: localized synthesis of an interfering RNA in a
subset of tissues of Drosophila
(Kennerdell and Carthew, 2000)
has been shown to produce interference in a similarly localized region of the
animal. Plants contain a number of systems for intercellular exchange of
macromolecular components (plasmodesmata, phloem, etc.). Extracellular mRNAs
of defined sequence have been proposed to traffic long distances through these
structures, exiting from one cell and functioning in a more distant cell
(Ruiz-Medrano et al.,
2001). In contrast, specific RNAs are not generally noted outside
cells in animal systems.
To distinguish between unidirectional uptake of dsRNA and bidirectional
movement of dsRNA across cell boundaries, we used C. elegans strains
harboring two different transgenes: one transgene produced GFP in all cells,
and a second transgene produced a double-stranded gfp hairpin RNA in
a subset of cells. The use of GFP as an RNAi target allowed us to monitor
effects on gene expression (loss of GFP fluorescence) at the response level of
individual cells. We failed to note systemic silencing from any of the three
tissue-specific promoters used to drive gfp hairpin expression, and
this contradicted our anticipated results. Because only a few molecules of
dsRNA per cell are required for an RNAi response in C. elegans
(Fire et al., 1998;
Kennerdell and Carthew, 1998),
we considered that systemic silencing phenotypes might reflect "leaky
promoter" activity in nonspecific tissues. We would thus have been
presented a need to discern the mechanism responsible for systemic loss of GFP
fluorescence (leaky promoter versus cellular exit of dsRNA).
These initial results (Figures
1 and
2) raised some intriguing
questions as to the robustness of dsRNA exit mechanisms in C. elegans
cells and suggested that cellular export of RNA silencing molecules is not a
significant aspect of the systemic RNAi response, at least for systemic
silencing signals that are derived from intracellular sources. (Similarly,
dsRNAs transcribed within cells do not elicit systemic RNA silencing in
Drosophila; Giordano et
al., 2002.) Indeed, analyses of the fed mutants
suggest that at least some cells in this animal have active mechanisms to
prevent systemization of RNA silencing signals that are derived from the
nucleus. However, systemization of RNA silencing signals has been observed
previously using similar transgene configurations in C. elegans. In
one instance, the myo-2 promoter was used to drive expression of a
gfp hairpin, and loss of fluorescence was observed outside the normal
expression range of this promoter (pharyngeal muscle)
(Winston et al.,
2002). Because the ectopic RNA silencing in this system was
dependent upon a functional sid-1 gene, spreading of a silencing
signal (as opposed to errant transcription) is indeed implicated.
(Sid-1 encodes a protein with eleven putative transmembrane-spanning
regions, and sid-1 mutants ineffectively respond to dsRNA delivered
exogenously; thus, sid-1 is more likely to play a role in the uptake
of RNA silencing signals or in their further dissemination rather than
regulation of transgene expression.) However, the ectopic silencing induced by
expression of myo-2::gfp hairpin was relatively weak (silencing was
not observed in all cells of the animal) and was temperature dependent. Our
contrasting observations of tissue-specific silencing may be a reflection of
the relative robustness of the promoters used in the different experiments.
Although the myo-3, vit-2, and unc-119 regions we used are
considered strong transcriptional activators based on the fluorescence
intensity of GFP that accumulates when under their regulation, the
myo-2 and snb-1 promoters are exceptionally strong
(snb-1 promoters have also been noted to elicit RNAi outside the
nervous system (Honigberg, personal communication). Thus, an ability to effect
tissue-specific RNAi in C. elegans by using transgene-delivered dsRNA
may depend upon the choice of promoter used to drive dsRNA expression.
After treatment with exogenous, unrelated dsRNA we observed release of an
RNA silencing signal from cells (Figure
3 and Table 1).
Although exposure to high concentrations of dsRNA of defined sequence is
probably not a normal event in the life of native C. elegans, the
effects we have observed demonstrate that dsRNA derived from the environment
can influence, as well as trigger, RNA-silencing mechanisms in this organism.
The systemic silencing response we observed with exogenous nonspecific dsRNA
in C. elegans was in all cases a partial and limited response. One
intriguing possibility is that the immediate physiological inducer of systemic
silencing may not be dsRNA but rather some other molecule produced during the
experiments. In this respect, it is important to recall lessons from studies
of metabolism in which key regulators can be by-products rather than central
intermediates in a biochemical pathway
(Jobe and Bourgeois,
1972).
Given the important role of RNAi in protecting cells from viruses, it might be expected that growth conditions that are indicative of a hostile or pathogen-rich environment might also induce similar systemic RNAi responses. We have noted that certain contaminated growth media produce a systemic response similar to that observed in the presence of exogenous dsRNA and in fed-1 and fed-2 mutants (our unpublished data). Several interesting possibilities exist that might explain systemic responses in such an environment: a dsRNA virus/bacteriophage present in the media might recapitulate the experimental conditions in Figure 3 by providing an abundant source of dsRNA or other triggering molecule; some environments might provide conditions under which the C. elegans RNAi system is "primed" to handle intracellular dsRNA; alternatively, some environments might allow systemic silencing by physically interfering with the integrity of C. elegans cells by providing molecules that perforate cells, for example. The nature of the contaminating microorganisms in the growth media has not been fully characterized. These experiments reinforce the suggestion that systemic RNAi may be part of a general mechanism for sensing and responding to environmental pathogens.
Our results suggest that multiple mechanisms are used in the systemic
uptake and exit of dsRNA molecules in intact animals and these mechanisms can
be revealed by physiological and genetic aberrations. For example, the
constitutive systemic silencing observed in fed-1 and fed-2
mutants suggests an interesting interplay between cellular dsRNA uptake and
exit mechanisms in this organism. The normal activities performed by these
genes might include inhibiting the manufacture of a mobile silencing signal,
or inhibiting the cellular exit or uptake of a mobile silencing signal; or
preventing organismal or cellular purge, sequestration, or degradation of a
silencing signal. The precise mechanism that is disrupted by these mutations
is not known. The phenotypes of the fed mutants contrast sharply to
that of sid-1 mutants (Winston
et al., 2002): sid-1 facilitates mobilization of
silencing signals and defects in sid-1 lead to a failure to respond
to dsRNA delivered by feeding or soaking, a failure to exhibit systemic RNAi
from transgene-derived dsRNAs expressed in somatic tissue and a reduced level
of RNAi response in progeny of injected mutant animals. Like sid-1
mutants, the fed mutants are defective in responding to ingested
dsRNAs; however, these mutants respond much more robustly to injected dsRNA
than sid-1, leading to silencing in the progeny of fed
animals (our unpublished data). One of our working models for the phenotypes
exhibited by fed mutants (spreading of in vivo-derived signals and
lack of spreading of signals derived by ingestion) is that these different
phenotypic behaviors reflect a deficiency in a tissue-specific mechanism
active in gut cells.
In C. elegans, the most readily observed responses to dsRNA are
sequence-specific gene silencing effects
(Montgomery et al.,
1998). In contrast, mammalian cells exhibit a variety of prominent
responses to dsRNA that are not sequence-specific in nature
(Kaufman, 1999;
Williams, 1999;
Majde, 2000;
Barber, 2001;
Levy and Garcia-Sastre, 2001).
The innate immune responses to dsRNA in mammalian systems involve both
intracellular and extracellular detection of dsRNA
(Alexopoulou et al.,
2001). These reflect in part a conservative, efficient, and
evolutionarily constrained effort to eliminate viruses or invading genomes. In
some cases, the mammalian response to extracellular dsRNA is thought to result
from circulating virus or the death and lysis of viral-infected cells. Our
observations of inducible export of dsRNA in C. elegans raise the
possibility that these protective responses that act systemically in higher
animals may also be mediated by deliberate cellular dsRNA export
mechanisms.
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
Footnotes |
|---|
Present address: University of Tokushima, Tokushima 770-8503 Japan. 
Corresponding author. E-mail address:
timmons{at}ku.edu.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Barber, G.N. (2001). Host defense, viruses and apoptosis. Cell Death Differ. 8, 113-126.[CrossRef][Medline]
Baulcombe, D. (2002). RNA silencing. Curr. Biol. 12, R82-R84.[CrossRef][Medline]
Bernstein, E., Caudy, A.A., Hammond, S.M., and Hannon, G.J. (2001). Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363-366.[CrossRef][Medline]
Boerjan, W., Bauw, G., Van Montagu, M., and Inze, D. (1994). Distinct phenotypes generated by overexpression and suppression of S-adenosyl-L-methionine synthetase reveal developmental patterns of gene silencing in tobacco. Plant Cell 6, 1401-1414.[Abstract]
Bucher, G., Scholten, J., and Klingler, M. (2002). Parental RNAi in Tribolium (Coleoptera). Curr. Biol. 12, R85-R86.[CrossRef][Medline]
Caplen, N.J., Parrish, S., Imani, F., Fire, A., and Morgan, R.A.
(2001). Specific inhibition of gene expression by small
double-stranded RNAs in invertebrate and vertebrate systems. Proc.
Natl. Acad. Sci. USA 98,
9742-9747.
C. elegans Sequencing Consortium, The.
(1998). Genome sequence of the nematode C. elegans: a
platform for investigating biology. Science
282,
2012-2018.
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001a). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498.[CrossRef][Medline]
Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001b).
RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes
Dev. 15,
188-200.
Fagard, M., Boutet, S., Morel, J.B., Bellini, C., and Vaucheret, H.
(2000). AGO1, QDE-2, and RDE-1 are related proteins required for
post-transcriptional gene silencing in plants, quelling in fungi, and RNA
interference in animals. Proc. Natl. Acad. Sci. USA
97,
11650-11654.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811.[CrossRef][Medline]
Giordano, E., Rendina, R., Peluso, I., and Furia, M.
(2002). RNAi triggered by symmetrically transcribed transgenes in
Drosophila melanogaster. Genetics
160,
637-648.
Gonczy, P., et al. (2000). Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature 408, 331-336.[CrossRef][Medline]
Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, 23-34.[CrossRef][Medline]
Grishok, A., Tabara, H., and Mello, C.C. (2000).
Genetic requirements for inheritance of RNAi in C. elegans.
Science 287,
2494-2497.
Hamilton, A.J., and Baulcombe, D.C. (1999). A species
of small antisense RNA in posttranscriptional gene silencing in plants.
Science 286,
950-952.
Hamilton, A., Voinnet, O., Chappell, L., and Baulcombe, D. (2002). Two classes of short interfering RNA in RNA silencing. EMBO J. 21, 4671-4679.[CrossRef][Medline]
Hannon, G.J. (2002). RNA interference. Nature 418, 244-251.[CrossRef][Medline]
Jobe, A., and Bourgeois, S. (1972). lac Repressor-operator interaction VI. The natural inducer of the lac operon. J. Mol. Biol. 69, 397-408.[CrossRef][Medline]
Kaufman, R.J. (1999). Double-stranded RNA-activated
protein kinase mediates virus-induced apoptosis: a new role for an old actor.
Proc. Natl. Acad. Sci. USA 96,
11693-11695.
Kelly, W.G., Xu, S., Montgomery, M.K., and Fire, A. (1997). Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics 146, 227-238.[Abstract]
Kennerdell, J.R., and Carthew, R.W. (1998). Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95, 1017-1026.[CrossRef][Medline]
Kennerdell, J.R., and Carthew, R.W. (2000). Heritable gene silencing in Drosophila using double-stranded RNA. Nat. Biotechnol. 18, 896-898.[CrossRef][Medline]
Ketting, R.F., Fischer, S.E., Bernstein, E., Sijen, T., Hannon,
G.J., and Plasterk, R.H. (2001). Dicer functions in RNA
interference and in synthesis of small RNA involved in developmental timing in
C. elegans. Genes Dev. 15,
2654-2659.
Klahre, U., Crete, P., Leuenberger, S.A., Iglesias, V.A., and
Meins, F., Jr. (2002). High molecular weight RNAs and small
interfering RNAs induce systemic posttranscriptional gene silencing in plants.
Proc. Natl. Acad. Sci. USA 99,
11981-11986.
Klink, V.P., and Wolniak, S.M. (2000). The efficacy of RNAi in the study of the plant cytoskeleton. J Plant Growth Regul. 19, 371-384.[Medline]
Knight, S.W., and Bass, B.L. (2001). A role for the
RNase III enzyme DCR-1 in RNA interference and germ line development in
Caenorhabditis elegans. Science
293,
2269-2271.
Levy, D.E., and Garcia-Sastre, A. (2001). The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine Growth Factor Rev. 12, 143-156.[CrossRef][Medline]
Lohmann, J.U., Endl, I., and Bosch, T.C. (1999). Silencing of developmental genes in hydra. Dev. Biol. 214, 211-214.[CrossRef][Medline]
MacMorris, M., Spieth, J., Madej, C., Lea, K., and Blumenthal, T.
(1994). Analysis of the VPE sequences in the Caenorhabditis
elegans vit-2 promoter with extrachromosomal tandem array-containing
transgenic strains. Mol. Cell. Biol.
14,
484-491.
Maduro, M., and Pilgrim, D. (1995). Identification and cloning of unc-119, a gene expressed in the Caenorhabditis elegans nervous system. Genetics 141, 977-988.[Abstract]
Majde, J.A. (2000). Viral double-stranded RNA, cytokines, and the flu. J. Interferon Cytokine Res. 20, 259-272.[CrossRef][Medline]
Mello, C.C., Kramer, J.M., Stinchcomb, D., and Ambros, V. (1991). Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10, 3959-3970.[Medline]
Mlotshwa, S., Voinnet, O., Mette, M.F., Matzke, M., Vaucheret, H., Ding, S.W., Pruss, G., and Vance, V.B. (2002). RNA silencing and the mobile silencing signal. Plant Cell Suppl. 14, S289-S301.
Montgomery, M.K., Xu, S., and Fire, A. (1998). RNA as
a target of double-stranded RNA-mediated genetic interference in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA
95,
15502-15507.
Palauqui, J.C., and Balzergue, S. (1999). Activation of systemic acquired silencing by localised introduction of DNA. Curr. Biol. 9, 59-66.[CrossRef][Medline]
Palauqui, J.C., Elmayan, T., Pollien, J.M., and Vaucheret, H. (1997). Systemic acquired silencing: transgene-specific post-transcriptional silencing is transmitted by grafting from silenced stocks to non-silenced scions. EMBO J. 16, 4738-4745.[CrossRef]
