![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, Issue 8, 3242-3253, August 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Institut für Allgemeine Zoologie und Genetik, Westfälische
Wilhelms-Universität Münster, D-48149 Münster, Germany;
Institute of Molecular Biology, Austrian Academy of Sciences, Salzburg,
Austria
Submitted January 27, 2003;
Revised March 21, 2003;
Accepted March 21, 2003
Monitoring Editor: Paul Matsudaira
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
;
Machesky and Hall, 1997).
These newly polymerized actin filaments are highly dynamic and are turned over
rapidly (Wang, 1985). It has
been proposed that the actin filaments found in the remainder of the cells
have their origin in the lamellipodium
(Small et al., 1998)
and in small membrane ruffles occurring throughout the lamella
(Schafer et al.,
1998). Actin filaments are organized into various arrays such as
stress fibers, lamellipodial networks, filopodial bundles, dorsal arcs,
peripheral concave or convex bundles as well as geodesic arrays
(Small, 1988;
Heath and Holifield, 1993;
Small et al., 1998).
The organization of each of these assemblies is controlled and stabilized by
specific sets of actin-associated proteins, conferring on them different
functions. However, it is not known how many functionally different actin
arrays exist in cells and how their spatial and temporal organization is
regulated and coordinated. An asymmetric and polarized organization of the
different actin arrays in cells is fundamental for cell migration, growth,
division, differentiation, and defense
(Verkhovsky et al.,
1998; Weiner et al.,
1999).
The induction and maintenance of a polarized distribution of different
actin arrays is dependent on extracellular and intracellular signals.
Leukocytes and amoebas of Dictyostelium discoideum can orient
themselves in a gradient of a chemoattractant and move toward the source of
the chemoattractant (Zigmond,
1981; Devreotes and Zigmond,
1988). Activation of uniformly distributed G protein-coupled
receptors on the cell surface leads to the intracellular stimulation of
phosphoinositide 3-kinase (PI 3-kinase) and a highly polarized accumulation of
phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] and/or
phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2]
(Meili et al., 1999;
Rickert et al., 2000;
Servant et al., 2000;
Chung et al., 2001).
Pleckstrin homology (PH)-domain–containing proteins have been suggested
to represent targets of PI 3-kinase lipids. PH-domains are found in many
proteins involved in a diverse array of physiological events, including
cellular signaling and cytoskeletal organization
(Haslam et al., 1993;
Gibson et al., 1994).
They are a structural module of 
100–120 amino acid residues, and
several of them have been demonstrated to bind with high specificity to
differently phosphorylated phosphoinositides
(Kavran et al., 1998;
Rameh et al.,
1997).
The PH-domain containing protein SWAP-70 with a molecular mass of 70 kDa
was originally isolated as a B cell-specific component of an isotype switch
recombination complex called SWAP
(Borggrefe et al.,
1998). Analysis of its PH-domain sequence reveals a good fit to a
consensus motif (Isakoff et al.,
1998; Ferguson et
al., 2000; Thomas et
al., 2001), which predicts high-affinity binding to
PI(3,4)P2. Its intracellular localization has been reported to
depend on cell activation. Stimulation of the B cell receptor triggers a
translocation of SWAP-70 from the cytosol to the plasma membrane in B cells
(Masat et al., 2000).
This translocation required a functional PH-domain. Although SWAP-70 was
considered to be expressed in B cells only (Borggrefe et al.,
1998,
1999;
Masat et al., 2000),
Ishikawa et al.
(1998) were able to detect RNA
expression by reverse transcription-polymerase chain reaction (PCR) in a
variety of different tissues. This result suggested that SWAP-70 could have a
more widespread function.
In a two-hybrid screen, we identified SWAP-70 as a possible binding partner of rat myosin IXb (myr 5), a class IX myosin-RhoGAP molecule (our unpublished observation). Therefore, we sought to investigate its possible role as an effector of PI 3-kinase in the regulation of polarized actin dynamics. To this end, we used the mouse melanoma B16F1 cells that are highly motile and exhibit a high frequency of lamellipodia formation.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). A
cDNA library in vector JG4-5 of serum-starved WI-38 human lung fibroblasts (a
kind gift of Sardet and Gyuris, Massachusetts General Hospital, Boston, MA)
was screened with bait plasmid pEG235 encoding amino acids 1440–1592 of
rat myosin IXB (myr 5). The myr 5 cDNA was inserted at BamHI and
NcoI sites. Plasmids were transformed into yeast strain EGY48
together with the LacZ reporter plasmid pSH18-34. Of 2 x 107
colony-forming units plated, two Leu+ and LacZ+ clones were identified. Both
clones contained the identical 2.3-kb insert encoding full-length SWAP-70 as
verified by analysis of cDNA and genomic DNA.
Antibodies
To raise antibodies specific for SWAP-70, rabbits were immunized with a
denatured fusion protein of 6xHis-SWAP-70 (aa 89–585). An
EcoRI/XhoI fragment encoding amino acids 89–585 was
excised from plasmid JG4-5-SWAP-70 and subcloned into the corresponding
restriction sites in pBluescriptSK (Stratagene, La Jolla, CA). Further
subcloning into the BamHI/SalI sites of the pQE30 6xHis-tag
expression vector (QIAGEN, Hilden, Germany) was performed by excision of a
BamHI/XhoI fragment from the modified pBluescript. Fusion
protein was expressed in Escherichia coli (DH5
) and purified
over Ni2+-nitrilotriacetic acid resin under denaturing
conditions as recommended by the manufacturer. Rabbit sera GK1 and GK2 were
affinity purified by standard techniques. The purified fusion protein was
coupled to CNBr-activated Sepharose-4B (Amersham BioSciences, Freiburg,
Germany) in 6 M urea, 0.1 M NaHCO3, pH 8.0.
The green fluorescent protein (GFP) antibody was a kind gift of Prof. Markus Maniak (Kassel, Germany). A rabbit polyclonal antibody directed against nonmuscle myosin (BT-561) was from Biomedical Technologies (Stoughton, MA).
Plasmids for Cell Transfections
SWAP-70 with an N-terminal hemagglutinin (HA)-tag followed by a short 19
residue linker sequence was cloned into pUHD10-3
(Resnitzky et al.,
1994). Two annealed complementary oligonucleotides encoding
SpeI, HA-tag and NotI sequences, a NotI/blunted Bsu
36I SWAP-70 fragment, and pUHD 10-3 previously modified by insertion of
SpeI/EcoRV sites between EcoRI and BamHI
sites were ligated. This resulted in a plasmid encoding amino acids
MYPYDVPDYACGRRGWLGRRGWRGSRAAA followed by the complete SWAP-70 coding
sequence.
For construction of the GFP-SWAP-70 plasmid, the 5' region of SWAP-70 was amplified by PCR with the primers MB411 (GGCTCGAGGGAGCTTGAAGGAGGAGCTG) and MB412 (CACAGAGGGTCCAACACATCC). The PCR fragment was cloned into the XhoI and EcoRI restriction sites of the pEGFP-C1 vector (BD Biosciences Clontech, Palo Alto, CA). The missing region of SWAP-70 was excised with EcoRI/BamHI from pUHD-HA-SWAP-70 and ligated into the corresponding sites of the pEGFP-C1 vector.
SWAP-70 fragments encompassing amino acids 1–313 or 205–585 were amplified by PCR to construct GFP-SWAP(1–313) and GFP-SWAP(205–585). The primers used were MB411 and MB420 (GGGGATCCTCAAGGGCTGCCCAGCTTCAACAG) for SWAP(1-313) and primers MB421 (GGCTCGAGGGATGGCAATTAATGAAGTCTTTAATG) and MB422 (GGGGATCCTCACTCCGTGGTCTTTTTCTCTT) for SWAP(205-585). The PCR fragments were cloned into the XhoI and BamHI restriction sites of the pEGFP-C1 vector.
The PH(aa205-313)-GFP plasmid was constructed by PCR with primers MB433 (GGGAATTCATGGCAATTAATGAAGTCTTTAATG) and MB434 (GGGGATCCCCAGGGCTGCCCAGCTTCAACAGA). The PCR fragment was inserted into the EcoRI and BamHI restriction sites of the pEGFP-N1 vector (BD Biosciences Clontech).
The mutations R230C and RR223,224EE in GFP-SWAP-70 were introduced by the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Primers encoding the R230C mutation were MB459 (CCACAGACGGAAAAACTGGACTGAATGCTGGTTTGTACTAAAACCC) and MB460 (GGGTTTTAGTACAAACCAG-CATTCAGTCCAGTTTTTCCGTCTGTGG) and primers encoding the RR223,224EE mutations were MB457 (GCAGGGTTACATGATGAAAAAGGGCCACGAAGAGAAAAACTGGACTG) and MB458 (CAGTCCAGTTTTTCTCTTCGTGGCCCTTTTTCATCATGTAACCCTGC). All PCR-products were verified by sequencing. The SWAP-70 cDNAs were transferred from the GFP-SWAP-70 plasmids into the pECFP-C1 and the pEYFP-C1 vectors (BD Biosciences Clontech) by using the XhoI and BamHI restriction sites. YFP-SWAP(1-525) was constructed by insertion of a stop codon with PCR. The SWAP(526-585) fragment was amplified by PCR by using the primers 5'-GGCTCGAGGGATGGCAACTAATAAGACC and 5'-GGGGATCCTCACTCCGTGGTCTTTTTCTCTT and subcloned into the XhoI and BamHI sites of pEGFP-C1.
Cell Culture
Swiss 3T3 fibroblasts, HtTa-1 HeLa cells (a gift of H. Bujard, Heidelberg,
Germany; Gossen and Bujard,
1992), REF52 cells, and B16F1 mouse melanoma cells (American Type
Culture Collection, Manassas, VA) were cultured in DMEM (Invitrogen,
Karlsruhe, Germany)/10% fetal calf serum (FCS) (Invitrogen)/2 mM
L-glutamine (Invitrogen)/0.1 mg/ml penicillin/streptomycin (Roche
Diagnostics, Mannheim, Germany) at 37°C in a humidified atmosphere with 5%
CO2. B16F1 cells used for videomicroscopy were maintained in high
glucose (4500 mg/l) DMEM (Sigma-Aldrich, St. Louis, MO) supplemented with 10%
FCS (PAA Laboratories, Linz, Austria). For observation by video microscopy
B16F1 cells were transferred to Ham's F12 medium (Sigma-Aldrich) containing
10% FCS.
Cell and Tissue Extract Preparations and Immunoblotting
Cells were plated on Ø 60-mm culture plates, transfected (see
below), and grown until they were 80–90% confluent. Cells were washed
three times with phosphate-buffered saline (PBS) (150 mM NaCl, 3 mM
Na2HPO4, 1.5 mM KH2PO4, pH 7.4),
harvested by scraping, and collected by centrifugation. Cells were lysed in 5
volumes of lysis buffer (100 mM NaCl, 1 mM MgCl2, 0.5 mM EGTA, 1 mM
-mercaptoethanol, 0.5% NP-40, 20 mM HEPES, pH 7.4). Tissue samples were
prepared as described previously
(Chieregatti et al.,
1998). Immunoblotting was performed according to Towbin et
al. (1979), and signals
were detected using either the enhanced chemiluminescence system (Amersham
Biosciences) or SuperSignal West Pico chemiluminescent substrate reagent
(Pierce Chemical, Rockford, IL).
Cell Transfections and Fluorescence Microscopy
For immunofluorescence microscopy, Swiss3T3 and HtTA-1 HeLa cells were
plated on sterile coverslips and transfected with FuGENE reagent (Roche
Diagnostics). Cells were treated with pharmacological agents 36–48 h
after transfection. B16F1 cells were cultured on Ø30-mm dishes and
transfected by using Superfect reagent (QIAGEN). Transfected B16F1 cells were
replated on laminin coated coverslips 4–6 h before analysis or
pharmacological treatments. Coverslips were coated for 1 h with laminin (25
µg/ml) (Sigma-Aldrich) in coating buffer (150 mM NaCl, 50 mM Tris, pH 7.5)
and rinsed with PBS immediately before plating of cells.
AlF4– (50 µM AlCl2 [Merck,
Darmstadt, Germany] and 30 mM NaF [Merck] final concentration) was diluted
from stock solutions into complete medium and then added to the cells by
replacing the growth medium. Cells were normally fixed in 4% paraformaldehyde
(PFA; Merck) for 30 min. Free aldehyde groups were blocked with 0.1 M glycine
(Roth, Karlsruhe, Germany) and then cells were permeabilized in 0.05% saponin
(Sigma-Aldrich) for 20 min. Unspecific binding sites were blocked with 5%
normal goat serum (Dianova, Hamburg, Germany). To remove cytosolic proteins
cells were treated with 0.3% Triton X-100 in the presence of 4% PFA for 3 min
followed by 4% PFA for 30 min. All reagents were buffered with PBS. After
incubation with primary antibody directed against SWAP-70 (GK2), cells were
stained with fluorescein isothiocyanate- or rhodamineconjugated goat
anti-rabbit IgG (Dianova). Filamentous actin was stained with fluorescein
isothiocyanate- or Alexa 594-conjugated phalloidin (Molecular Probes, Eugene,
OR). Some cells were fixed with glutaraldehyde (Sigma-Aldrich) to achieve
better actin cytoskeleton preservation. Cells were first extracted with 0.25%
Triton X-100 in the presence of 0.5% glutaraldehyde for 1 min and then fixed
further with 1% glutaraldehyde for 15 min. Free aldehyde groups were blocked
with 0.5 mg/ml sodium borohydride and unspecific binding sites with 5% normal
goat serum in PBS. Triton X-100, glutaraldehyde, and borohydride were buffered
with CB-buffer (150 mM NaCl, 5 mM EGTA, 5 mM glucose, 5 mM MgCl2,
10 mM 2-(N-morpholino)ethanesulfonic acid, pH 6.1). Antibody
stainings were produced as described for paraformaldehyde-fixed cells. The
cells were analyzed with an Axiophot fluorescence microscope (Carl Zeiss,
Jena, Germany), by using 63x or 100x objectives. Images were
acquired with a dual mode cooled charge-coupled device camera C 4880
(Hamamatsu, Bridgewater, NJ) controlled by High Performance Image Control
(Hipic) software (Hamamatsu). Images were imported and processed in Adobe
Photoshop 5.5. Videomicroscopy of B16F1 cells was performed as described
previously (Hahne et al.,
2001).
Generation of GST-SWAP-70 Fusion Proteins
The cDNA coding for full-length SWAP-70 or just the PH domain (aa
205–313) was amplified by PCR by using primers MB432
(GGGGATCCGGGAGCTTGAAGGAGGAGCTG), MB433B (GGCTCGAGTCACTCCGTGGTCTTTTTCTCTT) and
MB418 (GGGGATCCATGGCAATTAATGAAGTCTTTAATG), MB419
(GGCTCGAGTCAAGGGCTGCCCAGCTTCAACAG), respectively. The PCR fragments were
cloned into the BamHI and XhoI restriction sites of the
pGEX4T-1 vector (Pharmacia), yielding plasmids GST-SWAP-70 and
GST-PH(205-313). GST-SWAP-R230C and GST-SWAPRR223,224EE plasmids were obtained
by QuikChange site-directed mutagenesis as described above for the GFP
plasmids. For cloning of the GST-PH-R230C and GST-PH-RR223,224EE plasmids the
mutated SWAP-70 cDNAs served as templates for the initial PCR. All
PCR-products were verified by sequencing.
GST-SWAP-70 and GST-PH fusion proteins were expressed in E. coli
(DH5 or XL1Blue for GST-PH domains) and purified over
glutathione-Sepharose 4B as recommended by the manufacturer (Amersham
Biosciences).
Phospholipid Binding Assay
Nitrocellulose strips containing spots of equal amounts (100 pmol) of
different phospholipids (PIP-strips) were purchased from Echelon Biosciences
(Salt Lake City, UT). Phospholipid-binding assays were performed as
recommended by the manufacturer. Briefly, the PIP-strips were blocked with 3%
fatty acid-free bovine serum albumin (Sigma-Aldrich) and incubated with the
GST-SWAP fusion proteins overnight at 4°C. Bound protein was visualized by
standard immunodetection. GST-SWAP-70 fusion proteins were detected by SWAP-70
antibody GK2 and GST-PH fusion proteins were detected by anti-glutathione
S-transferase (GST) antibody (Amersham Biosciences). Secondary
antibodies were either coupled to peroxidase and detected by chemiluminescence
(Pierce Chemical) or to alkaline phosphatase and detected by
2,2'-di-p-nitrophenyl-5,5'-diphenyl-3,3'-[3,3'-dimethoxy-4,4'-diphenylene]-ditetrazolium
chloride)/(5-bromo-4-chloro-3-indolyl-phosphate) color reaction (Promega).
Online Supplemental Material
Time-lapse images are included as online videos, supplementing
Figure 5 (Videos 1, 2, and 3).
The videos 1, 2, and 3 contain the selected time-lapse frames shown in
Figure 5A, B, and C,
respectively. The time intervals of successive frames for Video 1 are 20 s and
for Videos 2 and 3 are 30 s, respectively. All cells were monitored
simultaneously by fluorescence and phase contrast microscopy. All videos are
available at
www.molbiolcell.org.
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
,
1999;
Masat et al., 2000).
However, Ishikawa et al.
(1998) had reported the
cloning of SWAP-70 (KIAA0640) from a human brain cDNA library. Furthermore,
reverse transcription-PCR experiments had detected SWAP-70 mRNA expression in
all of the 10 different tissues analyzed
(Ishikawa et al.,
1998). In addition, our SWAP-70 cDNA was derived from a WI-38 lung
fibroblast cDNA library. To assess the expression of SWAP-70 protein in
various rat tissues and cell lines, we raised polyclonal antibodies specific
for SWAP-70. Affinity-purified antibodies recognized on immunoblots a single
protein band of the expected molecular mass of 70 kDa
(Figure 1). SWAP-70 was
detected in every tissue tested, being most abundant in spleen and fairly
abundant in kidney, lung, and liver. SWAP-70 was also expressed in human
monocytes and macrophages, the human cell lines WI-38 and HtTA-1 HeLa, and the
mouse cell lines Swiss3T3 and B16F1 (Figure
1). Northern blot analysis revealed a similar tissue distribution
of mRNA expression (our unpublished data).
|
SWAP-70 Associates with Filament Arrays Generated behind Actively
Protruding Lamellipodia That Lack Myosin II
In B16F1 mouse melanoma cells, SWAP-70 exhibited in many cells a diffuse
localization. However, in cells with circular membrane ruffles (actin clouds;
Ballestrem et al.,
1998), SWAP-70 was localized specifically on filaments immediately
adjacent to the actin clouds (Figure
2). By using glutaraldehyde to preserve actin filaments and double
labeling with phalloidin, it could be demonstrated that SWAP-70 colocalized
with very fine, loose actin filament arrays
(Figure 2, C–F) that were
easily overlooked against the more prominent actin networks of lamellipodia
and stress fiber bundles. Therefore, SWAP-70 highlighted a subset of actin
filament arrays that were not assembled into distinct filament bundles.
Significantly, the same filament arrays were found to lack nonmuscle myosin II
(Figure 3). The filament arrays
labeled by SWAP-70 were neither colocalizing with microtubules nor
intermediate filaments, nor the actin-binding proteins tropomyosin,
-actinin, and vinculin (our unpublished data).
|
|
To investigate the SWAP-70 localization in live cells, we expressed a fusion protein of SWAP-70 with GFP at its N or C termini. Both constructs localized in the same way as endogenous SWAP-70, when expressed at low levels (Figure 4A), and exhibited the expected molecular weight when probed by immunoblotting with antibodies directed against SWAP-70 or GFP (Figure 4, B and C; only data from the N-terminal fusion are shown).
|
In resting, nonmotile cells, GFP-SWAP-70 was distributed diffusely. However, when cells started to extend lamellipodia, GFP-SWAP-70 became concentrated in fine, loose actin filament arrays located in the lamellae regions (Figure 5A; Video 1). The GFP-SWAP-70–labeled filaments followed the direction of extension, but they did not extend into lamellipodia (Figure 5B; Video 2). In cells switching from protrusion to retraction of lamellipodia, GFP-SWAP-70 became frequently localized to the cell edge, whereby the filamentous localization was gradually lost (Figure 5C; Video 3). In summary, the filamentous GFP-SWAP-70 localization was strictly coupled to lamellipodia extension and as such was highly dynamic. In accordance with this notion, an increase in number of cells exhibiting active lamellipodial extension or rosettes of dynamic actin "spots" by the application of aluminum fluoride and vanadate, respectively, correlated with an increase in number of cells with fine, loose actin filament arrays labeled by SWAP-70 (our unpublished data). The localization of SWAP-70 to loose actin filament arrays coupled to lamellipodial extension was not restricted to B16F1 cells, but was also observed in other cells such as Swiss 3T3, REF52, and HeLa (supplemental Figure 1).
The PH-Domain of SWAP-70 Binds Phosphoinositides
As a first step in addressing the mechanism of SWAP-70 targeting to the
loose actin filament arrays, we sought to investigate the involvement of the
SWAP-70 PH-domain. In vitro phospholipid binding studies were performed with
purified GST-SWAP-70 and GST-PH fusion proteins
(Figure 6). PIP-strips
containing equal amounts of different phospholipids immobilized on
nitrocellulose were incubated with the fusion proteins. Both fusion proteins
bound specifically to a number of phosphorylated phosphoinositides, namely,
phosphatidylinositol (3)-phosphate, phosphatidylinositol (4)-phosphate,
phosphatidylinositol (5)-phosphate, phosphatidylinositol (3,4)-bisphosphate,
phosphatidylinositol(3,5)bisphosphate, and
phosphatidylinositol(4,5)-bisphosphate. A weaker binding of GST-PH and only a
faint binding of GST-SWAP-70 was observed to PI(3,4,5)P3. No
binding was observed to the head group I(1,3,4,5)P4,
phosphatidylinositol, phosphatidylethanolamine, phosphatidylcholine, and
phosphatidylserine. Interestingly, the fusion proteins also interacted with
phosphatidic acid. Control experiments with GST alone detected no binding (our
unpublished data).
|
To modify or delete the phosphoinositide binding, we constructed two
PH-domain mutants. Based on previous studies with PH-domains, we speculated
that R230 might be important for binding to the 3-phosphate. Therefore, we
mutated this residue to a cysteine as in a mutant of Btk that causes
agammaglobulinemia (deWeers et
al., 1994). Introduction of this mutation caused a specific
reduction of the binding of GST-SWAP-70 and GST-PH to PI(3,4)P2
(Figure 6). To abolish the
binding of the SWAP-70 PH-domain to phosphoinositides, we mutated the two
positively charged arginine residues 223 and 224 in the 1/2-loop
to negatively charged glutamic acid residues. As predicted, the introduction
of these two point mutations abolished phosphoinositide and also phosphatidic
acid binding (Figure 6).
The Binding of a 3'-Phosphoinositide by the PH-Domain Is
Necessary for Localization of SWAP-70 to the Loose Actin Filament Arrays
Next, we investigated how the altered phospholipid binding by the mutant
PH-domains affected the cellular localization of SWAP-70. GFP-SWAP-70-RR/EE no
longer localized to the fine, loose actin filament arrays, demonstrating that
phospholipid binding to the PH-domain is necessary for the specific
subcellular localization of SWAP-70 (Figure
7A). Occasionally, GFP-SWAP-70-RR/EE exhibited a faint
colocalization with the phalloidin staining. Introduction of the PH-domain R/C
mutation into GFP-SWAP-70 seemed to reduce the SWAP-70 actin filament
association. To compare the localization of wild-type SWAP-70 and SWAP-70-R/C
directly in the same cells, we cotransfected cells with CFP-SWAP-70 and
YFP-SWAP-70-R/C. As shown in Figure 7, C
and D, YFP-SWAP-70-R/C exhibited an equal intensity of cytoplasmic
staining to CFP-SWAP-70, but a much fainter labeling of the fine actin
filament arrays. This result suggests that a 3'-phosphoinositide could
be the physiological ligand of the SWAP-70 PH-domain, a notion also supported
by the finding that the SWAP-70 localization was abolished by the specific PI
3-kinase inhibitor wortmannin (our unpublished data). Although the PH-domain
of SWAP-70 is necessary for proper SWAP-70 localization, it is not sufficient.
The isolated PH-domain of SWAP-70 was not targeted to the fine loose actin
filament arrays and its localization seemed to be mostly cytosolic
(Figure 7, E and F)
|
The Very C-Terminal Region of SWAP-70 Contains Actin
Filament-targeting Information
To identify the region of SWAP-70 that associates with actin filament
arrays, we truncated SWAP-70 after the PH-domain and expressed it as
GFP-SWAP(1-313) fusion protein. GFP-SWAP(1-313) failed to associate with actin
filaments and was diffusely distributed
(Figure 8, A and B). Truncation
of the N-terminal region yielded the GFP-SWAP(205-585) fusion protein. In
contrast to GFP-SWAP(1-313), this fusion protein containing the PH-domain and
the C-terminal region localized to actin filaments
(Figure 8, C and D). This
places the actin filament-binding region to the C-terminal region of SWAP-70.
Importantly, the GFP-SWAP(205-585) was not restricted to the subset of loose
actin filament arrays, but it was located on actin filament bundles in
general, with the exception of those in focal contacts
(Figure 8, C and D, insets).
Therefore, the specificity for binding to a subset of actin filaments must be
provided by the N-terminal region. The very C-terminal region is involved in
actin filament binding because truncation of the last 60 amino acids
compromised the targeting to loose actin filament arrays
(Figure 8, E and F). This
construct was still enriched in areas of the loose actin filament arrays
labeled by SWAP-70. However, in these areas it exhibited a diffuse or spotty
and only occasionally filamentous localization. It also localized partly to
the plasma membrane. To test whether the very C-terminal 60 residues contain
the targeting information for actin filaments, we expressed a
GFP-SWAP(526-585) fusion protein. This GFP-SWAP(526-585) protein exhibited a
striking colocalization with actin filaments stained by phalloidin
(Figure 8, G and H),
demonstrating that it indeed exhibits F-actin targeting information. However,
in vitro F-actin co-sedimentation experiments with purified GST-SWAP(526-585)
or full-length GST-SWAP-70 did not reveal any detectable binding to F-actin
(our unpublished data), suggesting that the association with actin filaments
is dependent on intermediaries or cofactors.
|
Overexpression of SWAP-70 Alters Actin Organization and Cellular
Morphology
Overexpression of either HA-tagged SWAP-70 or GFP-SWAP-70 in HtTa-1 HeLa
cells and B16F1 cells caused alterations in the actin cytoskeleton and
cellular morphology (Figure 9).
HtTa-1 HeLa cells showed a loss of lamellipodia and the acquisition of highly
refractile retraction fiber-like extensions
(Figure 9, A–C). The tips
of these fibers were still dynamic and showed often an accumulation of SWAP-70
protein. As a consequence of SWAP-70 overexpression, the HtTa-1 HeLa cells
adopted a spindle-shaped or rounded morphology. Overexpression of GFP-SWAP-70
in B16F1 cells also led to alterations in lamellipodial morphology and actin
organization (Figure 9,
D–F). The lamellipodia were no longer smooth and extended
but instead were strongly ruffling and generally less extended. Interestingly,
treatment of cells with aluminum fluoride reversed the morphological changes
induced by SWAP-70 overexpression to a large extent (our unpublished data).
The overexpression of SWAP-70 constructs that were not able to localize to the
fine loose actin arrays, such as the SWAP-70-RR/EE PH-domain mutant and the
truncated SWAP(1-313) and SWAP(205-585) constructs did not induce any obvious
alterations (our unpublished data). Therefore, proper
phosphoinositide-dependent subcellular targeting of overexpressed SWAP-70
constructs seemed to be a prerequisite for the induction of cellular
alterations in the actin organization.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
). There must therefore be a major switch in the proteins
associated with actin from generation in lamellipodia to incorporation into
other arrays in the body of the cytoskeleton. Indeed, the regulated
association of different actin binding proteins with actin is implicit in
general ideas about the formation and function of the actin cytoskeleton. And
there are various examples of actin bundling proteins that are used in the
organization of parallel actin arrays for specific functions in different cell
types (Bartles, 2000). In
contrast to bona fide bundling proteins, SWAP-70 was associated with a subset
of actin filaments that were not in obvious bundled arrays.
Two observations suggest that SWAP-70 marks filaments in the actin
cytoskeleton that are in transition between generation in the lamellipodium
and incorporation into contractile bundles. First, SWAP-70 filaments were both
spatially and temporarily associated with the formation of lamellipodia and
membrane ruffles. Speckle microscopy has shown a continuum of retrograde flow
of actin behind lamellipodia
(Waterman-Storer et al.,
1998), consistent with the idea that a proportion of filaments
generated in the lamellipodium contribute to the network of actin that makes
up the rest of the actin cytoskeleton. Second, SWAP-70–labeled filaments
conspicuously lacked myosin-II. In fibroblasts, the interaction of myosin-II
with actin is required for both the assembly and maintenance of actin filament
bundles (Burridge and Chrzanowska-Wodnicka,
1996) that are in turn required for retraction. We therefore
conclude that SWAP-70 associates with newly formed actin filaments generated
in lamellipodia, that have shed lamellipodia-associated proteins
(Small et al., 2002),
but have yet to acquire other associated proteins, in particular myosin, to
cooperate in the assembly of contractile bundles
(Verkhovsky et al.,
1995). Such a subset of actin filaments is likely detected only in
rapidly migrating cells where significant forward movement can occur before
complexing with myosin and other proteins takes place. Whether SWAP-70 plays a
role in regulating myosin association remains to be established. Nevertheless,
SWAP-70 seems to be the first example of a protein marking a subset of
filaments in arrays distinct from lamellipodia meshwork and compact
bundles.
Spatiotemporal Control of SWAP-70 Recruitment to the Subset of Loose
Actin Filament Arrays
The regulated association of SWAP-70 with loose actin filament arrays was
coupled to active lamellipodial extension, and it was blocked by the
inhibition of PI 3-kinase. Several observations argue for a direct rather than
an indirect regulation of SWAP-70 localization by 3'-phosphoinositides
and in particular PI(3,4)P2. SWAP-70 with point mutations in the
PH-domain was no longer found associated with the loose actin arrays. The
PH-domain of SWAP-70 was demonstrated to bind monophosphorylated
phosphoinositides, PI(3,4)P2, and phosphatidic acid in vitro.
Replacement of two arginine residues by glutamic acids in the 1-2
loop of the PH-domain abolished in vitro binding to the mentioned
phospholipids and in vivo association with the loose actin arrays. Mutation of
an arginine residue in the 2-strand important for 3-phosphate
coordination (Salim et al.,
1996; Franke et al.,
1997; Ferguson et
al., 2000) to cysteine reduced selectively the binding of
SWAP-70 to PI(3,4)P2 and the association of SWAP-70 with the loose
actin arrays. Oxidative stress has been reported to induce highly elevated
levels of PI(3,4)P2 in cells
(Van der Kaay et al.,
1999). Exposure of cells to oxidative stress, a spatially
unrestricted signal, caused a quantitative PI 3-kinase-dependent translocation
of SWAP-70 to loose actin arrays and the plasma membrane (our unpublished
data). Steep gradients of the PI 3-kinase lipid products PI(3,4)P2
and/or PI(3,4,5)P3 have been observed in agonist stimulated
neutrophils and amoebas of Dictyostelium discoideum. High
concentrations of these phosphoinositides were detected at actin-rich leading
edges of cells (Meili et al.,
1999; Rickert et al.,
2000; Servant et al.,
2000; Chung et al.,
2001). Therefore, generation of agonist stimulated
PI(3,4)P2 in extending lamellipodia could serve as a spatiotemporal
signal for recruitment of SWAP-70 via its PH-domain. Other phosphoinositides
cannot be excluded as SWAP-70 PH-domain ligands, because the SWAP-70 PH domain
bound several phosphoinositides in vitro. The binding of SWAP-70 to
PI(3,4,5)P3, the main product of PI 3-kinase, was very weak. This
is in accordance with predictions based on structural data
(Thomas et al., 2001)
that the D-5 inositol-phosphate–binding site might be blocked in the
SWAP-70 PH-domain.
Phosphoinositide binding of the PH-domain may be followed by the association of SWAP-70 with actin filaments. The actin association domain was demonstrated to reside in the C-terminal 60 residues of SWAP-70. A SWAP-70 fragment lacking the N-terminal region, but still containing the PH-domain, no longer localized to the specific subset of loose actin arrays. It associated with the bulk of the actin filaments present in cells, but was excluded from focal adhesions. This result can be explained by a regulatory function of the N-terminal region. The N-terminal region might prevent F-actin binding by the C-terminal 60 residues in dependence of ligand binding by the PH-domain. The PH-domain ligand, proposed to be PI(3,4)P2, would control the restricted actin array association. According to this scenario, the PH-domain and the C-terminally truncated fragment might be expected to associate with the plasma membrane of extending lamellipodia. However, no clear indication for such a subcellular localization was noticed for these two fragments, indicating that there is also a region C-terminal of the PH-domain needed for full specificity of SWAP-70 localization. This is in accordance with the nonfilamentous plasma membrane localization of SWAP(1-525) at leading edges and areas of loose actin arrays. The C-terminal 60 residues that are missing in SWAP(1-525) are responsible for F-actin association. This association seems to be indirect or dependent on a cofactor, because no direct binding to F-actin could be demonstrated.
The overexpression of SWAP-70 induced alterations in actin organization and
cell morphology, indicating that SWAP-70 does play a role in the control of
actin organization. SWAP-70 may keep the loose actin filament arrays in a
transitional state. Targeting of an excess of SWAP-70 to the loose actin
filament arrays may cause their depolymerization, because constructs that were
not properly targeted did not alter the actin organization. Aluminum fluoride
may counteract the observed changes of actin organization by stabilization of
the actin filaments. It has been reported that aluminum fluoride inhibits
turnover and depolymerization of actin filaments in vitro
(Combeau and Carlier, 1988).
Alternatively, aluminum fluoride might reverse the effects of an excess of
SWAP-70 by activation of a signaling pathway opposing the SWAP-70
activity.
We propose that SWAP-70 regulates the actin cytoskeleton and cell motility as an effector or adaptor in response to agonist stimulated PI 3-kinase activity, possibly by acting as a protein that prevents premature bundling of actin filaments in protruding zones.
|
ACKNOWLEDGMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
mann for help with adaptation of the videos. We
acknowledge the gift of the GFP-antibody from Prof. Dr. Markus Maniak
(University of Kassel, Kassel, Germany). This work was supported by the
Deutsche Forschungsgemeinschaft (Ba 1354/5-1) and the Austrian Science
Research Council (project P14660
[GenBank]
-PAT). |
Footnotes |
|---|
Abbreviations used: 3'-phosphoinositide, refers to PI(3)P, PI(3,4)P2, PI(3,5)P2, and PI(3,4,5)P3; GFP, green fluorescent protein; GST, glutathione S-transferase; HA, hemagglutinin; PH, pleckstrin homology; PI 3-kinase, phosphoinositide 3-kinase; PI(3,4)P2, phosphatidylinositol 3,4-bisphosphate; PI(3,4,5)P3, phosphatidylinositol 3,4,5-trisphosphate.
The online version of this article contains video material for some
figures. Online version is available at
www.molbiolcell.org. 
Present address: Institute of Biotechnology, Viikki Biocenter, University
of Helsinki, Helsinki FIN-00014, Finland.
Corresponding author. E-mail address:
baehler{at}nwz.unimuenster.de.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONACKNOWLEDGMENTSREFERENCES |
|---|
Bartles, J.R. (2000). Parallel actin bundles and their multiple actinbundling proteins. Curr. Opin. Cell Biol. 12, 72–78.[CrossRef][Medline]
Borggrefe, T., Wabl, M., Akhmedov, A.T., and Jessberger, R.
(1998). A B-cell-specific DNA recombination complex. J.
Biol. Chem. 273,
17025–17035.
Borggrefe, T., Masat, L., Wabl, M., Riwar, B., Cattoretti, G., and Jessberger, R. (1999). Cellular, intracellular, and developmental expression patterns of murine SWAP-70. Eur. J. Immunol. 29, 1812–1822.
Burridge, K., and Chrzanowska-Wodnicka, M. (1996). Focal adhesions, contractility, and signaling. Annu. Rev. Cell. Dev. Biol. 12, 463–518.[CrossRef][Medline]
Chieregatti, E., Gärtner, A., Stöffler, H.E., and Bähler, M. (1998). Myr 7 is a novel myosin IX-RhoGAP expressed in rat brain. J. Cell Sci. 111, 3597–3608.
Chung, C.Y., Funamoto, S., and Firtel, R.A. (2001). Signaling pathways controlling cell polarity and chemotaxis. Trends Biochem. Sci. 26, 557–566.[CrossRef][Medline]
Combeau, C., and Carlier, M.F. (1988). Probing the
mechanism of ATP hydrolysis on F-actin using vanadate and the structural
analogs of phosphate BeF3– and
AlF4–. J. Biol. Chem.
263,
17429–17436.
de Weers, M., Mensink, R.G., Kraakman, M.E., Schuurman, R.K., and
Hendriks, R.W. (1994). Mutation analysis of the Bruton's tyrosine
kinase gene in X-linked agammaglobulinemia: identification of a mutation which
affects the same codon as is altered in immunodeficient xid mice. Hum.
Mol. Genet. 3,
161–166.
Devreotes, P.N., and Zigmond, S.H. (1988). Chemotaxis in eucaryotic cells: a focus on leucocytes and Dictyostelium. Annu. Rev. Cell Biol. 4, 649–686.[CrossRef][Medline]
Ferguson, K.M., Kavran, J.M., Sankaran, V.G., Fournier, E., Isakoff, S.J., Skolnik, E.Y., and Lemmon, M.A. (2000). Structural basis for discrimination of 3-phosphoinositides by pleckstrin homology domains. Mol. Cell 6, 373–384.[CrossRef][Medline]
Franke, T.F., Kaplan, D.R., Cantley, L.C., and Toker, A.
(1997). Direct regulation of the Akt proto-oncogene product by
phosphatidylinositol-3,4-bisphosphate. Science
275,
665–668.
Gibson, T.J., Hyvönen, M., Musacchio, A., Saraste, M., and Birney, E. (1994). PH domain: the first anniversary. Trends Biochem. Sci. 19, 349–353.[CrossRef][Medline]
Golemis, E.A., and Khazak, V. (1997). Alternative yeast two-hybrid systems. The interaction trap and interaction mating. Methods Mol. Biol. 63, 197–218.[Medline]
Gossen, M., and Bujard, H. (1992). Tight control of
gene expression in mammalian cells by tetracycline-responsive promoters.
Proc. Natl. Acad. Sci. USA 89,
5547–5551.
Hahne, P., Sechi, A., Benesch, S., and Small, J.V. (2001). Scar/WAVE is localised at the tips of protruding lamellipodia in living cells. FEBS Lett. 492, 215–220.[CrossRef][Medline]
Haslam, R.J., Koide, H.B., and Hemmings, B.A. (1993). Pleckstrin domain homology. Nature 363, 309–310.[Medline]
Heath, J.P., and Holifield, B.F. (1993). On the mechanisms of cortical actin flow and its role in cytoskeletal organisation of fibroblasts. Symp. Soc. Exp. Biol. 47, 35–56.[Medline]
Isakoff, S.J., Cardozo, T., Andreev, J., Li, Z., Ferguson, K.M., Abagyan, R., Lemmon, M.A., Aronheim, A., and Skolnik, E.Y. (1998). Identification and analysis of PH domain-containing targets of phosphatidylinositol 3-kinase using a novel in vivo assay in yeast. EMBO J. 17, 5374–5387.[CrossRef][Medline]
Ishikawa, K., Nagase, T., Suyama, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998). Prediction of the coding sequences of unidentified human genes. X. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro. DNA Res. 5, 169–176.[Abstract]
Kavran, J.M., Klein, D.E., Lee, A., Falasca, M., Isakoff, S.J.,
Skolnik, E.Y., and Lemmon, M.A. (1998). Specificity and
promiscuity in phosphoinositide binding by pleckstrin homology domains.
J. Biol. Chem. 273,
30497–30508.
Machesky, L.M., and Hall, A. (1997). Role of actin
polymerization and adhesion to extracellular matrix in rac- and rho-induced
cytoskeletal reorganization. J. Cell Biol.
138,
913–926.
Masat, L., Caldwell, J., Armstrong, R., Khoshnevisan, H.,
Jessberger, R., Herndier, B., Wabl, M., and Ferrick, D. (2000).
Association of SWAP-70 with the B cell antigen receptor complex. Proc.
Natl. Acad. Sci. USA 97,
2180–2184.
Meili, R., Ellsworth, C., Lee, S., Reddy, T.B.K., Ma, H., and Firtel, R.A. (1999). Chemoattractant-mediated transient activation and membrane localization of Akt/PKB is required for efficient chemotaxis to cAMP in Dictyostelium. EMBO J. 18, 2092–2105.[CrossRef][Medline]
Rameh, L.E., et al. (1997). A comparative
analysis of the phosphoinositide binding specificity of pleckstrin homology
domains. J. Biol. Chem. 272,
22059–22066.
Resnitzky, D., Gossen, M., Bujard, H., and Reed, S.I.
(1994). Acceleration of the G1/S phase transition by
expression of cyclins D1 and E with an inducible system. Mol. Cell.
Biol. 14,
1669–1679.
Rickert, P., Weiner, O.D., Wang, F., Bourne, H.R., and Servant, G.
(2000). Leukocytes navigate by compass: roles of PI3K
and
its lipid products. Trends Cell Biol.
10,
466–473.[CrossRef][Medline]
Salim, K. et al. (1996). Distinct specificity in the recognition of phosphoinositides by the pleckstrin homology domains of dynamin and Bruton's tyrosine kinase. EMBO J. 15, 6241–6250.[Medline]
Schafer, D.A., Welch, M.D., Machesky, L.M., Bridgman, P.C., Meyer,
S.M., and Cooper, J.A. (1998). Visualization and molecular
analysis of actin assembly in living cells. J. Cell Biol.
143,
1919–1930.
Servant, G., Weiner, O.D., Herzmark, P., Balla, T., Sedat, J.W.,
and Bourne, H.R. (2000). Polarization of chemoattractant receptor
signaling during neutrophil chemotaxis. Science
287,
1037–1040.
Small, J.V. (1988). The actin cytoskeleton. Electron Microsc. Rev. 1, 155–174.[Medline]
Small, J.V., Rottner, K., Kaverina, I., and Anderson, K.I. (1998). Assembling an actin cytoskeleton for cell attachment and movement. Biochim. Biophys. Acta 1404, 271–281.[Medline]
Small, J.V., Stradal, T., Vignal, E., and Rottner, K. (2002). The lamellipodium: where motility begins. Trends Cell Biol. 12, 112–120.[CrossRef][Medline]
Thomas, C.C., Dowler, S., Deak, M., Alessi, D.R., and van Aalten, D.M.F. (2001). Crystal structure of the phosphatidylinositol 3,4-bisphosphate-binding pleckstrin homology (PH) domain of tandem PH-domain-containing protein 1 (TAPP1): molecular basis of lipid specificity. Biochem. J. 358, 287–294.[CrossRef][Medline]
Towbin, H., Staehelin, T., and Gordon, J. (1979).
Electrophoretic transfer of proteins from polyacrylamide gels to
nitrocellulose sheets: procedure and some applications. Proc. Natl.
Acad. Sci. USA 76,
4350–4354.
Van der Kaay, J., Beck, M., Gray, A., and Downes, P.
(1999). Distinct phosphatidylinositol 3-kinase lipid products
accumulate upon oxidative and osmotic stress and lead to different cellular
responses. J. Biol. Chem. 274,
35963–35968.
Verkhovsky, A.B., Svitkina, T.M., and Borisy, G.G.
(1995). Myosin II filament assemblies in the active lamella of
fibroblasts: their morphogenesis and role in the formation of actin filament
bundles. J. Cell Biol. 131,
989–1002.
Verkhovsky, A.B., Svitkina, T.M., and Borisy, G.G. (1998). Self-polarization and directional motility of cytoplasm. Curr. Biol. 9, 11–20.
Wang, Y.-L. (1985). Exchange of actin subunits at the
leading edge of living fibroblasts: possible role of treadmilling, J.
Cell Biol. 101,
597–602.
Waterman-Storer, C.M., Desai, A., Bulinski, J.C., and Salmon, E.D. (1998). Fluorescent speckle microscopy, a method to visualize the dynamics of protein assemblies in living cells. Curr. Biol. 8, 1227–1230.[CrossRef][Medline]
Weiner, O.D., Servant, G., Welch, M.D., Mitchison, T.J., Sedat, J.W., and Bourne, H.R. (1999). Spatial control of actin polymerization during neutrophil chemotaxis. Nat. Cell Biol. 1, 75–81.[CrossRef][Medline]
Zigmond, S.H. (1981). Consequences of chemotactic
peptide receptor modulation for leukocyte orientation. J. Cell
Biol. 88,
644–647.
This article has been cited by other articles:
|
|
 |
|
  J. Liu, D. Li, B. Cao, Y.-x. Li, R. Herva, Y.-s. Piao, and Y.-l. Wang Expression and Localization of SWAP-70 in Human Fetomaternal Interface and Placenta During Tubal Pregnancy and Normal Placentation J. Histochem. Cytochem., July 1, 2007; 55(7): 701 - 708. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ihara, T. Oka, and Y. Fukui Direct binding of SWAP-70 to non-muscle actin is required for membrane ruffling J. Cell Sci., February 1, 2006; 119(3): 500 - 507. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. R. Sivalenka and R. Jessberger SWAP-70 Regulates c-kit-Induced Mast Cell Activation, Cell-Cell Adhesion, and Migration Mol. Cell. Biol., December 1, 2004; 24(23): 10277 - 10288. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||
