|
|
|
|
Vol. 14, Issue 8, 3097-3113, August 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



* Friedrich Miescher Laboratorium der Max Planck Gesellschaft, D-72076
Tübingen, Germany;
Institut für Physiologische Chemie, Universität München, 81377
München, Germany;
Institut für Immunologie, Universität Tübingen, D-72076
Tübingen, Germany; and
Max Planck Institut für Entwicklungsbiologie, D-72076 Tübingen,
Germany
Submitted November 16, 2002;
Revised March 23, 2003;
Accepted April 11, 2003
Monitoring Editor: Vivek Malhotra
| ABSTRACT |
|---|
|
|
|---|
-COP) mutants rapidly blocks transport of certain
proteins along the early secretory pathway. We have identified the integral
membrane protein Mst27p as a strong suppressor of sec21-3 and
ret1-1 mutants. A C-terminal KKXX motif of Mst27p that allows direct
binding to the COPI complex is crucial for its suppression ability. Mst27p and
its homolog Yar033w (Mst28p) are part of the same complex. Both proteins
contain cytoplasmic exposed C termini that have the ability to interact
directly with COPI and COPII coat complexes. Site-specific mutations of the
COPI binding domain abolished suppression of the sec21 mutants. Our
results indicate that overexpression of MST27 provides an increased
number of coat binding sites on membranes of the early secretory pathway and
thereby promotes vesicle formation. As a consequence, the amount of cargo that
can bind COPI might be important for the regulation of the vesicle flow in the
early secretory pathway. | INTRODUCTION |
|---|
|
|
|---|
In this article, we identified a novel class of membrane proteins that suppresses specific mutants of the COPI coat upon overexpression. These suppressor proteins bind directly COPI coat complexes via a C-terminal KKXX motif and interact with COPII proteins via an unspecified sequence. Other members of this protein family contain a characteristic diphenylalanine motif, which mediates interaction with COPII components. However, these proteins are unable to suppress coatomer mutants. The KKXX motifcontaining proteins seem to shuttle between the ER and the Golgi. Overexpression of two family members leads to greatly enlarged vacuoles in large cells. However, the overexpressed proteins remain in the ER. The presence of the KKXX motif is essential for suppression of coatomer mutants, and our results suggest that the increase of COPI binding sites in the ER overcomes the defects in COPI mutants by a stimulation of the vesicular transport. From this, we propose that the vesicle flow between membranes of the early secretory pathway is regulated by the abundance of cargo proteins.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Sec21-3 Suppressor Screen
The strain sec21-3 was provided from E. Gaynor and S. Emr
(University of California, San Diego, CA) and transformed with an YEp24
(URA3, 2 µ)-based yeast library
(Carlson and Botstein, 1982
).
Transformants (40,000) were grown at 25°C, replica plated, and screened
for growth at 37°C. From growing colonies, plasmids were isolated and
retransformed into the sec21-3 mutant. From transformants that
remained temperature-resistant, plasmid DNA was isolated and sequenced. The
insert of the suppressing plasmid
1-25 contained a piece of chromosome
VII from base pairs 399250406876 (according to Stanford Genome
Database). For subcloning, the
1-25 plasmid was digested with
EcoRV and the resulting fragments cloned into the BamHI site
of YEp24. The plasmid containing the 3-kb EcoRV insert represented
the suppressing sequence. Sequences derived from open reading frames (ORFs)
YGL051w, YGL052w, and YGL053w were synthesized by polymerase chain reaction
(PCR) by using the primer pairs HH92
(GGGGGATCCCCTCATCTGTTCTCGTACTTTGTTG)/HH93(GGGGGATCCCGGGCCAGTTAGTGCTGATTA),
HH10 (GGGGAATTCATGCAGTTGCCCCAAAAACAC)/HH11 (GGGGGATCCCTAGGTTCGTTGAGTGTATCT),
or HH102 (GGGGGGATCCGTGTGCTAGTGTCTCCCG)/HH103 (GGGGGGATCCTGAGGATTCCTATATCCT),
respectively, cloned into the BamHI site of YEp24, and sequenced.
Thereby the ORF YGL051w (MST27) was identified as suppressing
gene.
Plasmid and Strain Construction
For gene disruption, a HIS3-containing cassette was amplified by
PCR and chromosomal sequences were replaced by homologous recombination using
the strains YPH499 and YPH500. All deletions were verified by PCR with primers
inside and outside of the inserted sequences.
mst27+
mst28 and
prm8+
prm9 deletions were combined by mating
and sporulation of the single mutants.
For the expression of myc-tagged versions of Mst27p and Prm8p, a PCR
strategy was used that led to a chromosomal insertion of the GAL10
promoter followed by three myc-epitopes in front of the ORFs
(Lafontaine and Tollervey,
1996
). To express GST-Mst27p, GST-Mst27_AAXXp, and GST-Prm8p in
E. coli, we used sequences encoding the cytoplasmic domains of Mst27p
and Prm8p amplified by PCR with the primer pairs HH100
(GGGGAGATCTGGTGATGGTAATCCAAAG)/HH93 (GGGGGATCCCGGGCCAGTTAGTGCTGATTA),
HH100/HH115 (GGGGGATCCTATTCCGTCGCCGCAAGAAGCGCATCGAT), and HH101
(GGGGAGATCTAGGTTTGGACCACAGATC)/HH102 (GGGGGGATCCGTGTGCTAGTGTCTCCCG),
respectively. The PCR products were digested with BglII and
BamHI and cloned into BamHI cut pETGEXCT
(Sharrocks, 1994
). For
expression of Mst28p, a sequence encoding for the cytoplasmic domain was
amplified by PCR from the
mst27-strain with primers TS045
(CGCGGATCCCTACGCCTTGTTGAGGGAG) and TS021 (CCGGAATTCCGGGCCAGTTAGTGCTGATTA), and
after digestion with BamHI and EcoRI cloned into vector
pGEX-6p (Amersham Biosciences, Freiburg, Germany).
The Emp24p overexpression plasmid was provided by A. Rowley (Glaxo Wellcome
Foundation, Stevenage, United Kingdom) and contained the EMP24
encoding sequence in a pRS426GAL multicopy expression vector
(Sikorski and Hieter, 1989
).
The plasmids for overexpression of Wbp1p and the invertase-Wbp1 fusion were
described previously (Gaynor et
al., 1994
). The 2 µ plasmid containing a N-terminally
myc-tagged Sec20 was provided by H. Pelham (MRC Cambridge, Cambridge, United
Kingdom)
To generate plasmid pESC-MST27, the MST27 coding sequence was amplified by PCR with primers TS013 (GCGAAGATCTTCATGCAGACCCCTCTAGAA) and TS014 (CGTGCGAGCTCCTATTCCGTCTTTTTAAGAAGC), digested with restriction enzymes BglII and SacI, and cloned into vector pESC-Trp (Invitrogen, Carlsbad, CA).
Pulse-Chase Analysis
Radiolabeling and lysis of cells and immunoprecipitations were essentially
performed as described previously
(Hosobuchi et al.,
1992
), except that for radiolabeling cells were grown in YPD or
selective minimal medium overnight to an OD600 of 0.20.5,
harvested, washed, and resuspended to an OD600 of 5 in sulfate-free
minimum medium containing all amino acids without methionine and cysteine.
After a preincubation of 5 min, 20 µCi per OD600 unit of
tran35S-label (ICN Pharmaceuticals, Costa Mesa, CA) was added.
After 3 min, labeling was terminated by addition of methionine and cysteine to
10 mM final concentration. Chase time point aliquots (0.5 OD600)
were removed as indicated, cells were lysed, and cell lysates used for
immunoprecipitation as described. The antisera used had been described
previously (Evan et al.,
1985
; Kuehn et al.,
1998
).
Protein-binding Assay
Glutathione S-transferase (GST)-fusion proteins were purified
essentially as described previously
(Frangioni and Neel, 1993
).
Fresh overnight E. coli cultures were diluted 100-fold and grown to
an OD600 of 0.5. Isopropyl
-D-thiogalactoside was
added to 0.4 µM final concentration, and cells were incubated at 25°C
for 3 h. Cells were harvested, resuspended in lysis buffer to 50
OD600/ml (1 M NaCl, 10 mM EDTA, 5 mM dithiothreitol [DTT], 0.2%
laurylsarcosyl, 100 mM Tris-HCl, pH 8.0), and lysed by freeze thawing. The
extract was cleared by centrifugation for 5 min at 15,000 x g,
adjusted to pH 6.8 and 2% Triton X-100, and incubated with glutathione agarose
for 1 h at 20°C. The beads were washed five times in 1 M NaCl, 10 mM EDTA,
5 mM DTT, 2% Triton X-100, 100 mM Tris-HCl, pH 6.8, and once in binding buffer
[150 mM KOAc, 5 mM Mg(OAc)2, 1 mM EDTA, 1 mM DTT, 0.1% Triton
X-100, 2% glycerol, 20 mM HEPES, pH 6.8], followed by an incubation in binding
buffer in the presence of either 1.25 or 2.5 mg/ml crude yeast cytosol
(Rexach et al., 1994
)
or 25 µg/ml Sec23/Sec24p complex
(Barlowe et al., 1994
)
(with or without 20 µg/ml Sar1p) for 1 h at 20°C. The beads were washed
five times in binding buffer and bound proteins were resolved by SDS-PAGE.
Gel Filtration
Yeast cells were converted to spheroplasts as described previously
(Rexach et al., 1994
)
and lysed in 4% octyl glucoside, 100 mM NaCl, 10% glycerol, 2 mM
phenylmethylsulfonyl fluoride (PMSF), 20 mM HEPES, pH 7.5, at a protein
concentration of 5 mg/ml. The extract was cleared by centrifugation (100,000
x g, 30 min, 4°C), and 200 µl of the resulting
supernatant was applied onto a Superose 6 HR 10/30 gel filtration column
(Amersham Biosciences). The run was performed in 1% octyl glucoside, 100 mM
NaCl, 10% glycerol, 20 mM HEPES, pH 7.5, at a flow rate of 0.25 ml/min, and
500-µl fractions were collected. The fractionation was calibrated by
immunoblotting against protein complexes of known size and by a parallel run
of molecular weight markers (Amersham Biosciences).
Coimmunoprecipitation
9E10 anti-myc antibody (Roche Diagnostics, Mannheim, Germany) was
immobilized on 20% protein A-Sepharose (1.6 µg of antibody + 200 µl of
protein A-Sepharose for SDS-PAGE analysis and matrix-assisted laser desorption
ionization (MALDI)-identification, 0.8 µg of antibody + 50 µl of protein
A-Sepharose for Western blot analysis) at 4°C for 1 h. Yeast cells were
converted into spheroblasts and lysed by rotating in 4% octyl glucoside, 100
mM NaCl, 10% glycerol, 2 mM PMSF, 20 mM HEPES, pH 7.5 (24 ml/2 ml) at 4°C
for 15°C. The lysate was diluted twofold with 100 mM NaCl, 10% glycerol, 2
mM PMSF, 20 mM HEPES, pH 7.5; cellular debris was removed by centrifugation
(30 min, 100,000 x g, 4°C); and the supernatant was
precleared with 20% protein A-Sepharose at 4°C for 45 min. The fusion
proteins were precipitated at 4°C for 3 h, washed five times with 0.5%
octyl glucoside, 100 mM NaCl, 10% glycerol, 2 mM PMSF, 20 mM HEPES, pH 7.5,
and eluted either by boiling the beads in 30 µl of nonreducing SDS-loading
buffer for SDS-PAGE and MALDI-identification or by incubation with 1 mg/ml
myc-peptide in 30 µl of wash buffer at 30°C for 30 min for immunoblot
analysis.
Protein Identification with Mass Spectrometry
In gel tryptic digestions were performed as described previously
(Shevchenko et al.,
1996
) and modified as outlined below. Briefly, protein bands were
excised from gels, fully destained, and digested for 3 h with porcine trypsin
(sequencing grade, modified; Promega, Madison, WI) at a concentration of 67
ng/µl in 25 mM ammonium bicarbonate, pH 8.1, at 37°C. Before peptide
mass mapping and sequencing of tryptic fragments by tandem mass spectrometry,
peptide mixtures were extracted from gels by 1% formic acid followed by two
changes of 50% acetonitrile. The combined extracts were vacuum-dried until
only 12 µl was left, and the peptides were purified by ZipTip
according to the manufacturer's instructions (Millipore, Bedford, MA).
MALDI-time of flight (TOF) analysis from the matrix
-cyano-4-hydroxycinnamic acid/nitrocellulose prepared on the target by
using the fast evaporation method (Arnott
et al., 1998
) was performed on a Bruker Reflex III
(Bruker Daltonik, Bremen, Germany) equipped with a N2 337-nm laser
and gridless pulsed ion extraction.
Sequence verifications of some fragments were performed by nanoelectrospray
tandem mass spectrometry on either a Q-Tof I mass spectrometer (Micromass,
Manchester, England) or a QStar Pulsar i Qqoa Tof mass spectrometer (Applied
Biosystems-MDS Sciex, Weiterstadt, Germany) equipped with a nanoflow
electrospray ionization source. Gold-coated glass capillary nanoflow needles
were obtained from Protana (Odense, Denmark) (type medium NanoES spray
capillaries). Database searches (NCBInr, nonredundant protein database) were
done using the MASCOT software (Perkins
et al., 1999
).
Immunofluorescence
Cells were grown to early log phase in rich medium supplemented either with
2% dextrose or 2% galactose for induction of the GAL10 promoter. To
observe the effects of glucose repression, expression of the respective fusion
protein was induced overnight in YP with 2% galactose and afterward repressed
by transferring the cells into YP with 2% glucose. Alternatively, protein
synthesis was inhibited by addition of rapamycin (Alexis, Grünberg,
Germany) to a final concentration of 100 ng/ml. Aliquots were taken at
different time points and analyzed by immunofluorescence as described
previously (Chuang and Schekman,
1996
) by using monoclonal 9E10 anti-myc (Roche Diagnostics) or M2
anti-FLAG-antibodies (Sigma, Taufkirchen, Germany). The secondary antibodies
were obtained from Jackson Immunoresearch Laboratories (West Grove, PA).
Electron Microscopy
Yeast cells were cryoimmobilized by high-pressure freezing according to
Hohenberg et al.
(1994
). In brief, living
specimens were sucked into cellulose microcapillaries of 200 µm diameter,
and 2-mm-long capillary tube segments were transferred to aluminum platelets
of 200-µm depth containing 1-hexadecene. The platelets were sandwiched with
platelets without any cavity and then frozen with a high-pressure freezer
(Bal-Tec HPM 010; Balzers, Liechtenstein). The frozen capillary tubes were
freed from extraneous hexadecene under liquid nitrogen and transferred to 2-ml
microtubes with screw caps containing the substitution medium precooled to
90°C. Samples were kept in 2% osmium tetroxide in anhydrous acetone
at 90°C for 32 h, at 60°C and 30°C for 4 h at
each step in a freeze-substitution unit (Balzers FSU 010, Bal-Tec; Balzers).
After washing with acetone, the samples were transferred into an acetone-Epon
mixture at 30°C, infiltrated at room temperature in Epon, and
polymerized at 60°C for 48 h. Ultrathin sections stained with uranyl
acetate and lead citrate were viewed in a Philips CM10 electron microscope at
60 kV.
Membrane Flotations
Cells were grown to early to mid-log phase under permissive conditions.
Golgi membranes, coatomer, and Arf1p were prepared according to Spang and
Schekman (1998
), Hosobuchi
et al. (1992
), and
Kahn et al. (1995
),
respectively. The Golgi membranes were incubated with 10 µg/ml coatomer, 2
µg/ml Arf1p, and 0.1 mM guanosine 5'-O-(3-thio)triphosphate
(GTP
S) for 30 min at 30°C in 100 µl of 0.9 M sucrose in B88 [20
mM HEPES, pH 6.8, 150 mM KOAc, 250 mM sorbitol, 5 mM Mg(OAc)2]. The
reactions were overlaid with 75 µl of 0.75 M sucrose in B88 and 10 µl of
B88. Membranes were floated in a TLA 100 rotor (90 min, 100,000 rpm, 2°C).
The top 25 µl was harvested and analyzed by SDS-PAGE and immunoblot.
Budding Assay
Perforated yeast spheroplasts (semi-intact cells) and yeast cytosol were
prepared as described by Rexach et al.
(1994
) and Spang and Schekman
(1998
). Semi-intact cells were
incubated with either 25 µg/ml Sar1p, 25 µg/ml Sec23/24p, and 75
µg/ml Sec13/31p (COPII), 25 µg/ml coatomer and 3 µg/ml Arf1p (COPI),
or 2 mg/ml cytosol for 30 min at 30°C in the presence of 50 µM GTP and
an ATP regeneration system (Baker et
al., 1988
). The reaction mixture was chilled for 5 min on
ice, and subjected to a medium-speed centrifugation (12,000 x
g, 30 s, 4°C), which retained the vesicles in the supernatant
fraction. The vesicles were sedimented by a centrifugation in a TLA 45 rotor
(30 min, 45,000 rpm, 2°C). The pellet was resuspended in sample buffer and
analyzed by SDS-PAGE followed by immunoblot.
| RESULTS |
|---|
|
|
|---|
-subunit of coatomer. The screen should
allow the identification of regulators of COPI vesicle budding as well as
cargo that binds directly to coatomer. The sec21-3 allele was chosen
because it exhibits an immediate and complete block of transport from the
Golgi at the nonpermissive temperature, and a cargo-specific block of
anterograde transport (Gaynor and Emr,
1997
1-25. The
1-25 plasmid did not allow the
loss of the sec21-3 gene containing plasmid in a background where the
chromosomal SEC21 was deleted. Thus, this suppressing plasmid did not
encode a protein that bypassed the need for Sec21p function.
1-25 contained the five ORFs YGL050w to YGL054c. Two of these,
YGL051w and YGL053w, are closely related to each other. Subcloning revealed
YGL051w as the suppressing gene (Figure
1A). The plasmid containing only the YGL051w gene completely
suppressed the sec21-3 phenotype and allowed nearly wild-type growth
at 37°C (Figure 1A). We
named YGL051w MST27 (multicopy suppressor of sec
twenty one of 27 kDa).
|
To test whether other mutants defective in essential transport proteins in
the early secretory pathway were suppressed by MST27, we transformed
the
1-25 plasmid into various mutants. Several different
temperature-sensitive sec21 strains were partially or completely
suppressed (Figure 1B). In
contrast,
1-25 had no effect on the temperature sensitivity of the
sec21-1 mutant, which might be due to the strong anterograde
transport defect observed in this mutant allele. In addition, the
-COP
mutant sec33-1 was suppressed by
1-25 at a moderate
temperature (Figure 1B). The
mutants sec27-1 (
'-COP), sec12-1, sec23-3,
sec22-2, and bet1-1 were not suppressed by
1-25. Sec12p
and Sec23p are the nucleotide exchange factor and the GTPase-activating
protein for Sar1p, the small GTPase involved in COPII vesicle formation,
respectively. Sec22p and Bet1p are v-SNAREs in the ER-Golgi shuttle. Thus,
MST27 represents a novel gene, which specifically suppresses the
growth defects of certain COPI mutants.
Mst27p Belongs to a Large Family of Membrane Proteins
Mst27p belongs to one of the most curious gene families in yeast
(Goffeau et al.,
1996
; Feuermann et
al., 1997
): the Ycr7 family comprises 16 members on six
chromosomes. Some of them are scattered singly, such as YCR007c on chromosome
III, but most are clustered and some even form long arrays (YHL042c through
YHL046c or YAR023c through YAR033w). All these genes encode proteins with one
or two membrane spanning domains, but nothing is known about their function.
As mentioned above,
1-25 contained the genes of two members of this
family: MST27 (YGL051w) and YGL053w, which is identical to
PRM8 (Heiman and Walter,
2000
). MST27 overlaps with the predicted ORF YGL052w,
which is probably not a functional gene (Zhang and Smith, in
http://bmerc-www.bu.edu/genome/yeast-analysis.html).
Thus, MST27 and PRM8 are directly adjacent genes. The ORFs
YAR033w (MST28) and YAR031w (PRM9) are highly homologous to
MST27 and PRM8, respectively
(Figure 2, A and B). The
predicted proteins Mst27p and Mst28p differ in only six amino acid residues.
Because the noncoding region is also very highly conserved, the chromosomal
region seemed to be subject to gene duplication
(Figure 2B;
Sonnhammer et al.,
1998
). MST27and MST28 as well as PRM8
encode proteins of 27 kDa that contain two predicted transmembrane domains
separated by approximately six amino acids
(Figure 2C). Prm9p contains an
N-terminal extension, resulting in apparent molecular mass of
34 kDa.
According to a topology prediction
(Hartmann et al.,
1989
), the N- and C-terminal tails face the cytoplasm. Both
proteins contain C-terminal domains, which show a high probability to form
coiled-coil domains (Lupas et
al., 1991
). Prm8p and Prm9p were identified as membrane
proteins that are up-regulated in response to mating factor
(Heiman and Walter, 2000
).
Mst27p and Mst28p expression was not significantly altered under these
conditions. Neither MST27 and MST28 nor PRM8 and
PRM9 are essential. Even the double deletions of
mst27
mst28 and
prm8
prm9 did not show any altered growth
phenotype under standard growth conditions. The lack of an obvious phenotype
for the
mst27
mst28 deletion might not be very
surprising because the expression of MST27 and MST28 is
down-regulated upon domestication of Saccharomyces cerevisiae
(Kuthan et al.,
2003
). The amount and structure of the extracellular matrix seem
to change upon domestication. Interestingly, the four proteins contain typical
coat binding motifs at their very C-terminus: Mst27p and Mst28p carry a KKXX
motif, suggesting an interaction with the COPI coat; Prm8p and Prm9p contain a
FF-sequence, a motif that was shown to allow COPII binding
(Fiedler and Rothman, 1997
;
Kappeler et al.,
1997
).
|
Mst27p, Mst28p, Prm8p, and Prm9p Form Two Distinct Complexes
Given the COPI binding motifs of Mst27p and Mst28p and the COPII
interacting sequences of Prm8p and Prm9, we were wondering whether these
proteins could form heteromeric complexes similar to the p24 family of
proteins (Marzioch et al.,
1999
). We solubilized yeast membranes with octylglucoside and
performed gel filtration experiments with the detergent extracts. The
fractions of the column were analyzed by immunoblot. Because we could not
detect any endogenous Mst27p or Prm8p with antibodies raised against specific
peptide sequences of Mst27p and Prm8p, we overexpressed Mst27p or Prm8p under
the inducible GAL10 promotor before the fractionation on the gel
filtration column. Because we used a chromosomal tagging procedure, the
expression of Mst27p or Prm8p was dependent on the addition of galactose.
Under these conditions, Mst27p eluted from the column exclusively at
300
kDa, indicating that Mst27p formed a complex
(Figure 3A). We never found any
Mst27p signal at around 27 kDa, which would correspond to monomeric Mst27p.
Although molecular weight determinations by gel filtration of membrane
proteins in detergent solutions are misleading, we took the big discrepancy
between the observed and predicted molecular weight as an indication that
Mst27p might be part of a complex. To determine the composition of the
potential Mst27p complex, we performed large-scale native immunoprecipitations
by using a strain carrying a myc-tagged Mst27p under GAL promotor
control. The precipitate was separated by SDS-PAGE
(Figure 3B). Coomassie
Blue-stained bands were excised, digested with trypsin, and subjected to mass
spectrometric analysis. Four prominent bands were observed at a mass of
27 and 34 kDa (Figure 3B),
all of which corresponded to either Mst27p or Mst28p. The identification was
unambiguously possible because Mst27p contained a myc-tag and thus possessed a
slower electrophoretic mobility than Mst28p. Other proteins in the
immunoprecipitates were present in much lower amounts than the Mst proteins
and might represent contaminations. These results indicate that Mst27p and
Mst28p form a complex and that both are at least in part posttranslationally
modified. The nature of the modification remains unclear, because we could
detect neither ubiquitination nor glycosylation by using different antibodies
directed against ubiquitin and a glycosylation detection kit (our unpublished
data). The endogenous levels of Mst27p and Mst28p were not detectable.
Remarkably, after overexpression of Mst27p, Mst28p was also present in the
cell in a higher concentration. Thus, it seems likely that Mst27p and Mst28p
form a heteromeric complex and that Mst28p could be stabilized by Mst27p and
vice versa. Similar effects have been observed for the p24 family of proteins.
The levels of Erp1p and Erv25p are reduced upon deletion of EMP24 and
Erv25p requires Emp24p for its stability
(Belden and Barlowe, 1996
;
Marzioch et al.,
1999
).
|
Similar to the Mst27/28p complex Prm8p was part of a complex, though of a different molecular weight. Mass spectrometric analysis of the most prominent bands of this complex revealed Prm8p and Prm9p as major components, indicating a reciprocal stabilization also for these related proteins (Figure 3). We could not detect any Prm8p or Prm9p in the Mst27/28p complex and vice versa. However, upon co-overexpression we observed minor amounts of Mst27p in a co-immunoprecipitation with Prm8p, indicating that these proteins can interact with each other in the cell. In addition, because we overexpressed MST27 and PRM8 from the strong GAL promotor, we might have missed other naturally interacting proteins.
The Mst27/28p and the Prm8/9p Complexes Accumulate in the ER upon
Overexpression
If the suppression ability of Mst27/28p was due to the KKXX motif, the
Mst27/28p complex should at least transiently localize to the Golgi apparatus.
Thus, we attempted to determine the localization of the Mst27/28p and Prm8/9p
complexes. Because Mst27p and Mst28p form a complex, we assumed that by
detecting Mst27p we also could localize Mst28p. Different antibodies that were
generated against Mst27p were not able to detect the endogenous protein by
immunofluorescence, indicating a very low abundance of this protein.
Therefore, we used the myc-tagged Mst27p under GAL10 promotor
control. After induction of the protein, Mst27p was mainly found in the ER
(Figure 4A). Because membrane
proteins often accumulate in the ER after overexpression, we repressed
transcription of MST27 by addition of either rapamycin or glucose to
the medium. Samples were taken after various time points after repression and
processed for immunofluorescence. Even after 6 h of repression, a subfraction
of the Mst27p persisted in the ER while the remaining Mst27p was chased out of
the ER and localized in a punctate pattern, typical for later compartments of
the secretory pathway, most likely Golgi or endosomal membranes
(Figure 4, compare A with C).
Because most of the signal persisted throughout the chase period, we assume
that Mst27/28p cycles between the ER and Golgi apparatus. However, the
steady-state localization of Mst27/28p is most likely in the ER.
|
We extended these experiments by overexpressing Prm8p, which, like Mst27p,
accumulated in the ER. In contrast to Mst27p, the entire Prm8p pool remained
in the ER during the 6-h chase period
(Figure 4, compare C with E and
G). This suggests that endogenous Prm8p might localize to the ER
at steady state. Our results are consistent with data by Kumar et al.
(2002
), who localized Prm8p in
the ER after overexpression in a genome-wide localization approach.
Mst27p Contains a COPI and a COPII Binding Motif
To test whether the C-terminal KKXX motif in Mst27p was able to bind COPI
components, we expressed the C-terminal 123 amino acids of Mst27p fused to GST
in E. coli. As a control, a fusion protein was expressed, in which
the lysine residues of the KKXX motif were replaced by alanines (AAXX).
Affinity chromatography with immobilized GST fusion proteins revealed a
specific interaction of the coatomer complex with Mst27p
(Figure 5A, lanes 1 and 2). In
contrast, no coatomer binding to GST-Mst27p_AAXX was detected.
(Figure 5A, lanes 5 and 6). To
rule out that the signal for the AAXX protein was only reduced, we repeated
the experiment performing an immunoblot analysis. In addition, we included an
Mst28p fusion protein in our assay, which also contains the C-terminal KKXX.
Again, only the KKXX containing fusion proteins interacted with coatomer
(Figure 5B, compare lanes 1 and
2 to 3 and 4).
|
Because overexpression of MST27 resulted in a partial relief from the COPII budding defect in sec21-3 mutants in vitro, we wondered whether Mst27p was able to bind members of the COPII coat. We performed GST pull-down assays in the presence of the small GTPase Sar1p and the Sec23/24p complex of the COPII coat. No significant amounts of Sec24p bound to GST alone (Figure 5C, lanes 14 and 15). In contrast, all three fusion proteins, GST-Mst27p, GST-Mst28p, and GST-Mst27p_AAXX, recruited the Sec23/Sec24p complex in a Sar1p-independent manner (Figure 5C, lanes 19). Sar1p did not bind to the fusion proteins, nor was this reaction guanine nucleotide dependent (our unpublished data). The tails of Mst27p and Mst28p do not contain any obvious COPII binding motif. These results indicate that the Mst proteins expose high-affinity binding sites for both coats in the ER-Golgi shuttle.
Using a similar experimental setup, we determined the coat recruitment abilities of Prm8p. Prm8p contains a C-terminal diphenylalanine (FF) motif, which has been reported to allow interaction with the Sec23/24p complex of the COPII coat. Consistently, Prm8p was able to specifically recruit Sec23/24p complex (Figure 5C, lanes 1012). This interaction was independent of the small GTPase Sar1p. However, no interaction with coatomer was observed (Figure 5, A and B).
COPI Binding and sec21-3 Suppression
To test whether the COPI binding of Mst27p is crucial for its ability to
suppress COPI mutants, we expressed in sec21-3 cells a version of
Mst27p in which the lysines of the KKXX motif were replaced by alanines
(AAXX). This mutant Mst27p did not suppress the sec21-3 strain
(Figure 5D). Thus, COPI-binding
was required for suppression of the sec21-3 mutant. However, we
wondered whether overexpression of any KKXX-containing membrane protein would
be sufficient to suppress the sec21-3 mutant. Wbp1p is the only
subunit of the octameric ER resident oligosaccharyl-transferase complex that
contains a KKXX COPI-binding motif and is not transported from the ER to the
Golgi apparatus (te Heesen et
al., 1992
; Gaynor et
al., 1994
). Overexpression of Wbp1p failed to increase the
temperature resistance of the strain (+WBP1;
Figure 5D), but even reduced
the restrictive temperature of the mutant from 35°C to 32°C.
Therefore, it does not seem to be sufficient to provide coatomer binding sites
on a membrane per se to rescue the sec21-3 mutant. Wbp1 is an ER
resident protein and does not leave the ER. The increase of COPI binding sites
exclusively at the ER might recruit coatomer to the ER and thereby
dramatically reduce the COPI vesicle formation at the Golgi. Hence,
suppression of coatomer mutants would only be expected if COPI binding sites
would be provided by a protein that at least transiently resides in Golgi
membranes. In accordance with this hypothesis, overexpression of Emp24p
suppressed the sec21-3 mutant (+EMP24). Although, Emp24p
does not contain a KKXX sequence, it might interact like its mammalian homolog
directly with coatomer (Fiedler and
Rothman, 1997
). However, overexpression of ERV25 and
ERP1, two other members of the p24 family only scarcely suppressed
the sec21-3 phenotype at 35°C. However, Erv25p and Erp1p depend
on Emp24p for their stability (Belden and
Barlowe, 1996
; Marzioch et
al., 1999
). In summary, the up-regulation of only certain
COPI-binding proteins can suppress the sec21-3 mutant. Hence,
overexpression of a coatomer binding motif and transient localization of these
proteins at the Golgi might not be sufficient to relieve the sec21-3
defect.
Overexpression of MST27 Suppresses Secretion Defects in
the sec21-3 Mutant
After a short incubation at the restrictive temperature, the
sec21-3 mutant shows a cargo-specific anterograde transport defect in
vivo. Precursors of
-factor and the vacuolar protease carboxypeptidase
Y (CPY) accumulate, whereas other proteins such as invertase are secreted at
normal rates. To analyze whether overexpression of MST27 rescues the
secretion defects in sec21-3, we grew either wild-type,
sec21-3, or sec21-3 (+
1-25) cells at 25°C,
shifted the cultures to 37°C for 5 min, and labeled newly synthesized
proteins for 3 min in the presence of [35S]methionine. After the
addition of an excess of cold methionine, aliquots were taken after various
incubation times. The cells were lysed and the extracts used for
immunoprecipitations with
-factor- or CPY-specific antisera
(Figure 6A). In wild-type
cells, the secretion of
-factor is fast, and after 5 min no
glycosylated ER form of the
-factor precursor (gp
F) was
detected. In contrast, in the sec21-3 mutant, gp
F accumulated
in the ER, leading to an increased signal that remained stable even after long
chase periods. In the presence of the suppressing plasmid, however, gp
F
was again efficiently secreted from the ER and completely processed after a
10-min chase.
|
CPY is synthesized as a proenzyme that is cotranslationally translocated
into the ER and glycosylated, leading to the p1 precursor form. On transport
to the Golgi apparatus, the glycan chains of CPY are elongated to yield the p2
form, which is finally processed in the vacuole to mature CPY. In wild-type
cells CPY acquires the Golgi-specific modification after
510 min
and after 20 min it is mostly found in its mature form
(Figure 6A). However, in the
sec21-3 mutant the p1 form is stable throughout the 40-min chase
period and no p2 or mature forms are generated. We also detected a species of
higher electrophoretic mobility that may represent a degradation product
(Figure 6A, *). Overexpression
of MST27 enabled the sec21-3 mutant to produce p2 and mature
forms. However, the transition from the p1 to the p2 form took about twice as
long as in the wild-type, whereas the maturation of the p2 forms occurred
without delay. Thus, the presence of increased amounts of Mst27p rescued the
-factor and CPY secretion defects of the sec21-3 mutant and
re-established nearly normal protein transport along the early secretory
pathway.
The observed block in ER to Golgi transport of
-factor precursor and
CPY in the sec21-3 mutant might either be due to a diminished
packaging efficiency of these proteins into the vesicles at the ER membrane or
to defects in the fusion of ER-derived vesicles with the Golgi. To distinguish
between both possibilities, we monitored packaging of gp
F into COPII
vesicles generated from microsomes in vitro. Wild-type, sec21-3 and
sec21-3 (+
1-25) cells were grown overnight at 25°C. After
incubation of cells at 37°C for 20 min, microsomes were isolated and used
to incorporate radiolabeled prepro-
-factor in vitro (pp
F). The
microsomes were then incubated with COPII components, ATP, and GTP for various
times, and the amounts of gp
F and Sec22p were measured by scintillation
counting and quantitative immunoblotting. A typical result is shown in
Figure 6B. In sec21-3
mutant microsomes the amounts of gp
F and Sec22p in the vesicle fraction
were clearly diminished compared with wild type. We conclude that either
vesicle formation or the cargo uptake process into the COPII vesicles is
affected in this COPI mutant.
Overexpression of MST27 almost completely restored the budding
efficiency of gp
F and Sec22p from sec21-3 microsomes
(Figure 6B). Thus,
overexpression of MST27 increases either the amount of COPII vesicles
generated from the ER or the packaging efficiency of cargo in the
sec21-3 mutant.
MST27 Rescues sec21-3 by Enhancing the Efficiency of COPI and COPII
Vesicle Production
We wanted to further investigate the mechanism of the sec21-3
suppression by MST27. Therefore, we used an in vitro budding assay
from semi-intact cells. Permeabilized yeast cells from sec21-3
strains expressing either no gene, MST27, PRM8, or
MST27-AAXX from a 2 µ plasmid were incubated with cytosol from
sec21-3 or wild type under conditions that should be restrictive for
the sec21-3 mutant in vitro. The free diffusible vesicles were
separated from the membranes by a medium-speed centrifugation. The generated
vesicles were enriched by ultracentrifugation and analyzed by immunoblot with
antibodies against Sec22p and Emp47p, a KKXX motif-containing protein that
cycles between the ER and the Golgi apparatus. As expected, wild-type cytosol
resulted in vesicle release from the different semi-intact cells
(Figure 7A, lanes 4, 7, 10, and
13). In contrast, in the presence of sec21-3 cytosol, vesicles were
only obtained from membranes containing extra Mst27p
(Figure 7A, compare lanes 3, 9,
and 12, to lane 6). Although, Prm8p contains a diphenylalanine signal at the
C-terminus, which should enhance the recruitment of COPII components, it could
not rescue the budding defect. The replacement of KKXX by AAXX in the tail of
Mst27p abolished the formation of vesicles. This result indicates that
overexpression of MST27 leads to the formation of vesicles from
sec21-3 membranes.
|
However, because we used semi-intact cells and cytosol and scored for proteins, which cycle between the ER and Golgi, we could not distinguish between COPI or COPII vesicles. Therefore, we aimed to reconstitute vesicle formation with purified proteins. Semi-intact cells were incubated with either components of the COPI or the COPII coat or wild-type cytosol. Only sec21-3 MST27 membranes were able to efficiently generate COPI-coated vesicles under non-saturating concentrations of coatomer and Arf1p (Figure 7B, compare lanes 1 and 3 to lane 2). Thus, Mst27p enhances the production of COPI vesicles. Next, we added saturating amounts of COPII components to the different semi-intact cells. Under these conditions, MST27 overexpression did not have a positive effect (Figure 7B, lane 5). However, even from sec21-3 membranes the COPII vesicles were released quite efficiently (Figure 7B, compare lanes and 5). Surprisingly, the overexpression of MST27-AAXX did not promote the formation of COPII vesicles (Figure 7B, lane 6), indicating that Mst27p does not influence the uptake of cargo into COPII vesicles but helps to increase the amount of COPII vesicles. This negative effect of MST27-AAXX might be counteracted by one or more cytosolic factors because wild-type cytosol resulted in COPI and COPII vesicle formation from all the membranes (Figure 7, A and B). In addition, Sec21p is part of a cytosolic protein complex, thus adding back wild-type cytosol should rescue the sec21-3 defect. However, addition of limiting amounts of wild-type COPI (Figure 7B, lanes 13) might not be sufficient to alleviate the sec21-3 phenotype.
We assumed that Mst27/28p cycles between the ER and the Golgi. Therefore,
overexpression of MST27 might result in an increase of coatomer at
the Golgi, which could be the explanation for the rescue, we observed. We
enriched Golgi membranes from the sec21-3 strains overexpressing
MST27 or MST27-AAXX. We resolved equal amounts of Golgi by
SDS-PAGE and compared the relative abundance of different Golgi proteins and
coatomer by immunoblot. Although the amount of coatomer and Sed5p, the
cis-Golgi t-SNARE were comparable in all three Golgi membranes, the
amount of Emp47p was increased in Golgi membranes from the sec21-3
MST27 strain (our unpublished data). Thus, coatomer did not seem to be
enriched on the sec21-3 MST27 Golgi. However, we might have extracted
coatomer from the Golgi during the enrichment procedure. Therefore, we added
purified coatomer, GTP
S, and Arf1p back to the Golgi membranes and
floated the membranes through a sucrose cushion. Most of the Golgi would
remain on the bottom of the tube together with the unbound cytosolic proteins.
If only coatomer was added to the different Golgi membranes, vesicles were
released from sec21-3 MST27 Golgi and floated. They contained Emp47p
as well as the SNAREs Sec22p and Sed5p
(Figure 7C, lane 2). Although
Sed5p is a t-SNARE, it has been shown to recycle through the ER
(Wooding and Pelham, 1998
).
Only a few vesicles were released from the Golgi membranes from the other
strains (Figure 7C, compare
lanes 1 and 3 to lane 2). On addition of GTP
S, comparable amounts of
vesicles were formed from the sec21-3 and sec21-3 MST27
Golgi. However, Emp47p seemed to be more concentrated in the vesicles derived
from the Golgi that contains more Mst27p
(Figure 7C, compare lanes 4 and
5). The addition of Arf1p should accentuate the COPI vesicle production. Under
saturating amounts of COPI components and GTP
S, sec21-3 Golgi
could produce even more vesicles than the sec21-3 MST27 Golgi;
however, the cargo packaging as judged by inclusion of Emp47p seemed to be
more efficient upon overexpression of MST27. The observed effects
might have been more pronounced by the use of coatomer derived from a
sec21-3 mutant. As observed for the formation of COPII-coated
vesicles from sec21-3 MST27-AAXX membranes, COPI-coated vesicle
release was abolished from sec21-3 MST27-AAXX Golgi membranes. Thus,
the change of KKXX to AAXX might even result in a negative effect on COPI and
COPII vesicle generation.
Our results indicate that overexpression of MST27 facilitates the formation of COPI and COPII vesicles in a sec21-3 mutant. In addition, we provide evidence that at least at the Golgi apparatus inclusion of cargo into COPI vesicles might be more efficient.
Co-overexpression of Mst27p and Prm8p Results in Abnormally Large
Vacuoles and Cells
We checked the strains overexpressing MST27, PRM8, or both under
the light microscope. Although single overexpression did not result in any
obvious morphological phenotype, the simultaneously increased protein levels
of Mst27p and Prm8p resulted in large cells with abnormally big vacuoles
(Figure 8, compare F to A to
C). This effect was not simply due to overexpression of two
transmembrane domain-containing proteins because cells co-overexpressing
Sec20p, an ER resident protein that contains an HDEL-ER localization signal,
together with Mst27p or Prm8p, were almost indistinguishable from wild-type
cells grown under the same conditions
(Figure 8, compare D and E to
A). We confirmed this phenotype by electron microscopy
(Figure 9). The vacuole in the
Mst27p- and Prm8p-overexpressing strain seemed to fill almost the entire cell
and the nucleus was pushed to the edge of the cell. The vacuoles seemed to be
empty, because they contained very little electrodense material in their
lumen. One explanation for this phenotype would be that the overexpressed
proteins would fill up the vacuole and that their expression rate was so high
that they accumulated in the vacuole. Thus, we wondered whether Prm8/9p would
piggy-back on Mst27/28p to the vacuole. However, interestingly, both protein
complexes remained largely in the ER
(Figure 10). Therefore,
Mst27/28p and Prm8/9p may act in concert to efficiently export a membrane
protein or protein complex that was transported to the vacuole. These membrane
proteins might be part of the extracelluar matrix in the wild, but are no
longer needed upon domestication and thus transported to the vacuole.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
-COP (Sec21p) only interacts with the dimeric form of p23.
We propose that the Mst27/28p and p24 complexes can provide nucleation
sites, which recruit and locally concentrate cytosolic coat complexes onto the
membranes of the early secretory pathway. This stimulates the formation of
vesicles and thereby mitigates the decreased vesicle flow in sec
mutants. This hypothesis is supported by the strict dependence of the
COPI-binding ability. Although the minimal machinery necessary for COPI
vesicle formation in vitro are Arf1p, coatomer and guanine nucleotides (Spang
et al., 1998), in vivo, the amount of vesicles formed might also be
dependent on the amount of cargo to be transported. Currently, it remains
unclear whether there are vesicles running between different compartments on a
specific schedule or whether the vesicles are formed upon demand when cargo is
present to be transported. These possibilities are difficult to distinguish
because in vivo vesicle emergence and consumption is a fast and highly dynamic
process. Yeung et al.
(1995
) have shown that ER
membranes devoid of cargo are still competent for COPII vesicle formation in
vitro. However, the amount of COPII vesicles might have been reduced under
these conditions. For different vesicle populations regulatory proteins have
been identified, which help the recruitment of cargo (for reviews, see
Aridor and Traub, 2002
;
Spang, 2002
). These might have
a positive effect in the budding process. Our data provide evidence that cargo
itself can act as driving force for vesicle formation.
The Mst27/28p complex is part of a large family of proteins, the DUP
family, indicating that their members are scattered throughout the genome by
gene duplication. So far, no close homologs have been identified in any other
organism. Why is this protein family so large and well maintained in S.
cerevisiae, but is not conserved in any other species? The easy answer
could be that the role of the DUP family proteins is a highly specialized
task. This would also explain why the phenotypes of the deletion mutants were
so difficult to characterize. The
mst27
mst28
homozygous diploid mutant was sensitive toward PMSF, ZnCl2, EDTA,
and H2O2 (Sandmann and Spang, unpublished data). The
haploid cells did not show any growth defects when compared with the isogenic
wild-type. Thus, the function of Mst27/28p complex might be more important in
diploids than in haploid cells. This seems indeed to be the case. Recently,
Kuthan et al. (2003
)
reported that wild S. cerevisiae possessed a fluffy colony morphology
that was lost upon domestication of the yeast in the laboratory. The
domesticated strains showed a smooth colony morphology. The fluffy colony
appearance was due to extracellular matrix unrelated to the flocculins. They
analyzed the expression pattern from wild and domesticated S.
cerevisiae and showed that MST27 and MST28 were
down-regulated upon domestication. This explains why we could not detect
Mst27/28p without overexpression and why we could not find strong phenotypes.
We observed only defects in diploid yeast. This might be because in the wild,
S. cerevisiae exists mostly as diploid and only switches to the
haploid cycle upon starvation and spore formation.
The next close homologs of Mst27/28p in yeast are Prm8p and Prm9p. They are
induced upon treatment of cells with pheromone
(Heiman and Walter, 2000
).
Similar to Mst27/28p, Prm8p and Prm9p form a complex with each other. Because
overexpression of either MST27 or PRM8 resulted in higher
levels of Mst28p and Prm9p in the cell, respectively, we assume that Mst27p
and Prm8p stabilize their counterpart in the complex. Mst27p and Mst28p are
both in part posttranslational modified. However, we were unable to determine
the nature of the modification. Although our results exclude
polyubiquitination of Mst27p and Mst28p, the addition of a single ubiquitin
residue cannot be formally ruled out, because the antibodies that are
commercially available are not very sensitive toward monoubiquitination.
Monoubiquitination was shown to function as a signal for degradation of Ste2p
in the vacuole (Hicke and Riezman,
1996
). Degradation of Mst27p in the vacuole is supported by the
observation that overexpression of Mst27p in a
pep4
background, where the major vacuolar protease is deleted is lethal (Sandmann
and Spang, unpublished data). Alternatively the mobility shift, we observed
for a fraction of the Mst27/28p complex, might be of a different nature.
What are the functions of the Mst27/28p and Prm8/9p complexes? Both are
located in the ER; one complex seems to cycle between ER and Golgi apparatus
(Mst27/28p), whereas the other (Prm8/9p) resides stably in the ER. However,
because we were unable to detect endogenous Mst27/Mst28p, we cannot exclude
that this complex is ER resident and not cycling. The enlarged vacuole
phenotype after overexpression of both complexes points toward a function in
ER exit of other proteins. This would be in analogy to the exit of the
V0 sector of the vacuolar H-ATPase. There, Vma22p is required for
the assembly for the V0 sector. Then Vma21p is needed for the
export out of the ER of the assembled protein complex. Vma21p is a membrane
protein containing a KKXX motif (Hill and
Stevens, 1994
). On arrival of the V0-Vma21p complex at
the cis-Golgi, Vam21p dissociates from the V0 complex. The
V0 sector continues its journey to the vacuole, whereas Vam21p
returns to the ER for another round of transport out of the ER. Similarly, the
members of the p24 family are, at least in yeast, required for the efficient
export of GPI-anchored proteins (Muniz
et al., 2000
; Muniz
and Riezman, 2000
). The role of the Mst27/28p complex might be to
escort extracellular matrix proteins out of the ER. Alternatively, the
passengers might be special Golgi enzymes that allow for a different branching
of sugars of glycosylated proteins in the Golgi. The Prms might be required to
assemble protein complexes for the export out of the ER. However, the precise
role of the Mst and Prm proteins still awaits discovery.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
|| Corresponding author. E-mail address: anne.spang{at}tuebingen.mpg.de.
| REFERENCES |
|---|
|
|
|---|