![]() |
|
|
Vol. 14, Issue 8, 3065-3081, August 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


||
* Department of Biology and Developmental Biology Center, University of
Washington, Seattle, Washington 98195-1800;
Institute of Neuroscience, University of Oregon, Eugene, Oregon
97403-1254
Submitted August 27, 2002;
Revised April 13, 2003;
Accepted April 15, 2003
Monitoring Editor: Mark Ginsberg
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Cadherins are prominent in adherens junctions and desmosomes used in the
formation of epithelial tissues. They are transmembrane proteins, which form
homophilic interactions between neighboring cells and connect the plasma
membrane with the actin cytoskeleton. They are involved in signaling,
polarization of epithelia, cell sorting, and probably cell migration (reviewed
in Gumbiner, 2000
). Cadherins
are also thought to regulate many aspects of morphogenesis: mouse embryos
deficient in N-cadherin (Cdh2) develop mesodermal defects such as irregularly
shaped somites and an undulating notochord and die at day 10
(Radice et al.,
1997
). Mosaic expression of a dominant-negative cadherin in
Xenopus embryos results in failure of the expressing cells to
intercalate during notochord morphogenesis
(Delarue et al.,
1998
). In N-cadherin mutants (parachute) of zebrafish
(Danio rerio), convergent cell movements in the neural tube are
severely compromised (Lele et
al., 2002
).
The integrin-mediated and cadherin-mediated adhesion-modulating systems may
interact. Somitogenesis in vertebrate embryos involves presumptive somite
border cells with cadherin-based adhesion apically
(Linask et al., 1998
)
while forming integrin-based focal adhesions to the ECM basolaterally
(Hens and DeSimone, 1995
;
Henry et al., 2001
).
In addition, mesoderm migrates as a multilayered coherent mass held together
by cadherins in Xenopus embryos
(Winklbauer et al.,
1996
). It seems plausible that the mechanism that coordinates
these activities may involve proteins that participate in both processes.
Paxillin functions as an adaptor protein coordinating the activities of
many focal adhesion proteins (Turner,
2000b
). Thus, paxillin is in a position to play a role in the
integration and regulation of adhesion and signaling, yet little is known
regarding its function during embryogenesis
(Turner, 1991
;
Hagel et al., 2002
).
FAK (abbreviated "Fak" in zebrafish) is a nonreceptor tyrosine
kinase that binds paxillin and is a well-characterized component of focal
adhesions. Integrin-mediated FAK-autophosphorylation of Tyr397
generates a binding site for Src, which in turn phosphorylates a number of
other tyrosine residues on FAK, notably Tyr576/577 in the kinase
domain and Tyr861 in the proline-rich domain
(Schlaepfer and Hunter, 1998
;
Cary et al., 2002
).
Consequently, the phosphorylation state of Tyr397 is considered
indicative of FAK's activity. FAK has been localized at sites of strong
cell-ECM adhesion in embryos. Hens and DeSimone
(1995
) and Polte et
al. (1994
) showed that in
Xenopus and mouse embryos FAK is prominent at somite borders and in
the brain. We have shown it to be prominent in somite borders and in the
notochord cells in zebrafish embryos
(Henry et al.,
2001
).
To elucidate the roles of cell-cell and cell-ECM adhesion in morphogenesis
and to characterize these important regulators of adhesion, we have cloned
cDNAs representing paxillin (this study) and two isoforms of
fak (Henry et al.,
2001
; this study). We examined the differential phosphorylation of
tyrosine residues in Fak in the context of possible interactions with paxillin
and cadherins in the developing fish embryo. We found that Fak is dynamically
phosphorylated after gastrulation when the somites form and the notochord
extends the body-axis. We found that a novel pattern of Fak phosphorylation
occurs in the epithelial enveloping layer (EVL) at epithelial junctions where
Fak colocalizes with paxillin and cadherins. Our analysis of the expression
and phosphorylation dynamics of these proteins, combined with ultrastructural
observations, provides insight into the mechanisms of morphogenesis in the
EVL, somites, and notochord.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of fak1b cDNA
Sequences of fak1b were initially identified by a comparison of
the PCR products from a zebrafish PAC genomic library generously supplied by
Dr. Bruce W. Draper (Frederick Hutchinson Cancer Research Center, Seattle,
WA), by using specific and degenerate primers for the amino acid sequences
"PPTANLDR" and "EYVPMVKEVG" in the FAT domain.
Degenerate sequences were design by CODEHOP (Fred Hutch Cancer Research Center
and
http://bioinformatics.weizmann.ac.il/blocks/codehop.html).
The fak1b PCR product was used to isolate clones of fak1b
from the Lepage/Kimelman gastrula zebrafish library, which was cloned into a
Uni-ZAP XR unidirectional vector (Stratagene, San Diego, CA). To determine the
specificity of the FAK C-20 antibody (Santa Cruz Biotechnology, Santa Cruz,
CA), which we have previously demonstrated recognizes Fak1a in zebrafish
(Henry et al., 2001
),
we expressed Fak1b and assayed cross-reactivity by Western blot. The fak1b
clone was subcloned into a pGEX-5X-3 vector (Amersham Biosciences, Piscataway,
NJ) and transcribed and translated using PROTEINscript-PRO (Ambion, Austin,
TX). The 5' end of fak1b was sequenced from a TA-clone derived
from a 5' rapid amplification of cDNA ends (RACE) cDNA library
generously supplied by Chris J. Thorpe (University of Washington, Seattle,
WA), by using SMART RACE (BD Biosciences Clontech, Palo Alto, CA) and
5'-CGTCACATTCTCATACACTT-3' as the reverse fak1b primer.
The GenBank accession number for the full-length zebrafish fak1b
sequence is AY196213
[GenBank]
.
Mapping of paxillin and fak1b
The meiotic mapping of paxillin was performed as in Henry et
al. (2001
). Genomic DNAs
from the mapping panels were amplified using primers from the
3'-untranslated region of paxillin to give a 342-base pair
fragment (forward paxillin +53 CCTTGTGGCGGTAGTGAGCA, reverse
paxillin 394 AGACATGATACGGCCGAGGAAGAA). Genomic DNAs from the
mapping panels were similarly amplified using primers from the
3'-untranslated region of fak1b.
Whole-Mount In Situ Hybridization
Single in situ hybridizations were performed as in Henry et al.
(2001
). The antisense in situ
probes were synthesized to hybridize with the 3'-untranslated region of
the paxillin, fak1a, and fak1b transcripts. Sense controls
showed no specific staining (our unpublished data). Images of stained embryos
were prepared using Photoshop 7.0 (Adobe Systems, Mountain View, CA).
Western Blot Analysis
Methods were similar to those in Henry et al.
(2001
). For each stage to be
analyzed, embryos were partially deyolked by poking the yolk ball with sharp
forceps and gently squeezing the embryo to force out the majority of yolk.
Deflated embryos were suspended in ice-cold embryo medium
(Westerfield, 1995
) with 10 mM
orthovanadate and one tablet of protease inhibitors/5 ml medium (double the
recommended dose of Mini Complete tablets; Roche Diagnostics, Indianapolis,
IN), settled on ice, and boiled in 2x reducing SDS-PAGE sample buffer at
a concentration of 1 embryo/µl. Ten microliters of embryo extracts was run
per lane in a 10% gel (Invitrogen, Carlsbad, CA), blotted, and processed for
enhanced chemiluminescence detection as in Henry et al.
(2001
). Primary antibodies
were used diluted at 1:1000, except for anti-paxillin, which was used at
1:5000, and secondary antibodies were used at 1:5000. To detect weak signals
during epiboly, films were exposed to the blots for 7 to 10 times longer than
for postbud stages. Films were scanned using an Umax 6500 scanner and prepared
using Photoshop 7.0 (Adobe Systems). For blots that were probed with multiple
antibodies, membranes were stripped using Restore Western blot stripping
buffer (Pierce Chemical, Rockford, IL) and redetected with secondary
antibodies between probes to ensure complete removal of primary antibodies.
Antibodies used were polyclonal antibodies to the C-terminal end of FAK (C-20;
Santa Cruz Biotechnology) and affinity-purified polyclonal antibodies to the
SH2 binding sites pY397FAK, pY576FAK,
pY577FAK, pY861FAK, and pY925FAK (BioSource
International, Camarillo, CA), which are conserved in human, mouse, and chick.
The antibody against paxillin was a monoclonal to human paxillin (Transduction
Laboratories, Lexington, KY).
The Tyr397 antigenic SH2 binding sites of zebrafish Fak1a and
Fak1b are identical with that of human FAK (see
Figure 2; Dre Fak1a:
Henry et al., 2001
and GenBank AAK31154
[GenBank]
; Dre Fak1b: GenBank AY196213
[GenBank]
). In comparison, the
sequence at this site in human cell adhesion kinase-
(CAK-
) is
dissimilar at four amino acids and becomes very dissimilar as the length of
the peptide is extended. BioSource International shows that their human
pY397-FAK peptide, but not their human pY397-CAK-
competes with their pY397 affinity-purified polyclonal antibody
(http://www.biosource.com/;
catalog no. 44-624). Thus, their antibody to pY397-FAK is specific
for FAK. The CAK-
gene in zebrafish has not yet been identified.
|
The Tyr925 SH2 binding site is identical for human FAK and
zebrafish Fak1a and Fak1b (see Figure
2). The anti-pY925 antibody, however, is weak and only lightly
stains zebrafish proteins on Western blots and does not stain whole mounts.
The SH2 binding sites for Tyr576/577 and Tyr861 have one
or two conservative amino acid differences between humans and zebrafish. In
contrast, the site for human CAK-
Tyr576/577 is very
different in charge, and CAK-
has no Tyr861 SH2 binding site
(see Figure 2). The
anti-pY576/577 and anti-pY861 antibodies gave strong signals in both Western
blots and whole mounts of fish embryos.
The polyclonal antibody to the C-terminal end human FAK (C-20; Santa Cruz
Biotechnology) was shown by us to recognize the expressed Dre Fak1a
protein (Henry et al.,
2001
). By Western Blot analysis of the in vitro-expressed
proteins, we have shown that the FAK (C-20) antibody does not recognize with
Dre Fak1b and confirmed that it recognizes Dre Fak1a (our
unpublished data). The C termini of human CAK-
do not significantly
match that of human FAK (see Figure
2). Thus, all of our antibodies except that to C-20 FAK recognize
both Fak1a and Fak1b and not CAK-
. The antibody to C-20 Fak recognizes
only Fak1a.
Whole-Mount Antibody Immunofluorescence
Whole-mount immunostaining was used to determine the subcellular
localization of various antigens. In addition to the antisera used in Western
blot analysis, we used rabbit anti-laminin and anti-fibronectin (NeoMarkers,
Fremont, CA), mouse anti-pTyr (pY99; Santa Cruz Biotechnology), and rabbit
anti-PanCadherin (Sigma-Aldrich, St. Louis, MO), which was used previously by
Bitzur et al. (1994
)
on zebrafish. With the exception of experiments with the anti-FAK polyclonal
antibody, the embryos were dechorionated and fixed with 4% paraformaldehyde in
phosphate-buffered saline (PBS) with 10 mM orthovanadate for 24 h at 4°C.
All embryos were rinsed with PBDT (1% bovine serum albumin, 1% dimethyl
sulfoxide, and 0.1% Triton X-100 in PBS pH 7.3) and then blocked in PBDT with
5% bovine serum albumin at room temperature for 2 h. Embryos were incubated
with primary antibodies diluted at 1:200 overnight at 4°C. Embryos were
washed three times in PBDT, incubated 2 h with secondary antibodies (goat
anti-mouse Alexa-488, goat anti-rabbit Alexa-568; Molecular Probes) at 1:250
dilution at room temperature, and washed three times in PBDT, mounted, and
viewed using a Radiance 2000 confocal microscope (Bio-Rad, Hercules, CA)
fitted with 20x 0.8 numerical aperture dry and 63x 1.3 numerical
aperture water immersion objectives. Microscopic data were processed and
analyzed using ImageJ 1.27z
(http://rsb.info.nih.gov/ij/)
and prepared for publication using Photoshop 7.0 (Adobe Systems). For
actin-staining experiments, Alexa-568-conjugated phalloidin (Molecular Probes)
was added to the secondary incubation at 1:100. For negative control
experiments, diluted primary antibody was heat inactivated for 5 min at
70°C before use. No specific staining was observed in any negative
control. Embryos stained with anti-FAK were fixed in 2% trichloroacetic acid
as in Henry et al.
(2001
).
Detection of Apoptosis by Terminal Deoxynucleotidyl Transferase dUTP
Nick-End Labeling (TUNEL)
Apoptotic cell death in the EVL of normal embryos was detected using the
TUNEL technique. Embryos were fixed in 4% paraformaldehyde overnight at
4°C, made permeable by washing 3 x 15 min and 1 x 5 min in PBS
+ 1% Triton X-100, biotinylated with dUTP according to the Roche protocol, and
labeled nuclei detected using streptavidin-Alexa488 (Molecular Probes).
Transmission Electron Microscopy (TEM)
Embryos were dechorionated and fixed in Karnofsky's fixative (2%
paraformaldehyde, 2.5% glutaraldehyde, 5% sucrose, 0.1% CaCl2, in
0.2 M cacodylate buffer pH 7.2) overnight at 4°C. For TEM embryos were
postfixed in 4% osmium tetroxide (Electron Microscopy Sciences, Fort
Washington, PA) in 0.2 M cacodylate buffer for 1 h and then dehydrated through
graded ethanols, embedded in LX-112 resin overnight, and polymerized at
70°C. Blocks were sectioned, stained with uranyl acetate and lead citrate,
and viewed on a Phillips CM100 transmission electron microscope. Images were
prepared using Photoshop 7.0 (Adobe Systems).
| RESULTS |
|---|
|
|
|---|
-paxillin (Figure 1). In
the amino half of human paxillin, there are five conserved leucine-rich motifs
(LDxLLxxL), termed LD domains, which bind to a number of other proteins,
including FAK, vinculin, and p95PKL, and indirectly to the Rho family of
GTPases (Tong et al.,
1997
|
Zebrafish paxillin maps to linkage group 5 (LG5) with a high statistical significance (courtesy of Yi-Lin Yan and John Postlethwait, University of Oregon, Eugene, OR). It placed 3.05 cR from Z6323 with a Z6323 LOD of 14.1. Analyses of apparent orthologs show no synteny with human pavilion, which maps to human chromosome 14.
Zebrafish Has Two fak Genes, fak1a and fak1b
We have cloned the duplicated Fake gene, fak1b, which is
very similar to the previously reported fak1a
(Henry et al., 2001
)
and, like fak1a, is more similar in derived amino acid sequence to
mammalian FAK than to CAK-
. The amino acid sequence of
zebra fish Fak1b is 69% identical compared with zebra fish Fak1a or with human
FAK1 (Figure 2). The kinase
domain is very highly conserved being 94% identical to zebra fish Fak1a and
93% identical to human FAK1 (Figure
2, shaded area). The focal adhesion-targeting domain (FAT) of
zebra fish Fak1b is also highly conserved, 93% with zebra fish Fak1a and 92%
with human FAK1 (Figure 2,
cross-hatched). The proline-rich Cas binding domain (amino acids
714724; Figure 2) is
identical between all three FAK sequences. The FERM2 phosphotyrosine binding
domain, NYFY at amino acids 144147, is identical for Fak1a and Fak1b
and similar to Hum FAK (NFFY)
(Garcia-Alvarez et al.,
2003
). Of importance, for our observations, is that the SH2
binding sites surrounding Tyr397 and Try925 are
identical for zebrafish Fak1a, Fak 1b, and human FAK1 and that the SH2 binding
sites for Tyr576/577 and Tyr861 are identical except for
a few conservative changes (Figure
2, highlighted). Although the SH2 binding sites are similar for
the zebrafish and human FAK proteins, there are significant difference between
them and the SH2 binding sites of human CAK-
(Figure 2). Those areas that
differ most significantly between zebrafish Fak1a, Fak1b, and human FAK are
the N-terminal ends, two areas of the FERM3 domain, and the areas between the
proline-rich Cas binding domain and the FAT domain. These areas are not
usually conserved between species.
Zebrafish fak1b maps to linkage group 19 (LG19), which is a duplicate of LG 16 containing fak1a (see AAK31154 [GenBank] and AY196213 [GenBank] ). Both LG19 and LG 16 share syntenies with the distal tip of human chromosome 8, the site of the human FAK locus.
paxillin, fak1a, and fak1b mRNAs Are Expressed throughout
Embryogenesis
We previously found that fak1a mRNA is segmentally expressed in
the paraxial mesoderm and is regulated at least in part by the Notch signaling
pathway (Figure 3E;
Henry et al., 2001
).
We compared the expression of paxillin and fak1b with that
of fak1a. In situ hybridization reveals that paxillin mRNA
is expressed ubiquitously throughout the embryo at the shield stage
(Figure 3A), when very little
fak1a mRNA is detected (Figure
3B; Henry et al.,
2001
). The expression of fak1b is similar to
paxillin at shield stage (Figure
3C). At the 10-somite stages, paxillin, fak1a, and
fak1b mRNAs accumulate in the axial region, the head, and the tail.
However, in the paraxial region paxillin and fak1b are
expressed homogeneously (Figure 3, D and
F, respectively), whereas fak1a is expressed segmentally
(Figure 3E). At the 20-somite
stage, paxillin is detected strongly in the head and EVL surrounding
the yolk, and less strongly in the tail
(Figure 3G). In 20-somite
embryos, fak1a and fak1b are both expressed strongly in the
head region and in the dorsal axis, but not strongly in the EVL
(Figure 3, H and I).
fak1a is also segmentally expressed in the newly formed somites in
the tail (Figure 3H), The mRNA
expression is reflected in the protein expression (see below; Figures
5 and
9).
|
|
|
We also examined the expression of paxillin mRNA in the fused
somite class of mutations, which are believed to disrupt Ephrin and Notch
signaling and in which expression patterns of fak1a mRNA are
disrupted (Henry et al.
2001
,
2002
;
Holley et al., 2002
).
Expression of paxillin is ubiquitous throughout the paraxial mesoderm
in fused-somite (fss/Tbx24), beamter
(bea), deadly seven (des/notch 1), and after-eight
(aei/DeltaD) embryos and is indistinguishable from wild-type embryos
(our unpublished data). Thus, the transcriptional regulation of
paxillin is markedly different from fak1a, in that only
fak1a is segmentally expressed and regulated by the Notch
pathway.
Expression and Phosphorylation of Focal Adhesion Proteins Change
Dramatically after Gastrulation
FAK is phosphorylated at several SH2 binding sites, both because of
autophosphorylation in response to integrin signaling, and because of the
activity of other kinases such as Src
(Hanks and Polte, 1997
). We
used several affinity-purified rabbit antibodies that recognize conserved
phosphorylated SH2 binding sites from human FAK to analyze the phosphorylation
of the zebrafish Fak epitopes in whole-embryo extracts. The SH2 binding sites
of both Fak1a and Fak1b are identical for the zebrafish and human sequences
flanking Tyr397, and those sequences flanking Tyr925.
The sequences flanking Tyr576/577 and Tyr861 have just
one or two conserved changes between humans and zebrafish (see MATERIALS AND
METHODS). Several lines of evidence indicate that zebrafish CAK-
is not
recognized by these antibodies. The comparable Tyr397 and
Tyr576/577 sequences in human CAK-
are very dissimilar, the
Tyr861 SH2 binding site does not exist, and binding of the
antiserum to the FAK Tyr397 peptide is not competitively inhibited
by CAK-
peptides (see MATERIALS AND METHODS).
Dramatic increases in the abundance and phosphorylation of Fak and the
abundance of paxillin occur during somitogenesis
(Figure 4). In
Figure 4, this increase is
underrepresented because of the long exposures used to detect signals during
epiboly and gastrulation (first three lanes). During epiboly and gastrulation,
no Fak phosphorylation is detectable on Tyr397 even after long
exposures (Figure 4, lanes
13). However, the phosphorylation of other tyrosine residues of Fak,
including Tyr576/577, Tyr861, and Tyr925, are
just detectable in long exposures (Figure
4, lanes 13). By the beginning of somitogenesis, the
Tyr397 residue of Fak is increasingly phosphorylated. The
phosphorylation of all four tyrosine residues of Fak increases during
somitogenesis. This pattern is consistent with our previous observations
(Henry et al., 2001
)
and will be revisited later in relationship to spatial patterns of Fak
phosphorylation in the EVL and at somite boundaries.
|
A qualitative change in the detection of paxillin also occurs at the
beginning of somitogenesis, in the appearance of a doublet separated by an
apparent molecular mass of
5 kDa. This doublet does not seem to be due to
nonspecific proteolysis, because other proteins detected on the same blot show
no sign of degradation. We have not been able to assign the change to a
phosphorylation difference: a general phosphatase does not consolidate the
bands and both bands are phosphorylated. The faster moving band is probably
not the related Hic-5 protein, because Hic-5 is significantly smaller than
paxillin (50 compared with 68 kDa), and we have evidence by
immunocytochemistry that Hic-5 is not expressed during early somitogenesis,
whereas it is during late somitogenesis. In addition, we observed that the
slow-migrating band is cytosolic and the faster migrating paxillin band occurs
in a low-speed membrane pellet (our unpublished data). Possible explanations
for this doublet include expression of a second paxillin gene, alternate
splicing, posttranslational modifications, and paxillin-specific proteolysis
that is not blocked by the protease inhibitors in our extraction buffers.
Although we have found no evidence for the existence of a second paxillin gene
or splice variants in any of our libraries or in database searches, future
completion of the zebrafish genome sequence may resolve this question.
Nevertheless, it is clear that a qualitative change is taking place after the
onset of somitogenesis. We will designate this period of increased protein
synthesis, changes in the patterns of Fak and paxillin synthesis, and
increases in the phosphorylation of Fak as the postgastrula mesodermal
transition (PGMT).
Paxillin, Fak, Fibronectin, and Laminin Localize at Boundaries of
Somites as They Form
In zebrafish embryos, somites form by the alignment and polarization of
their border cells (Henry et al.,
2000
). Thus, we hypothesize that matrix deposition and adhesion at
newly formed somite boundaries may be important in the stabilization of somite
boundaries. We asked whether paxillin colocalizes with Fak in somites and
whether these proteins are found adjacent to the extracellular matrix
glycoproteins fibronectin and laminin.
Figure 5, A and D, illustrate
the abundance of paxillin and Fak in the axial and somitic mesoderm during
somitogenesis. Paxillin concentrates at the boundaries of forming somites
(Figure 5A, white arrowhead)
and in later stages at the boundaries of the chevron-shaped myotomes
(Figure 5B). That paxillin
protein remains abundant after paxillin mRNA has declined suggests
that the protein is relatively stable. The pattern of paxillin distribution in
somites is similar to that described for Fak
(Figure 5, D and E;
Henry et al., 2001
),
despite apparent differences in the regulation of these genes at the
transcriptional level. All tyrosine-phosphorylated forms of Fak that we are
able to detect by immunostaining (pY397, pY576/577, and
pY861Fak) concentrate at the somite boundaries during somitogenesis
and later stages (Figure 5, G, H, J, K, M,
and N). In addition, anti-pY397Fak labels the fused
myotome cells that extend between somite boundaries
(Figure 5H). Fibronectin
concentrates at the somite boundaries during somitogenesis
(Figure 6A, white arrowhead)
and in 24-h embryos (Figure
6B). We did not detect laminin in forming somite boundaries at the
eight-somite stage (Figure 6E),
but laminin is abundant at the somite boundaries by the 15-somite stage
(Parsons et al.,
2002
) and at 24 hours postfertilization (hpf)
(Figure 6F). In TEMs, we saw
that by prim-5 (24 hpf) the somites are separated by rich, fibrous ECM
(Figure 6J, between the black
arrows), consistent with the presence of both fibronectin and laminin. We also
occasionally observe cell processes that cross the somite boundary making
adherens and/or gap junctions with the cells of neighboring somites
(Figure 6J, white arrowheads).
The distributions of fibronectin and laminin are similar to those observed in
chick and frog embryos at the somite boundaries
(Duband et al., 1987
;
Krotoski and Bronner-Fraser,
1990
) and are consistent with our previous suggestion
(Henry et al., 2001
)
that focal adhesion contacts mediate the stabilization of somite
boundaries.
|
Ontogeny of Somite Boundaries
Cadherins have been implicated in the morphogenesis of axial mesoderm in
mice and frogs (Radice et al.,
1997
; Delarue et al.,
1998
) and in the somites of chick embryos
(Duband et al., 1987
;
Linask et al., 1998
).
In bud-stage fish embryos (Figure
7A) cadherins are concentrated in membranes of the axial mesoderm
of the notochord (black arrowhead), and in membranes of the adaxial and
paraxial cells of the presomitic mesoderm (white arrow and white arrowhead,
respectively). In lateral views of early somitogenesis, we see that cadherins
are concentrated in the internal cells of forming somites between the somite
boundaries (Figure 7B, see
middle of S1 and S2). In dorsal views later in development, cadherins are
still present around all cells, but are more concentrated at the somite
boundaries (Figure 7, C and D,
white arrowheads).
|
Somite boundaries emerge between mesodermal cells that are in direct
cell-cell contact. Wood and Thorogood
(1994
) suggested the formation
of the boundary starts in the lateral somitic mesoderm and then spreads into
adaxial somitic mesoderm. In contrast, Henry et al.
(2000
) suggested a random
initiation of boundary formation at multiple sites. To test these hypotheses,
we examined the ultrastructure of forming somite boundaries of a three-somite
embryo where the location of the forming somite boundaries could be
established (Figure 6H, black
brackets). At high magnification, we observed, several small
"islands" of ECM (Figure
6I, black arrowhead) between stretches of direct cell-cell contact
that extend both medially and laterally along nascent somite boundaries (white
arrowheads). These small patches of matrix are in stark contrast to a mature
somite boundary (Figure 6J),
which has rich ECM separating cells of adjacent somites. Our observations
suggest that somite boundaries form at multiple sites between adjacent
somites.
Notochord Cells Initially Express Cadherins and Form Circumferential
Focal Adhesions after Intercalation
As previously noted, the earliest adhesion proteins found in the notochord
are cadherins that concentrate in the membranes of notochord cells in
bud-stage embryos (Figure 7A,
black arrowhead). In eight-somite embryos the level of cadherin detected in
the anterior notochord cells (Figure
7C, black arrowhead) becomes reduced compared with posterior
regions that are still undergoing intercalation. These observations suggest
that cadherins are required primarily during intercalation. By prim-5, high
levels of cadherins are detected only in isolated cells in the caudal region
of the notochord (Figure 7E,
black arrowheads; and F). This residual staining suggests that these cells are
still undergoing intercalation.
Paxillin and Fak are expressed abundantly in the cytoplasm of intercalating notochord cells (Figure 5, A, C, D, and F, black arrowheads). Their localization on plasma membranes cannot be verified as distinct from nuclear exclusion of the proteins, which gives the impression of their location in the cortex of the cell. Most obvious, however, is that fibronectin and laminin are absent from the regions where cells are intercalating (Figure 6, A, C, and D, black arrowheads). Instead, laminin is present at the periphery of the notochord (Figure 6, D, E, and G). To assess the interaction of notochord cells with the perichordal sheath, we investigated the pattern of Fak phosphorylation. Figure 5G shows a single confocal section of a 10-somite embryo labeled with an antibody to pY397Fak. We can resolve fine circumferential striations where notochord cells are in contact with the perichordal ECM (black arrowhead). Labeling is restricted to the periphery of the notochord. These circumferential striations persist and are shown in a projection of confocal sections comprising the notochord of a prim-5 embryo (24 hpf) stained with anti-pY397Fak in Figure 5I (black arrowhead) and with anti-pY861Fak in Figure 5O (black arrowhead). These observations imply a fine structure in the pattern of adhesion to the extracellular matrix that has not been previously described.
To determine what, if any, relationship these circumferential patterns of Fak-immunolabeling have to the ultrastructure of the notochord sheath surrounding the notochord, we used electron microscopy. In the TEMs of prim-5 embryos (Figure 8A), a fibrous sheath denoted by black arrowheads can be seen beside the notochord cells, which are to the left of the sheath. At high magnification, we see what may be focal adhesions where the notochord cell membrane contacts the perichordal sheath (Figure 8B, black arrowheads). The layer of matrix closest to the notochord and these sites of adhesion is laminin-like, based on ultrastructure. The dominant component of the sheath, however, is probably a fibrillar collagen. The orientations of collagen-like fibers occur in alternating groups, which are either perpendicular to the plane of section, and thus, circumferential to the notochord, or else parallel to the plane of section and thus, longitudinal to the notochord. In prim-5 embryos, the distance between groups of circumferential fibers is 1.56 ± 0.35 µm (n = 14) (Figure 8A, black arrowheads), and the distance between circumferential striations of immunostaining for pY861Fak is 1.45 ± 0.27 µm (n = 26) (Figure 8D). These are statistically indistinguishable patterns. We hypothesize that the pattern of phosphorylation of Fak represents a spatially periodic pattern of adhesion by notochord cells to the sheath. During notochord elongation, this pattern of adhesion may generate an uneven mechanical load on the sheath, resulting in the observed alternating pattern of orientation of the collagen-like fibers.
|
To test this hypothesis, we looked at the sheath of the notochord in three-somite embryos before notochord extension has occurred. The fibers of the matrix surrounding the notochord in the three-somite embryos occur only in circumferential orientation (Figure 8, C and E). We also measured the distance between circumferential striations of pY397Fak around the notochord periphery in an embryo that did not yet have a straight body-axis. The distance between striations in the 10-somite embryos in Figure 5G is 0.63 ± 0.18 µm (n = 24), which is significantly smaller that that of the older prim-5 embryo (P << 0.01) (Figure 8E; see above). Consistent with our hypothesis, the longitudinal collagen fibers indicative of stretching are absent from the notochord sheath in early embryos. Thus, as the notochord elongates, the spacing between striations in Fak phosphorylation expand and the longitudinal collagen fibers occur.
Paxillin, Cadherin, and Noncanonically Phosphorylated Fak
Codistribute at the Lateral Membranes of the Enveloping Layer Cells
The first tissue to develop in the zebrafish embryos is the EVL. The EVL is
an epithelial sheet that migrates over the yolk and gastrulating embryo,
forming an extraembryonic membrane (Kimmel
et al., 1995
). The cells of the EVL remain a coherent
epithelium that extends and flattens, enveloping the yolk and the rest of the
embryo. The mechanism of its migration is not clear
(Betchaku and Trinkaus, 1978
;
Cooper and Kimmel, 1998
;
Zalik et al., 1999
).
This epithelium undergoes apoptosis at around prim-15 (30 hpf) shown by TUNEL
labeling of apoptotic EVL cell nuclei
(Figure 9S).
To better understand the migration of this epithelial EVL, we investigated the distribution and activity of cell adhesion proteins during epiboly of the EVL by using confocal microscopy. Anti-paxillin and anti-cadherin immunolabeling shows concentrations of both proteins at the lateral margins of EVL cells at 50% epiboly (Figure 9, A and D). This codistribution of paxillin and cadherin continues as long as the EVL is present and is shown herein in a six-somite embryo (Figure 9, B and E) and in a prim-5 embryo (Figure 9, C and F). At higher magnification, the paxillin staining (Figure 9C) is often more diffuse than cadherin staining (Figure 9F) and may extend into the cytosol with actin.
The existence of tight and adherens junctions and desmosomes (macula adherens) between cells of the EVL were confirmed by TEM. Tight junctions hold these cells together at their apical-lateral points of contact (Figure 9P, white arrow). Basal to the tight junctions are an adherens junction followed by a row of desmosomes surrounded by dense material that is probably intermediate filaments (Figure 9P, white and black arrowheads). This structure is consistent with tension being applied to these cells as they spread over the embryo.
The surprising observations that paxillin is concentrated at the lateral margins of EVL cells and that some tyrosine residues of Fak, but not Tyr397, are phosphorylated during epiboly (Figure 4) led us to investigate the localization of phosphorylated Fak during epiboly and gastrulation. fak1b, the dominant isoform of Fak expressed early in development (Figure 3, B and C), is not recognized by anti-Fak-C20 and is therefore not shown. However, faint immunoreactivity can be seen in the EVL of prim-5 embryos stained with anti-Fak-C20 (Figure 5E, arrowhead), suggesting that both isoforms of Fak may be expressed in the EVL. The phosphorylated residues of Fak detectable at EVL cell boundaries are pY576/7Fak (Figure 9, JL) and pY861Fak (Figure 5, MO). Phosphorylation on Tyr397 is not detected at the borders of EVL cells in any stages examined (Figure 9, GI). Punctate background staining was seen in both cellular and acellular regions of the embryo when using anti-pY397Fak antibodies (Figure 9, GI), but no labeling was ever seen at the lateral membranes of EVL cells. Similar findings are shown in Figure 5 where anti-pY576Fak and anti-pY861Fak stain the epithelium of EVL cell margins (Figure 5, K, L, and O), but anti-pY397Fak does not (Figure 5I). These observations are consistent with the phosphorylation patterns of Fak seen in Western blots before the bud stage (Figure 4). How phosphorylated-Fak functions in the EVL is not yet clear, but it does not seem to depend on stable phosphorylation of Tyr397.
Zalik et al.
(1999
) and Betchaku and
Trinkaus (1978
)) have shown
that EVL cells contain conspicuous cortical actin belts and that the apical
surfaces of the EVL cells are covered with small aggregates of actin
coincident with microvilli or ridges. We investigated the relationship between
paxillin, cortical belts, and these microvilli. In the EVL at the prim-5 stage
(24 hpf), paxillin is abundant (Figure
9R) in areas of actin concentration
(Figure 9Q) that is in the
cortical belt and microvilli-like extension. One possible interpretation is
that paxillin is associated with actin support filaments spreading from
adherens or tight junctions.
In summary, the EVL migrates as an epithelial layer connected at their lateral margins by tight and cadherin-based adherens junctions. The focal adhesion proteins paxillin and Fak associate near these junctions. The distribution of paxillin, pY576/577Fak and pY861Fak, cadherin, and actin at the lateral margins of the EVL cells are strikingly similar from 50% epiboly through prim-15, suggesting a cooperation in their functions. The stably phosphorylated tyrosine residues of Fak in the EVL are in the kinase domain, near the Cas-binding site, and in the Map kinase-signaling domain, but not at the autophosphorylation site.
| DISCUSSION |
|---|
|
|
|---|
Regulation of Focal Adhesion Components
The transcriptional regulation of the segmentally expressed fak1a
mRNA was shown to be strongly affected by mutants in Notch signaling
(Henry et al., 2001
).
The expression pattern of the nonsegmentally expressed paxillin mRNA
is independent of Notch or other signaling that confers segmentation in the
paraxial mesoderm (Conlon et al.,
1995
; Barrantes et
al., 1999
). Despite these differences in transcriptional
regulation, paxillin and Fak1a proteins show many similarities in expression
pattern at the protein level especially in somitogenesis and notogenesis. Both
proteins accumulate at the boundaries of the forming somites where fibronectin
is secreted, persist after the formation of the intersomitic borders, and
remain through myotome formation. Both proteins are abundant in the notochord
and both proteins seem to be participating in the cell-cell adhesion between
EVL cells.
Cell Adhesion in Somite Boundary Formation
Focal adhesions do not act alone in forming somites. Cadherin proteins
occur early on the membranes of every cell of the presomitic mesoderm. In
early zebrafish embryos, we see a reduction in the abundance of cadherins at
the interface with neighboring somite border cells, similar to that in chick
embryos where there is strong expression of cadherin proteins in the inner
mesenchymal cells of forming chick somites and down-regulation near the somite
borders (Duband et al.,
1987
; Radice et al.,
1997
). The observations in chicks suggested that the formation of
cell-cell adhesions drives the formation of groups of somite cells. In other
words, the adhesions of the central mesenchymal cells pull together groups of
cells to form discrete somites, segmenting the presomitic mesoderm. We have
shown previously that, at least in zebrafish, the central mesenchyme cells are
not needed for the formation of somite boundaries
(Henry et al., 2000
).
Herein, we also show with TEM images that a matrix is secreted between somite
boundaries in patches as the borders form.
Our observations that phosphorylated Fak and paxillin concentrate at somite
boundaries where fibronectin is secreted is consistent with integrin-based
adhesion to fibronectin at one edge of these polarized cells
(Henry et al., 2001
;
this study). Laminin is not required because mutations in laminin
1 and
1 do not disrupt somite boundary formation. Rather, laminin mutations
disrupt the formation of the notochord, which is surrounded by laminin, and
the differentiation of somites at a stage when we see laminin in somites
(grumpy and sleepy; Stemple et al., 1996;
Parsons et al.,
2002
). We see also in the TEM sections that cell-cell contacts
extend across somite boundaries in late-stage embryos, which may contain the
cadherin proteins we observe in mature somites and may stabilize these
boundaries. Thus, the formation of somites is mediated by both cell-cell
(cadherin) and cell-matrix (fibronectin/integrin/Fak) junctions.
Cell Adhesion in Notogenesis
The nature of the cell-cell or cell-matrix interactions involved in the
intercalation of notochord cells is obscure
(Keller et al., 1989
;
Winklbauer and Keller, 1996
;
Henry et al., 2001
).
We found cadherin proteins and little, if any, matrix material between the
intercalating cells of the early notochord. Furthermore, we detected
phosphorylated Fak only at the interface between notochord cells and the
perichordal sheath, not in the middle of the notochord where the cells are
extending processes that intercalate between one another. Thus, integrin-based
adhesion to the ECM may not provide traction for the intercalating cells. In
zebrafish, the N-cadherin (Cdh2) gene parachute
clearly mediates convergence of dorsal cells in the midbrain, a process
similar to notochord cell intercalation
(Lele et al., 2002
).
Zebrafish E-cadherin (Cdh1) mRNA is present in the midline
during early development and could be involved in the ventral notochord cell
movements (Babb et al.,
2001
). We and others (Duband
et al., 1987
;
Krotoski and Bronner-Fraser,
1990
; Delarue et al.,
1998
) have shown that cadherins are present surrounding notochord
cells, and we suggest that cadherin-based cell-cell adhesion could provide the
major traction force required for notochord intercalation. This idea is
consistent with results of mosaic expression of a dominant-negative cadherin
construct in Xenopus embryos, in which axial mesoderm cells
expressing the construct fail to intercalate
(Delarue et al.,
1998
).
Notogenesis involves the deposition of an ECM sheath around the presumptive
notochord cells and the intercalation of the notochord cells into a single
column of disk-shaped cells that contact the ECM at their peripheries, like a
stack of pennies in a tube. The notochord cells then develop large internal
vacuoles, the inflation of which results in elongation and stiffening of the
notochord. One possible mechanism for this elongation is that the mechanical
properties of the sheath and the interactions of the cells with the sheath
result in a system that resists lateral expansion, while permitting
longitudinal expansion (Adams et
al., 1990
). Our observations with respect to the
ultrastructure of the zebrafish notochord sheath and the pattern of Fak
phosphorylation within the notochord are consistent with such a model.
Viewed by TEM, the zebrafish notochord sheath has an extensive fibrillar
layer, which seems structurally similar to collagens. Zebrafish notochord
cells express type II collagen mRNA (Yan
et al., 1995
; Lele
and Krone, 1997
), and types I and II collagen are
well-characterized components of the perichordal sheath in other vertebrates
(Ghanem, 1996
;
Zhu et al., 2001
).
The collagen-like fibrillar matrix is bound on the notochord side by laminin,
which is required for notogenesis: mutations in laminin
1 and
1
block differentiation of the notochord, which is rescued by exogenous sources
of laminin (Parsons et al.,
2002
).
We see a change in the orientation of the collagen-like fibrillar matrix that correlates with notochord elongation and with a change in distance between the circular patterns of Fak phosphorylation on the periphery of the notochord. In the early embryo, the collagen-like fibers within the sheath are consistently circumferential, and circumferential striations in phospho-Fak immunolabeling are close together. Later in development, we see alternating patterns of circumferential and longitudinal collagen-like fibers and the circumferential striations in phospho-Fak immunolabeling are further apart. If the notochord cells were adhering to the fibrillar sheath by periodic junctions such as focal adhesion complexes while the notochord was undergoing expansion by vacuolization, these periodic junctions would move apart and the fibers between the junctions would be stretched longitudinally, like a coil-spring being stretched. We observe this pattern in the perichordal sheath.
Focal Adhesion Proteins in the Enveloping Epithelial Layer
Previous investigations have shown that cadherins are abundant at the
lateral margins of EVL cells (Zalik et
al., 1999
) and are important in maintaining the integrity of
the ectoderm during epiboly in Xenopus embryos
(Levine et al., 1994
,
Lee and Gumbiner, 1995
).
Although Betchaku and Trinkaus
(1978
) have studied the
morphology and ultrastructure of the EVL in the teleost, Fundulus
heteroclitis, apart from the studies of Zalik et al.
(1999
), little is known about
the nature of the EVL in zebrafish.
The vegetal spreading of the EVL is an interesting example of a migrating
epithelial sheet. Typically, cells of an epithelium share tight junctions and
cadherin-based adherens junctions and desmosomes (reviewed in
Jamora and Fuchs, 2002
). ECM
and integrins are ostensibly absent between neighboring cells in an
epithelium. This view of the EVL is supported by the close apposition of the
membranes and the absence of detectable ECM in TEMs and high magnification
confocal micrographs (Figure
9P). However, we find both paxillin and phosphorylated Fak,
hallmarks of integrin-mediated cell-ECM adhesion, concentrated along the
lateral membranes of these squamous epithelial cells where cadherin is also
present. It is provocative that Fak in the EVL is not detectably
phosphorylated on Tyr397, but is phosphorylated on
Try576/577 and Tyr861. McLean et al.
(2000
) showed that v-Src
phosphorylates residues in FAK in fibroblasts without phosphorylating
Tyr397 and results in a decrease in the fibronectin-stimulated
phosphorylation of FAK. Src phosphorylation of FAK may also drive the
deregulation of E-cadherin-associated adhesion in colon cancer cells
(Avizienyte et al.,
2002
). However, the noncanonical pattern of FAK phosphorylation
has not been documented in the context of a normal tissue nor its biological
significance understood. Tsai and Kinsey
(2002
)) showed that the
tyrosine kinase Yes is active in zebrafish embryos during epiboly and thus Yes
could potentially contribute to the phosphorylation of Fak1b. Another Src-like
kinase, Fyn, is activated by fertilization of zebrafish eggs
(Rongish and Kinsey, 2000
);
however, there is no evidence yet that Fyn is active during epiboly. We
propose that, in the epithelium of zebrafish EVL, modulation of the actin
cytoskeleton at cadherin-based cell-cell adhesions may involve
Tyr397-independent phosphorylation of Fak by Src-like kinases such
as Yes, although we cannot rule out rapid dephosphorylation of
Tyr397.
The integration of Fak and paxillin into the protein complex on the
cytoplasmic face of EVL cells may be mediated through 1) a direct
cadherin-paxillin interaction, because E-cadherin has a potential paxillin
binding sequence (Brown et al.,
1998
), or 2) through an indirect interaction with vinculin, which
binds paxillin and thus FAK (Tong et
al., 1997
). Cell-cell junctions in the corneal epithelium and
neuroepithelium also bind paxillin (Sugrue
and Zieske, 1997
; Chenn et
al., 1998
).
Several potential roles exist for paxillin and Fak in this migrating
epithelial sheet. It is unlikely that Fak in these cells is a signal for cell
division because EVL cells divide only once after the 10th cleavage cycle of
the embryo (Kane et al.,
1992
). One possibility is that Fak signaling blocks premature
apoptosis (Almeida et al.,
2000
). Fak also has a FERM domain, which would allow it to
interact with molecules such as phosphatidylinositol phosphate kinase
type1
that are involved in membrane recycling
(Liddington et al.,
2003
). Thus, Fak1b may be involved in membrane recycling during
the expansion of the EVL epithelial layer to 50% epiboly as it envelops the
yolk cell, or in remodeling of the EVL membrane as it moves over the lower
equator of the yolk cells. Paxillin may function to stabilize the microvilli
on the apical surface of EVL cells, which in turn might provide storage for
membrane and cytoskeletal material needed as the EVL expands over the yolk.
Our data support roles for paxillin and Fak in the organization of actin
around tight junctions or adherens junctions: functions that would help
stabilize or remodel cell-cell borders during the migration of this epithelial
sheet.
The PGMT
The shift in activity patterns of focal adhesion proteins observed during
development is of great interest. Dramatic changes in the expression as well
as qualitative and quantitative changes in phosphorylation of focal adhesion
proteins are indicative of a fundamental change in the adhesive milieu of
mesoderm cells at the onset of somitogenesis. Hagel et al.
(2002
) note in the mouse
embryo, similar to our observations in the zebrafish embryo, that there is
expression of paxillin in extraembryonic membranes early in development, and a
dramatic increase in paxillin abundance in the mesoderm after gastrulation.
Bitzur et al. (1994
)
also noted in the zebrafish a de novo synthesis of one subtype of cadherin at
the end of gastrulation, which persists through somitogenesis. We also
observed an increased expression of fak1a mRNA during somitogenesis. The
molecular triggers and consequences of this PGMT as well as the interactions
between cadherin-based and focal adhesion-based cell adhesion probably play
central roles in the morphogenesis of vertebrate embryos. We have only begun
to scratch the surface of our understanding of these processes.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
, cell adhesion kinase-
, which is also
known as protein tyrosine kinase 2
(PTK2
), and focal adhesion
kinase 2 (FADK 2); ECM, extracellular matrix; EVL, enveloping layer; FAK,
mouse, Xenopus, or human focal adhesion kinase protein; Fak,
zebrafish focal adhesion kinase protein; all numbering of Fak residues is
according to the known phosphorylated human sites; fak, mRNA or DNA
focal adhesions kinase gene; hpf, hours postfertilization; PGMT, postgastrula
mesoderm transition; TEM, transmission electron microscopy. Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02-08-0537. Article and publication date are available at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-08-0537.
Present address: Department of Biological Sciences, CW 405, University of
Alberta, Edmonton, Canada T6G 2E9. ![]()
Present address: Department of Molecular and Cell Biology, University of
California, Berkeley, CA 94720. ![]()
|| Corresponding author. E-mail address: mbhille{at}u.washington.edu.
| REFERENCES |
|---|
|
|
|---|
Almeida, E.A.C., Ilic, D., Han, Q., Hauck, C.R., Jin, F.,
Kawakatsu, H., Schlaepfer, D.D., and Damsky, C.H. (2000). Matrix
survival signaling: from fibronectin via focal adhesion kinase to c-Jun
NH2-terminal kinase. J. Cell Biol.
149,
741754.
Avizienyte, E., Wyke, A.W., Jones, R.J., McLean, G.W., Westhoff, M.A., Brunton, V.G., and Frame, M.C. (2002). Src-induced de-regulation of E-cadherin in colon cancer cells requires integrin signaling. Nat. Cell Biol. 4, 632638.[Medline]
Babb, S.G., Barnett, J., Doedens, A.L., Cobb, N., Liu, Q., Sorkin, B.C., Yelick, P.C., Raymond, P.A., and Marrs, J.A. (2001). Zebrafish E-cadherin: expression during early embryogenesis and regulation during brain development. Dev. Dyn. 22, 231237.
Barrantes, I.B., Elia, A.J., Wunsch, K., De Angelis, M.H., Mak, T.W., Rossant, J., Conlon, R.A., Gossler, A., and de la Pompa, J.L. (1999). Interaction between notch signaling and lunatic fringe during somite boundary formation in the mouse. Curr. Biol. 9, 470480.[CrossRef][Medline]
Betchaku, T., and Trinkaus, J.P. (1978). Contact relations, surface activity, and cortical microfilaments in marginal cells of the enveloping layer of the yolk syncytial and yolk cytoplasmic layers of Fundulus before and during epiboly. J. Exp. Zool. 206, 381426.[CrossRef][Medline]
Bitzur, S., Kam, Z., and Geiger, B. (1994). Structure and distribution of N-cadherin in developing zebrafish embryos: morphogenetic effects of ectopic over-expression. Dev. Dyn. 201, 121136.[Medline]
Brown, M.C., Curtis, M.S., and Turner, C.E. (1998). Paxillin LD motifs may define a new family of protein recognition domains. Nat. Struct. Biol. 5, 677678.[CrossRef][Medline]
Brown, M.C., West, K.A., and Turner, C.E. (2002).
Paxillin-dependent paxillin kinase linker and p21-activated kinase
localization to focal adhesion involves a multistep activation pathway.
Mol. Biol. Cell 13,
15501565.
Cary, L.A., Klinghoffer, R.A., Sachsenmaier, C., and Cooper, J.A.
(2002). SRC catalytic but not scaffolding function is needed for
integrin-regulated tyrosine phosphorylation, cell migration, and cell
spreading. Mol. Cell. Biol. 22,
24272440.
Chenn, A., Zhang, Y.A., Chang, B.T., and McConnell, S.K. (1998). Intrinsic polarity of mammalian neuroepithelial cells. Mol. Cell Neurosci. 11, 183193.[CrossRef][Medline]
Conlon, R.A., Reaume, A.G., and Rossant, J. (1995). Notch1 is required for the coordinate segmentation of somites. Development 121, 15331545.[Abstract]
Cooper, M.S., and Kimmel, C.B. (1998). Morphogenetic cell behaviors and specification of cell fate during early teleost development, in Motion Analysis of Living Cells, ed. D.R. Soll and D. Wessels, New York: Wiley-Liss, 177220.
Delarue, M., Saez, F.J., Boucaut, J.-C., Thiery, J.-P., and Broders, F. (1998). Medial cell mixing during axial morphogenesis of the amphibian embryo requires cadherin function. Dev. Dyn. 213, 248260.[CrossRef][Medline]
Duband, J.L., Dufour, S., Hatta, K., Takeichi, M., Edelman, G.M.,
and Thiery, J.P. (1987). Adhesion molecules during somitogenesis
in the avian embryo. J. Cell Biol.
104,
1361174.
Furuta, Y., Ilic, D., Kanazawa, S., Takeda, N., Yamamoto, T., and Aizawa, S. (1995). Mesodermal defect in late phase of gastrulation by a targeted mutation of focal adhesion kinase, FAK. Oncogene 11, 19891995.[Medline]
Garcia-Alvarez, B., de Pereda, J.M., Calderwood, D.A., Ulmer, T.S., Critchley, D., Campbell, I.D., Ginsberg, M.H., and Liddington, R.C. (2003). Structural determinants of integrin recognition by talin. Mol. Cell. 11, 4958.[CrossRef][Medline]
Georges-Labouesse, E.N., George, E.L., Rayburn, H., and Hynes, R.O. (1996). Mesodermal development in mouse embryos mutant for fibronectin. Dev. Dyn. 207, 145156.[CrossRef][Medline]
Ghanem, E. (1996). Immunohistochemical localization of type I and II collagens in the involuting chick notochords in vivo and in vitro. Cell Biol. Int. 20, 681685.[CrossRef][Medline]
Gumbiner, B.M. (2000). Regulation of cadherin adhesive
activity. J. Cell Biol. 148,
399403.
Hagel, M., George, E.L., Kim, A., Tamimi, R., Opitz, S.L., Turner,
C.E., Imamoto, A., and Thomas, S.M. (2002). The adapter protein
paxillin is essential for normal development in the mouse and is a critical
transducer of fibronectin signaling. Mol. Cell. Biol.
22,
901915.
Hanks, S.K., and Polte, T.R. (1997). Signaling through focal adhesion kinase. Bioessays 19, 137145.[CrossRef][Medline]
Henry, C.A., Hall, L.A., Hille, M.B., Solnica-Krezel, L., and Cooper, M.S. (2000). Somites in zebrafish doubly mutant for knypek and trilobite from without internal mesenchymal cells or compaction. Curr. Biol. 10, 10631066.[CrossRef][Medline]
Henry, C.A., Crawford, B.D., Yan, Y.L., Postlethwait, J., Cooper, M.S., and Hille, M.B. (2001). Roles for zebrafish focal adhesion kinase in notochord and somite morphogenesis. Dev. Biol. 240, 474487.[CrossRef][Medline]
Henry, C.A., et al. (2002). Two linked
hairy/Enhancer of split-related Zebrafish genes, her1 and her7, function
together to refine alternating somite boundaries. Development
129,
36933704.
Hens, M.D., and DeSimone, D.W. (1995). Molecular analysis and developmental expression of the focal adhesion kinase pp125FAK in Xenopus laevis. Dev. Biol. 170, 274288.[CrossRef][Medline]
Holley, S.A., Jülich, D., Rauch, G.-J., Geisler, R., and
Nüsslein-Volhard, C. (2002). her1 and the notch pathway
function within the oscillator mechanism that regulates zebrafish
somitogenesis. Development 129,
11751183.
Jamora, C., and Fuchs, E. (2002). Intercellular adhesion, signalling and the cytoskeleton. Nat. Cell Biol. 4, 101108.
Kane, D.A., Warga, R.M., and Kimmel, C.B. (1992). Mitotic domains in the early embryo of the zebrafish. Nature 360, 735737.[CrossRef][Medline]
Keller, R., Cooper, M.S., Danilchik, M., Tibbetts, P., and Wilson, P.A. (1989). Cell intercalation during notochord development in Xenopus laevis. J. Exp. Zool. 251, 134154.[CrossRef][Medline]
Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., and Schilling, T.F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253310.[Medline]
Krotoski, D., and Bronner-Fraser, M. (1990). Distribution of integrins and their ligands in the trunk of Xenopus laevis during neural crest cell migration. J. Exp. Zool. 253, 139150.[CrossRef][Medline]
Lee, C.-H., and Gumbiner, B.M. (1995). Disruption of gastrulation movements in Xenopus by a dominant-negative mutant for C-cadherin. Dev. Biol. 171, 363373.[CrossRef][Medline]
Lele, Z., Folchert, A., Concha, M., Rauch, G.J., Geisler, R., Rosa, F., Wilson, S.W., Hammerschmidt, M., and Bally-Cuif, L. (2002). Parachute/N-cadherin is required for morphogenesis and maintained integrity of the zebrafish neural tube. Development 129, 32813294.
Lele, Z., and Krone, P.H. (1997). Expression of genes encoding the collagen-binding heat shock protein (Hsp47) and type II collage in developing zebrafish embryos. Mech. Dev. 61, 8998.[CrossRef][Medline]
Levine, E., Lee, C.H., Kintner, C., and Gumbiner, B.M. (1994). Selective disruption of E-cadherin function in early Xenopus embryos by a dominant negative mutant. Development 120, 901909.[Abstract]
Liddington, R.C., Bankston, L.A., and de Pereda, J.M. (2003). Cell adhesion: a FERM grasp of membrane dynamics. Curr. Biol. 13, R94R95.[CrossRef][Medline]
Linask, K.K., Ludwig, C., Han, M.D., Liu, X., Radice, G.L., and Knudsen, K.A. (1998). N-Cadherin/catenin-mediated morphoregulation of somite formation. Dev. Biol. 202, 85102.[CrossRef][Medline]
McLean, G.W., Fincham, V.J., and Frame, M.C. (2000).
v-Src induces tyrosine phosphorylation of focal adhesion kinase independently
of tyrosine 397 and formation of a complex with Src. J. Biol.
Chem. 275,
2333323339.
Ogawa, M., Hiraoka, Y., Taniguchi, K., Sakai, Y., and Aiso, S. (2001). mRNA sequence of the Xenopus laevis paxillin gene and its expression. Biochim. Biophys. Acta 1519, 235240.[Medline]
Parsons, M.J., Pollard, S.M., Saúde, L., Feldman, B.,
Coutinho, P., Hirst, E.M.A., and Stemple, D.L. (2002). Zebrafish
mutants identify an essential role for laminins in notochord formation.
Development 129,
31373146.
Polte, T.R., Naftilan, A.J., and Hanks, S.K. (1994). Focal adhesion kinase is abundant in developing blood vessels and elevation of its phosphotyrosine content in vascular smooth muscle cells is a rapid response to angiotensin II. J. Cell. Biochem. 55, 106119.[CrossRef][Medline]
Radice, G.L., Rayburn, H., Matsunami, H., Knudsen, K.A., Takeichi, M., and Hynes, R.O. (1997). Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol. 181, 6478.[CrossRef][Medline]
Rongish, B.J., and Kinsey, W.H. (2000). Transient nuclear localization of Fyn kinase during development in zebrafish. Anat. Rec. 260, 115123.[CrossRef][Medline]
Roy, S., Ruest, P.J., and Hanks, S.K. (2002). Fak regulates tyrosine phosphorylation of CAS, paxillin, and PYK2 in cells expressing v-Src, but is not a critical determinant of v-Src transformation. J. Cell. Biochem. 84, 377388.[CrossRef][Medline]
Schlaepfer, D.D., and Hunter, T. (1998). Integrin signaling and tyrosine phosphorylation: just the FAKs? Trends Cell Biol. 8, 151157.[CrossRef][Medline]
Schwartz, M.A. (2001). Integrin signaling revisited. Trends Cell Biol. 11, 466470.[CrossRef][Medline]
Sugrue, S.P., and Zieske, J.D. (1997). ZO1 in corneal epithelium: association to the zonula occludens and adherens junctions. Exp. Eye Res. 64, 1120.[CrossRef][Medline]
Stemple, D.L. (1996). Mutations affecting development of the notochord in zebrafish. Development 123, 117128.[Abstract]
Tsai, W., and Kinsey, W.H. (2002). Role of c-Yes kinase during gastrulation of the zebrafish embryos. Mol. Biol. Cell 13, 117a.
Tong, X., Salgia, R., Li, J.-L., Griffin, J.D., and Howley, P.M.
(1997). The bovine papillomavirus E6 protein binds to the LD
motif repeats of paxillin and blocks its interaction with vinculin and the
focal adhesion kinase. J. Biol. Chem.
272,
3337333376.
Turner, C.E. (1991). Paxillin is a major
phosphotyrosine-containing protein during embryonic development. J.
Cell Biol. 115,
201207.
Turner, C.E. (2000a). Paxillin and focal adhesion signalling. Nat. Cell Biol. 2, E231E236.[CrossRef][Medline]
Turner, C.E. (2000b). Paxillin interactions. J.
Cell Sci. 113,
41394140.
West, K.A., Zhang, H., Brown, M.C., Nikolopoulos, S.N., Riedy,
M.C., Horwitz, A.F., and Turner, C.E. (2001). The LD4 motif of
paxillin regulates cell spreading and motility through an interaction with
paxillin kinase linker (PKL). J. Cell Biol.
154,
161176.
Westerfield, M. (1995). The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio). Eugene, OR: University of Oregon Press.
Winklbauer, R., and Keller, R.E. (1996). Fibronectin, mesodermal migration and gastrulation. Dev. Biol. 177, 413426.[CrossRef][Medline]
Winklbauer, R., Nagel, M., Selchow, A., and Wacker, S. (1996). Mesoderm migration in the Xenopus gastrula. Int. J. Dev. Biol. 40, 305311.[Medline]
Wood, A., and Thorogood, P. (1994). Patterns of cell behaviour underlying somitogenesis and notochord formation in intact vertebrate embryos. Dev. Dyn. 201, 151167.[Medline]
Yan, Y.L., Hatta, K., Riggleman, B., and Postlethwait, J.H. (1995). Expression of a type II collagen gene in the zebrafish embryonic axis. Dev. Dyn. 203, 363376.[Medline]
Yang, J.T., Bader, B.L., Kreidberg, J.A., Ullman-Cullere, M., Trevithick, J.E., and Hynes, R.O. (1999). Overlapping and independent functions of fibronectin receptor integrins in early mesodermal development. Dev. Biol. 215, 264277.[CrossRef][Medline]
Zalik, S.E., Lewandowski, E., Kam, Z., and Geiger, B. (1999). Cell adhesion and the actin cytoskeleton of the enveloping layer in the zebrafish embryo during epiboly. Biochem. Cell Biol. 77, 527542.[CrossRef][Medline]
Zhu, Y., McAlinden, A., and Sandell, L.J. (2001). Type IIA procollagen in development of the human intervertebral disc: regulated expression of the NH(2)-propeptide by enzymic processing reveals a unique developmental pathway. Dev. Dyn. 220, 350362.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
D. Julich, A. P. Mould, E. Koper, and S. A. Holley Control of extracellular matrix assembly along tissue boundaries via Integrin and Eph/Ephrin signaling Development, September 1, 2009; 136(17): 2913 - 2921. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Marshall, K. D. Watters, L. R. Hovdestad, R. R. F. Cozzi, and F. Katoh CFTR Cl- channel functional regulation by phosphorylation of focal adhesion kinase at tyrosine 407 in osmosensitive ion transporting mitochondria rich cells of euryhaline killifish J. Exp. Biol., August 1, 2009; 212(15): 2365 - 2377. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. O. Deakin and C. E. Turner Paxillin comes of age J. Cell Sci., August 1, 2008; 121(15): 2435 - 2444. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lemeer, R. Ruijtenbeek, M. W. H. Pinkse, C. Jopling, A. J. R. Heck, J. den Hertog, and M. Slijper Endogenous Phosphotyrosine Signaling in Zebrafish Embryos Mol. Cell. Proteomics, December 1, 2007; 6(12): 2088 - 2099. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Mathias, M. E. Dodd, K. B. Walters, J. Rhodes, J. P. Kanki, A. T. Look, and A. Huttenlocher Live imaging of chronic inflammation caused by mutation of zebrafish Hai1 J. Cell Sci., October 1, 2007; 120(19): 3372 - 3383. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kato, K. Nakamura, H. Kudo, Y. H. Tran, Y. Yamamoto, H. Doi, and S. Hirose Characterization of the Column and Autocellular Junctions That Define the Vasculature of Gill Lamellae J. Histochem. Cytochem., September 1, 2007; 55(9): 941 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Miyasaka, Y. S. Kida, T. Sato, M. Minami, and T. Ogura Csrp1 regulates dynamic cell movements of the mesendoderm and cardiac mesoderm through interactions with Dishevelled and Diversin PNAS, July 3, 2007; 104(27): 11274 - 11279. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Franco, B. Ho, D. Mulholland, G. Hou, M. Islam, K. Donaldson, and M. P. Bendeck Doxycycline Alters Vascular Smooth Muscle Cell Adhesion, Migration, and Reorganization of Fibrillar Collagen Matrices Am. J. Pathol., May 1, 2006; 168(5): 1697 - 1709. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Kragtorp and J. R. Miller Regulation of somitogenesis by Ena/VASP proteins and FAK during Xenopus development Development, February 15, 2006; 133(4): 685 - 695. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lin, D. S. Sepich, S. Chen, J. Topczewski, C. Yin, L. Solnica-Krezel, and H. Hamm Essential roles of G{alpha}12/13 signaling in distinct cell behaviors driving zebrafish convergence and extension gastrulation movements J. Cell Biol., June 6, 2005; 169(5): 777 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Brown and C. E. Turner Paxillin: Adapting to Change Physiol Rev, October 1, 2004; 84(4): 1315 - 1339. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yano, Y. Mazaki, K. Kurokawa, S. K. Hanks, M. Matsuda, and H. Sabe Roles played by a subset of integrin signaling molecules in cadherin-based cell-cell adhesion J. Cell Biol., July 19, 2004; 166(2): 283 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bakkers, C. Kramer, J. Pothof, N. E. M. Quaedvlieg, H. P. Spaink, and M. Hammerschmidt Has2 is required upstream of Rac1 to govern dorsal migration of lateral cells during zebrafish gastrulation Development, February 1, 2004; 131(3): 525 - 537. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||