![]() |
|
|
Vol. 14, Issue 8, 3366-3377, August 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*Department of Biological Sciences, Center of Tropical Disease Research and Training, University of Notre Dame, Notre Dame, Indiana 46556
Submitted December 2, 2002;
Revised March 10, 2003;
Accepted April 5, 2003
Monitoring Editor: Suzanne Pfeffer
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The Rab proteins are members of the Ras-superfamily of low-molecular-weight
GTPases that cycle between their active GTP and inactive GDP bound forms and
function as molecular switches to promote vesicle fusion
(Martinez and Goud, 1998
).
Rab5 and Rab7 are two members of the Rab family that facilitate early and late
endosome fusion, respectively (Feng et
al., 1995
; Li,
1996
; Vitelli et al.,
1997
). The GTPase-defective mutants of these Rab proteins are
constitutively active and accelerate vesicle fusion, whereas the GDP-bound Rab
mutants, which are incapable of nucleotide exchange, limit vesicle fusion and
function as dominant-negatives mutants. More recently, it has been reported
that Rab5 also regulates fusion of endosomes with phagosomes in an analogous
manner to endosome-endosome fusion and thus may play an important role in the
phagosome maturation process (Duclos
et al., 2000
).
We have examined the effect of perturbing the GTPase cycles of Rab5 and
Rab7 to define the importance of early and late endosome fusion events during
phagosome maturation in primary macrophages infected with M. avium
101. This pathogenic strain of M. avium, originally isolated from an
AIDS patient, is retained within an early phagosome compartment in infected
murine macrophages (Xu et al.,
1994
). Using a retroviral transduction system, we were able to
successfully express wild-type, constitutively active, or dominant negative
forms of Rab5 and Rab7 in primary murine bone marrow macrophages. Our studies
described here address whether constitutively active Rab5 or Rab7 would
facilitate the transport of the mycobacteria to a late endosome/lysosome
compartment and whether limiting endosome fusion with the mycobacteria
phagosome, through the expression of dominant negative Rab mutants, results in
altered trafficking of the mycobacteria. We show that fusion of phagosomes
with early endosomes and an adequate iron supply are important for
mycobacteria to halt the phagosome maturation process.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2 x
105 cells per glass coverslip (Fisher Scientific, Pittsburg, PA) in
6-well tissue culture plates (Corning Incorporated, Corning, NY). Cells were
allowed to adhere for 1824 h before treatments with bacteria and virus.
All tissue culture reagents were found to be negative for endotoxin
contamination by the E-Toxate assay (Sigma).
M. avium Culturing and FITC Labeling
To generate fluorescein isothiocyanate (FITC)-labeled M. avium 101
stocks, the bacteria were passaged through a mouse to ensure virulence. A
single colony was used to produce frozen stocks. Before freezing, cultures
were pelleted and washed with Hanks' buffered saline solution (HBSS; GIBCO)
supplemented with 1% bovine serum albumin (BSA; ICN Biochemicals Inc., Aurora,
OH). For some experiments, M. avium was thawed and immediately
heat-killed by incubating the mycobacteria at 85°C for 30 min. Plating the
treated M. avium confirmed that >99% of the mycobacteria was
incapable of growth. Cultures were resuspended in boric acid buffer, pH 9.2,
containing 1.5 mg/ml FITC powder (Sigma) dissolved in DMSO (Sigma) and
incubated at 37°C for 2 h. Cultures were washed with HBSS supplemented
with 1% BSA to remove any residual buffer and pelleted. FITC-labeled cultures
were resuspended and frozen as described
(Bohlson et al.,
2001
). Frozen stocks were quantified by serial dilution.
Complement Opsonization
Appropriate concentrations of mycobacteria were suspended in macrophage
culture media containing 10% horse serum (GIBCO) as a source of complement
components (Bohlson et al.,
2001
) and incubated for 2 h at 37°C. The complement opsonized
M. avium was directly added to BMMs at a 10:1 bacilli-to-macrophage
ratio for all infection experiments, and the infections were performed as
described (Roach and Schorey,
2002
).
Generation of Retroviral Expression Plasmids and Ecotrophic
Retrovirus
The retroviral expression plasmids were constructed by subcloning cDNAs
encoding human wild-type Rab5, Rab5(Q79L), Rab5(S34N), and canine wild-type
Rab7, Rab7(Q67L), and Rab7(S22N) (generously provided by Dr. C.
D'Souza-Schorey, University of Notre Dame, Notre Dame, IN) into the retroviral
plasmid pLZRS-IRES-NEO (generously provided by Dr. J. Collard, NKI, Amsterdam,
Netherlands). The vector pLZRS-IRES-NEO encodes a multicloning site, followed
by an IRES (internal ribosome entry site) sequence, the neomycin resistance
gene (NEO), and oriP (origin of replication of the Epstein-Barr virus;
Michiels et al.,
2000
). Expression plasmids containing the cDNA of the various Rabs
were tagged at the 5' end with a sequence encoding a 10-amino acid
peptide from hemagglutinin (HA; Palacios
et al., 2001
). The Rab5s, originally in pCDNA 3.1, were
removed by XbaI digestion and subcloned into a pCDNA3.1()
containing the HA tag coding sequence to create an inframe fusion between the
HA tag and the Rab5. These HA-Rab5 constructs were sequenced to confirm the
correct reading frame and point mutations.
The pCDNA-HA-Rab5s were digested with ClaI and NotI and
the HA-Rab5 coding sequences were cloned into the BstBI and
NotI sites of pLZRS-IRES-NEO. The PCR-based amplification of the
Rab7s used a 5' primer
(ATCGATATGTACCCATATGACGTTCCAGACTACGCGATGACCTCTAGGAAGAAAGTG), which contained a
ClaI restriction site, the HA epitope sequence, and 21 base pairs of
the Rab7 N-terminal sequence and a 3' primer
(GCGGCCGCACTCTGTGCTCTGCTCTCAC),which contained a NotI restriction
site, followed by the complement of the Rab7 C-terminal sequence. The PCR
product was subcloned into the pGEM expression vector (Promega, Madison, WI)
using the PCR-generated adenosine overhangs. The HA-Rab7 constructs were
sequenced to confirm the proper reading frame and DNA sequence. ClaI-
and NotI-digested HA-Rab7 coding sequence was cloned into the
ClaI and BstBI sites of pLZRS-IRES-NEO. These pLZRS Rab
clones were transfected into the Phoenix (
NX) cell line and used for
generating the ecotrophic retrovirus as described elsewhere
(Michiels et al.,
2000
). In brief,
NX cells were seeded onto 6-well tissue
culture dishes (Corning Inc.) and transfected using standard calcium phosphate
procedure. Cells were incubated in culture media for 24 h, the medium was
replaced, and virus was collected after 48 h. Virus-containing supernatants
were stored at 80°C for up to 6 months and were subjected to no
more than one freeze-thaw cycle.
Transduction of BMMs
BMMs on glass coverslips were infected with complement opsonized M.
avium 101 as indicated above before transduction with the Rab-containing
retrovirus. One milliliter of freshly thawed retrovirus-containing supernatant
mixed with 1% DOTAP liposomal transfection reagent (Boehringer Mannheim,
Indianapolis, IN) was added to the BMMs. Retroviral infection was allowed to
proceed for 4 h at 37°C. Cells were gently washed in phosphate-buffered
saline (PBS) and then incubated in normal growth media. Forty-eight hours
after incubation, the cells were fixed and processed for antibody
staining.
Antibody Staining and Immunofluorescence Labeling
The immunofluorescence staining and confocal microscopy were conducted as
previously described (Boshans et
al., 2000
). Briefly, infected cells were fixed in 2%
paraformaldehyde (Sigma) in PBS. Fixed cells were permeabilized with 0.02%
Triton X-100 (Sigma), blocked with 0.2% BSA and 0.02% gelatin (Sigma), and
washed with PBS, 1% BSA. The anti-mouse mAb against HA (Covance, Berkeley,
CA), the anti-rat mAb against Lamp1 (1D4B
[PDB]
; The Developmental Hybridoma Bank,
University of Iowa) and the anti-rabbit polyclonal antibody against
transferrin receptor (Santa Cruz Biotechnology, Santa Cruz, CA) were used at a
1:100 dilution in PBS, 1% gelatin. All secondary antibodies were obtained from
Chemicon International (Temecula, CA) and used at a dilution of 1:600 in PBS,
1% gelatin.
Fluorescent Dextran Uptake by Macrophages
Fluid phase ingestion of Dextran by macrophages was conducted as previously
described (Racoosin and Swanson,
1993
; Thilo et al.,
1995
). Briefly, 10,000 molecular weight, lysine fixable Texas-red
Dextran (Molecular Probes, Eugene, OR) was added to cells at a concentration
of 1.5 mg/ml. Cells were incubated at 25°C for 5 min, washed extensively
with PBS, and incubated at 37°C, 5% CO2 for 30 min to chase the
dextran to the lysosome. Cells were fixed and processed for immunofluorescence
as described above.
Iron Loading Assays
For the 72-h time point, 100 µM ferric ammonium citrate (FAC; Sigma) was
added to the culture media of M. aviuminfected BMMs. These
infected BMMs were incubated in the presence of FAC for 24 h before viral
transduction. The FAC was maintained in the culture media throughout the
remaining 48-h incubation. For the 48-h time point, 100 µM FAC was added to
the opsonization media of the M. avium in an attempt to preload the
mycobacteria with iron before macrophage infection. BMMs were infected with
the iron-loaded bacteria followed immediately by the viral transduction. FAC
was again maintained in the culture media throughout the remaining 48-h
incubation. For experiments using transferrin-linked FAC, apotransferrin
(Sigma) was incubated with FAC at a 2:1 ratio overnight at 4°C and
concentrated in an Amicon concentrator (Amicon, Beverly, MA) followed by two
washes of the retentate as described
(Olakanmi et al.,
2000
).
Gallium Treatment
Mycobacteria and macrophages were treated with Gallium as previously
described (Olakanmi et al.,
2000
). Briefly, glass coverslips were added to each well of a
6-well tissue culture plate (Corning Inc.), and BMMs were plated at 2 x
105 cells per well. Cells were allowed to adhere for 1824 h.
To limit the amount of available iron to the BBMs, cells were cultured in
media containing DMEM and supplemented with 1% FBS for 24 h before treatment
with bacteria and gallium. M. avium was opsonized in the presence of
500 µM gallium. BMMs in DMEM, 1% FCS were infected with the gallium-loaded
bacteria. The infections were performed as described above. Gallium at 500
µM was added to the BMM growth media during the infection. Cells were then
fixed and stained as described above.
Mycobacteria Killing Assay
BMMs, 1 x 106, on glass coverslips were infected with
complement opsonized M. avium 101 at a 30:1 bacilli-to-macrophage
ratio and were left untreated or transduced with Rab5 WT, Rab5(S34N) or
Ev-Neocontaining retrovirus as described above. Immediately postviral
transduction, coverslips containing infected, transduced, or nontransduced
cells were either removed from the well and lysed for 2 min with 200 µl of
1% IGEPAL (Sigma) in PBS (initial infection load) or incubated for 2, 5, 8, or
12 d in fresh BMM media before lysis. Supernatants were collected at each time
point and spun at 14,000 x g for 10 min to pellet any released
bacilli, and the pellet was pooled with the cell lysis. The M. avium
was quantitated by serial dilution on Middlebrook 7H10/OADC (Bector Dickinson,
Sparks, MD) agar plates.
Statistical Analysis
Data were analyzed by a one-tailed Student's t test. Statistical
significance was assumed at p < 0.05. For all immunofluorescence n = 3 or
greater and error bars represent SD.
| RESULTS |
|---|
|
|
|---|
As described in MATERIALS AND METHODS, HA-tagged wild-type and mutant Rab5
and Rab7 genes were subcloned into the retroviral expression vector
pLZRS-IRES-NEO. Plasmids were transfected into the ecotrophic packaging cell
line, Phoenix (
NX), for generation of recombinant ecotropic virus capable
of infecting rodent cells, as previously described
(Michiels et al.,
2000
). Mouse BMMs were infected with recombinant virus and 48 h
postinfection, expression of Rab proteins was assessed by immunofluorescence
microscopy. We first examined the distribution of wild-type Rab5. As shown in
Figure 1, confocal microscopy
of the transduced BMMs showed a punctate staining pattern characteristic of
endosome distribution (Zerial,
1993
; Woodman,
2000b
). Only a low background staining pattern was detected under
identical conditions when BMMs were infected with "empty"
retrovirus containing the pLZRS vector alone. Using an approach similar to
that described above, we examined the distribution of the activated and
dominant negative Rab5 mutants, Rab5(Q79L) and Rab5(S34N), respectively. Both
Rab5 mutants exhibited a punctate "endosome-like" staining pattern
(Figure 1). Furthermore, in all
cases, BMMs expressing the recombinant Rab5s ranged from 85 to 100%.
|
Next, we generated recombinant viruses expressing HA-tagged wild-type Rab7 and its activated and dominant negative mutants, Rab7(Q67L) and Rab7(S22N), respectively. Rab7 and its mutants also exhibited a punctate staining pattern characteristic of late endosomes and showed expression efficiency similar to that with Rab5 (our unpublished results).
Colocalization of M. avium with Rab5 and Rab 7 in
Transduced Macrophages
To determine if phagosomes containing mycobacteria acquired Rab5 and Rab7
proteins, we first infected BMMs with FITC-labeled M. avium 101
followed by infection with retrovirus encoding HA-tagged wild-type Rab5 and
Rab7. Fortyeight hours postinfection, the distribution of mycobacteria and Rab
proteins were visualized by confocal immunofluorescence microscopy. As shown
in Figure 2, almost all of the
mycobacteria-containing phagosomes were positive for Rab5
(Figure 2, A and D), whereas
significantly fewer were positive for Rab7 (our unpublished results and
Figure 2E). This is in
agreement with previous reports indicating that live pathogenic mycobacteria
are retained within an early phagosome compartment which contain Rab5 but not
Rab7 (Deretic et al.,
1997
).
|
Next we examined the distribution of mycobacteria relative to
constitutively active or dominant negative forms of Rab5 in transduced BMMs.
As indicated in Figure 2 there
was a significant difference between the number of mycobacteria phagosomes
that were positive for Rab5(Q79L), the GTP-bound, compared with Rab5(S34N),
the GDP-bound, mutant (Figure 2, B, C, and
D). As observed for wild-type Rab5, Rab5(Q79L) was present on the
mycobacterial phagosome. In marked contrast, only 38% of the mycobacteria
stained positive for Rab5(S34N). The decreased overlap of dominant negative
Rab5 with the mycobacteria phagosome may result from decreased fusion of
endosomes with phagosomes, as has been previously described in
Rab5(S34N)-expressing cells (Woodman,
2000a
). We also examined infected BMMs for the distribution of
FITC-labeled M. avium with constitutively active (Q67L) and
dominant-negative (S22N) Rab7. As shown in
Figure 2D only a limited number
of mycobacterial phagosomes stained positive for the Rab 7 mutant
proteins.
Mycobacterial Trafficking in Macrophages Expressing Wild-type or
Mutant Rab5 or Rab7
The previous experiments suggest that the mycobacteria were retained within
an early phagosomal compartment in BMMs expressing WT or Rab5(Q79L). To
further define the mycobacterial cellular localization, we used confocal
immunofluorescence microscopy to determine if the transferrin receptor (TR) or
the lysosome-associated membrane protein 1 (LAMP1) localized to the
mycobacterial phagosome in Rab5 transduced BMMs. As predicted, in wild-type
and Rab5(Q79L)-expressing cells we observed
8095% of the
mycobacterial phagosomes to stain positive for the transferrin receptor, an
early/recycling endosome marker, whereas only
1015% contained
detectable LAMP1, a late endosome/lysosome marker
(Figure 3A-B, D-E, and G). This
suggests that an increased level of active Rab5 in BMMs is not sufficient to
force the mycobacterial phagosome through the maturation process. In contrast,
the mycobacterial phagosomes in BMMs expressing the dominant negative Rab5
showed limited TR staining and increased LAMP1 staining compared with cells
expressing Rab5 WT (Figure 3, C, F, and
G). LAMP2, another late endosome/lysosome marker, also colocalized
with M. avium 101 in BMMs expressing Rab5(S34N;
Figure 3H). These studies
suggest that expression of Rab5(S34N) results in increased transport of M.
avium to a late endosome or lysosome compartment. This finding was
unexpected because Rab5(S34N) has previously been shown to reduce the rate of
ligand trafficking (McCaffrey et
al., 2001
). However, we did observe other features
characteristic of the Rab5 mutants, including enlarged and fragmented
TR-positive endosomes in Rab5(Q79L) and Rab5(S34N) expressing BMMs
(Figure 3, B and C, respectively).
|
Similar staining studies were done with wild-type and mutant Rab7s. Unlike the Rab5 results, we observed no significant differences in transduced BMMs between vector alone, wild-type, Q67L and S22N Rab7 in the TR and LAMP1 staining of the mycobacteria phagosome (Figure 3G).
To further compare our system with published data, we evaluated the
transport of the fluid phase marker dextran through the endocytic pathway in
Rab5-transduced BMMs. The murine BMMs were retrovirally infected with Rab5 WT,
Q79L and S34N expression constructs and then treated with Texas
Redlabeled dextran as described in the MATERIALS AND METHODS. As
predicted, dextran was rapidly transported to a LAMP1-positive compartment in
BMMs expressing WT or Rab5(Q79L; Figure 4,
B and C). However, in BMMs expressing Rab5(S34N), colocalization
of dextran with LAMP1 was markedly diminished compared with control cells
(Figure 4, A and D). This
indicates that the dominant-negative Rab5-expressing BMMs are limited in their
endocytosis and trafficking, as predicted from previous studies in cells
expressing Rab5(S34N; Barbieri et
al., 1994
; Li et
al., 1994
). Thus, although expression of Rab5(S34N) markedly
diminished fluid phase uptake and transport, it stimulated M. avium
transport to a late endosome/lysosome compartment.
|
M. avium within Rab5 S34N-expressing Macrophages Showed Decreased
LAMP1 Staining in Cells Preloaded with Free Iron But Not Transferrin-bound
Iron
To further investigate the findings described above, we tested the
hypothesis that a limitation in iron acquisition by M. avium, due to
decreased fusion of mycobacteria phagosomes with early endosomes, is
responsible for the acquisition of late endosome markers in
Rab5(S34N)-expressing BMMs. Iron is required for mycobacterial growth
(De Voss et al.,
1999
; Lounis et al.,
2001
). Mycobacteria have evolved high-affinity siderophores,
exochelins, which function to bind extracellular iron and mycobactins whose
role is to transport iron into the mycobacteria
(Raghu et al., 1993
).
Recent studies by Schlesinger and colleagues demonstrate that inhibition of
iron acquisition by intracellular M. tuberculosis in human BMMs
results in increased killing of the mycobacteria
(Olakanmi et al.,
2000
). In these studies they also showed that intracellular M.
tuberculosis was accessible to radiolabeled iron added to the macrophage
culture media. Together, these data suggest that intracellular mycobacteria
can obtain iron through the macrophage and that this iron acquisition is
required for their intracellular survival.
To test our hypothesis, we examined the effect of supplementing
Rab5(S34N)-transduced BMMs with exogenous iron. Previous studies have shown
that nontransferrin-bound iron can be absorbed by the human monocyte-like cell
line THP-1 (Scaccabarozzi et al.,
2000
). Additional studies with rat hepatocytes indicate that
Fe-citrate can be taken in by facilitated diffusion
(Baker et al., 1998
).
Furthermore, using 59Fe-chloride we observed that the BMMs can
absorb iron (our unpublished results). Therefore, we investigated how
"iron-loading" the M. avium would affect its trafficking
in Rab5(S34N)-expressing BMMs. In dominant-negative Rab5-expressing cells,
incubated with 100 µM Fe-citrate, there was a significant decrease in the
number of M. avium phagosomes staining positive for LAMP1 compared
with noniron-treated macrophages
(Figure 5A). The addition of
Fe-bound transferrin to Rab5(S34N)-transduced BMMs using the same protocol
indicated for Fe-citrate had no affect on M. avium transport to a
LAMP1-positive compartment (Figure
5B). This is likely due to limited uptake of transferrin-bound
iron in cells expressing dominant-negative Rab5
(Stenmark et al.
1994
) and the already high concentration of transferrin-bound iron
in fetal calf serum.
|
Iron is known to have various effects on host cell activities including
increased expression of TNF-
mRNA and TNF-
secretion in
PMA-differentiated THP-1 cells
(Scaccabarozzi et al.,
2000
). Therefore, we tested whether the influence of iron on
mycobacterial localization was specific to BMMs expressing Rab5(S34N) or
whether it had a general effect on mycobacterial trafficking. As shown in
Figure 6, we observed minimal
LAMP1 but strong TR staining of M. avium phagosomes in nontransduced
BMMs or macrophages transduced with pLZRS or Rab5 WT in the presence of
Fe-citrate, similar to our earlier findings (see
Figure 3). This indicates that
treatment of BMMs with Fe-citrate is not affecting the positioning of the
mycobacteria within the endocytic pathway unless the BMMs are expressing the
dominant negative Rab5.
|
Further support for iron having a direct effect on mycobacteria comes from
our experiments using gallium, a group IIIA metal. Gallium (Ga) can be
absorbed by macrophages in a transferrin-dependent and -independent manner and
can substitute for iron in many biomolecular complexes
(Chitambar and Zivkovic, 1987
;
Olakanmi et al.,
1994
). However, Ga is unable to undergo redox cycling and
therefore disrupts the function of many iron-binding proteins such as
ribonucleotide reductase, thus affecting DNA replication
(Chitambar et al.,
1988
). Olakanmi and colleagues found that addition of Ga to M.
tuberculosisinfected human macrophages resulted in increased
killing of the mycobacteria, which was likely preceded by increased
phagosome-lysosome fusion (Olakanmi et
al., 2000
). We found that addition of 500 µM Ga-citrate to
M. aviuminfected macrophages resulted in a significant
increase in colocalization between LAMP1 and mycobacteria compared with
infected control BMMs (29.8 ± 80% of M. avium phagosomes
staining positive for LAMP1 in Ga-treated BMMs compared with 8.0 ± 1.1%
in untreated infected cells; mean ± SD from three separate
experiments). These results support our hypothesis that an adequate iron
concentration within the M. avium phagosome is required for
mycobacteria to maintain its block of the phagosome maturation process.
Previous studies have demonstrated that killed mycobacteria show increased
trafficking to late endosome/lysosome compartments compared with live bacilli
(Clemens and Horwitz, 1995
),
suggesting that metabolic activity is required for mycobacteria to maintain
itself within an early phagosome compartment. Therefore we would predict that
addition of iron would not affect transport of dead mycobacteria through the
phagosome maturation process in Rab5(S34N)-expressing BMMs. As shown in
Figure 7, colocalization
between LAMP1 and heat-killed M. avium in macrophages expressing
dominant-negative Rab5 was not effected by the addition of iron. Further,
expression of Rab5(S34N) in BMMs did not result in increased transport of
heat-killed M. avium to a LAMP1-positive compartment compared with
nontransduced, pLZRS, or Rab5 WT transduced BMMs, indicating that the effect
of dominant negative Rab5 on M. avium transport is limited to live,
metabolically active mycobacteria.
|
As noted above, limiting accessibility of phagocytosed M.
tuberculosis to iron resulted in decreased mycobacteria viability
(Olakanmi et al.,
2000
). To determine if this was also the case for BMMs expressing
Rab5(S34N), we infected transduced and control BMMs with M. avium 101
and defined colony counts overtime (6 h to 12 d). As shown in
Figure 8, there was a
significant decrease in colony-forming units isolated from
Rab5(S34N)-expressing BMMs over the 12-d infection period. This was not
observed for the Rab5 WT or pLZRS-transduced BMMs or for nontransduced cells,
indicating that expression of Rab5(S34N) in BMMs results in decreased M.
avium viability. This is likely due, at least in part, to decreased
accessibility of M. avium to iron in these transduced cells.
|
| DISCUSSION |
|---|
|
|
|---|
Our ability to dissect the mechanism by which mycobacteria inhibit the
phagosome maturation process would be facilitated by introducing various
molecules involved in the vesicle fusion process and then determine their
effect on mycobacterial trafficking. However, introducing genes into primary
macrophages, the host cell for mycobacteria, has been problematic. We have
used a second generation retrovirus transduction system to introduce genes
into murine bone marrowderived macrophages
(Michiels et al.,
2000
). This system has a number of advantages: 1) the genes
introduced into the macrophage are inserted into the chromosome, maintaining
increased stability of the DNA compared with episomally replicating plasmids,
2) expression levels using retroviral systems are typically 23-fold
higher than endogenous protein and therefore problems associated with marked
protein overexpression are not observed, and 3) we were able to consistently
obtain >85% of the primary macrophages to express recombinant protein by
this method.
In our study we addressed whether Rab5 and Rab7 are targets of the
mycobacteria in modulating the phagosome maturation process by introducing
these proteins in their wild-type, constitutively active and dominant negative
forms into murine BMMs. The small-molecular-weight GT-Pases Rab5 and Rab7 are
important in trafficking material through the endocytic pathway. Rab5
functions in both endocytosis from the plasma membrane and homotypic fusion
between early endosomes (Li,
1996
; Somsel Rodman and
Wandinger-Ness, 2000
). Rab7 regulates transport from the early
endosome to the late endosome (Feng et
al., 1995
; Mohrmann and
van der Sluijs, 1999
). Previous studies, using the murine
macrophage cell line J774, indicate that M. bovis BCG phagosomes
retain Rab5 but fail to acquire Rab7 (Via
et al., 1997
). Our studies with primary murine
macrophages also showed M. avium phagosomes to retain wild-type or
constitutively active Rab5 and exclude wild-type or constitutively active
Rab7. This suggests that increased expression of activated Rab5 or Rab7 does
not alter the trafficking of the M. avium significantly. This was
supported by the colocalization of the M. avium phagosome with the
transferrin receptor but not LAMP1, indicating retention of the mycobacteria
in an early endosome/recycling compartment.
An interesting result from our studies was the augmented LAMP1 and LAMP2
staining of the M. avium phagosome in macrophages expressing the
dominant negative Rab5, indicating an increased transport to a late
endosome/lysosome compartment. This was specific since expression of dominant
negative Rab7 in BMMs had no effect on M. avium trafficking compared
with nontransduced cells. Our results were unexpected as previous studies have
shown decreased endocytosis of transferrin receptor in Rab5(S34N)-expressing
cells (Stenmark et al.,
1994
). Expression of Rab5(S34N) also decreases transport of
endocytosed material to a lysosomal compartment as indicated by a 50%
reduction in LDL and EGF degradation in transfected HeLa cells
(McCaffrey et al.,
2001
). Our results from the dextran uptake experiments also
suggest a role for Rab5(S34N) in the endocytic process because colocalization
between intracellular LAMP1 and Texas Redlabeled dextran was
significantly diminished in Rab5(S34N)-expressing BMMs compared with control
cells. However, these results may be due primarily to the importance of Rab5
in the endocytic process rather then its role in the maturation of early
endosomes to late endosomes and fusion with lysosomes. This is supported by
our data with the heat-killed mycobacteria where we observed no difference in
trafficking of the dead M. avium to a LAMP1-positive compartment
between WT and dominant negative Rab5-expressing BMMs.
Insight into a potential explanation for the increased transport of M.
avium to a LAMP1- and LAMP2-positive compartment in Rab5(S34N)-expressing
macrophages came from our TR localization studies. As expected, there was a
significant decrease in TR staining of the M. avium phagosome in
Rab5(S34N)-expressing macrophages compared with controls. Therefore, a
decrease in transferrin bound iron within the M. avium phagosome
would be expected. Mycobacteria, like many pathogenic bacteria, are
exquisitely sensitive to iron deprivation
(Lounis et al.,
2001
). Analysis of the M. tuberculosis genome suggests
that iron is an obligate cofactor for at least 40 different enzymes (De Voss
et al., 1999). It is involved, when complexed with heme, in electron
transport and oxygen metabolism (De Voss et al., 1999). Nonheme iron
is also a cofactor for proteins involved in amino acid and pyrimidine
biosynthesis as well as enzymes such as ribonucleotide reductase involved in
DNA synthesis and superoxide dismutase
(Edwards et al.,
2001
). However, whether iron serves as a cofactor for
mycobacterial enzymes required for blocking the phagosome maturation process
has yet to be determined.
An important aspect of the host defense against bacterial pathogens is
restriction of available iron. Natural resistance associated membrane protein
1 (Nramp1) is a well-known example of a protein whose activity is associated
with resistance to various intracellular pathogens including Leishmania,
Salmonella, and Mycobacterium
(Vidal et al., 1995
;
Bellamy, 1999
). Nramp1 is
expressed in macrophages and its expression is upregulated with IFN-
treatment, an important cytokine involved in controlling intramacrophage
pathogens (Govoni et al.,
1995
; Atkinson et al.,
1997
). Functional studies with different Nramp homologues suggest
that this class of protein functions to transport divalent cations, including
iron, across membranes (Forbes and Gros,
2001
). Therefore, a likely role for Nramp1 is to pump iron out of
the phagosome, thus limiting the amount of iron available for the pathogenic
mycobacteria (Forbes and Gros,
2001
).
There are also clinical data showing a strong correlation between iron
overload in patients and enhanced risk of death due to tuberculosis
(Murray et al.,
1978
). Animal studies suggest that iron may be a limiting factor
during a mycobacterial infection, because mice fed an iron-rich diet have a
higher M. avium infection load than mice fed a normal iron diet
(Dhople et al.,
1996
). Furthermore, studies by Schaible et al.
(2002
) indicate that the
increased susceptibility of
-2 Microglobulin null mice to M.
tuberculosis infection is due to iron overload. Finally, in vitro studies
using isolated macrophages also suggest that accessibility to iron is
essential for mycobacterial survival and replication in macrophages
(Olakanmi et al.,
2000
). More recent studies by Olakanmi et al.
(2002
) indicate that the
mycobacterial phagosome can access iron both from endocytosed transferrin and
through some internal pool of iron.
On the basis of the above, we propose that expression of Rab5(S34N) in macrophages limits the concentration of iron within the M. avium phagosome, resulting in its inability to inhibit the phagosome maturation process and increased mycobacterial killing. As mentioned previously, dead mycobacteria are trafficked to the lysosome, and therefore metabolic activity of the Mycobacterium is important for this inhibitory process. Our data support this hypothesis of iron deprivation because "iron loading," mediated by the addition of ferric citrate to the M. avium infected Rab5(S34N)-expressing macrophages, resulted in a significant decrease in LAMP1 staining of the M. avium phagosome. In contrast, addition of ferric citrate had no affect on trafficking of heat-killed mycobacteria in Rab5(S34N)-expressing macrophages. Further, in control macrophages, or macrophages expressing wild-type Rab5, where the availability of iron is not as limited, we did not observe any effect of iron on M. avium localization within the macrophage. Future analysis of the genes regulated by iron may provide us with important clues as to proteins required for Mycobacterium's ability to inhibit the phagosome maturation process.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
* Corresponding author. E-mail address: Schorey.1{at}nd.edu.
| REFERENCES |
|---|
|
|
|---|
Baker, E., Baker, S.M., and Morgan, E.H. (1998). Characterisation of non-transferrin-bound iron (ferric citrate) uptake by rat hepatocytes in culture. Biochim. Biophys. Acta 1380, 2130.[Medline]
Barbieri, M.A., Li, G., Colombo, M.I., and Stahl, P.D.
(1994). Rab5, an early acting endosomal GTPase, supports in vitro
endosome fusion without GTP hydrolysis. J. Biol. Chem.
269,
1872018722.
Bellamy, R. (1999). The natural resistance-associated macrophage protein and susceptibility to intracellular pathogens. Microbes Infect. 1, 2327.[CrossRef][Medline]
Bohlson, S.S., Strasser, J.A., Bower, J.J., and Schorey, J.S.
(2001). Role of complement in Mycobacterium avium pathogenesis:
in vivo and in vitro analyses of the host response to infection in the absence
of complement component C3. Infect. Immun.
69,
77297735.
Boshans, R.L., Szanto, S., van Aelst, L., and D'Souza-Schorey, C.
(2000). ADP-ribosylation factor 6 regulates actin cytoskeleton
remodeling in coordination with Rac1 and RhoA. Mol. Cell. Biol.
20,
36853694.
Chitambar, C.R., Matthaeus, W.G., Antholine, W.E., Graff, K., and
O'Brien, W.J. (1988). Inhibition of leukemic HL60 cell growth by
transferrin-gallium: effects on ribonucleotide reductase and demonstration of
drug synergy with hydroxyurea. Blood
72,
19301936.
Chitambar, C.R., and Zivkovic, Z. (1987). Uptake of
gallium-67 by human leukemic cells: demonstration of transferrin
receptor-dependent and transferrin-independent mechanisms. Cancer
Res. 47,
39293934.
Clemens, D.L. (1996). Characterization of the Mycobacterium tuberculosis phagosome. Trends Microbiol. 4, 113118.[CrossRef][Medline]
Clemens, D.L., and Horwitz, M.A. (1995).
Characterization of the Mycobacterium tuberculosis phagosome and evidence that
phagosomal maturation is inhibited. J. Exp. Med.
181,
257270.
De Voss, J.J., Rutter, K., Schroeder, B.G., and Barry, C.E., 3rd.
(1999). Iron acquisition and metabolism by mycobacteria.
J. Bacteriol. 181,
44434451.
Deretic, V., and Fratti, R.A. (1999). Mycobacterium tuberculosis phagosome. Mol. Microbiol. 31, 16039.[CrossRef][Medline]
Deretic, V., Via, L.E., Fratti, R.A., and Deretic, D. (1997). Mycobacterial phagosome maturation, rab proteins, and intracellular trafficking. Electrophoresis 18, 25422547.[CrossRef][Medline]
Dhople, A.M., Ibanez, M.A., and Poirier, T.C. (1996). Role of iron in the pathogenesis of Mycobacterium avium infection in mice. Microbios 87, 7787.[Medline]
Duclos, S., Diez, R., Garin, J., Papadopoulou, B., Descoteaux, A., Stenmark, H., and Desjardins, M. (2000). Rab5 regulates the kiss and run fusion between phagosomes and endosomes and the acquisition of phagosome leishmanicidal properties in RAW 264.7 macrophages. J. Cell Sci. 113(Pt 19), 35313541.[Abstract]
Edwards, K.M., Cynamon, M.H., Voladri, R.K., Hager, C.C.,
DeStefano, M.S., Tham, K.T., Lakey, D.L., Bochan, M.R., and Kernodle, D.S.
(2001). Iron-cofactored superoxide dismutase inhibits host
responses to Mycobacterium tuberculosis. Am. J. Respir. Crit. Care
Med. 164,
22139.
Feng, Y., Press, B., and Wandinger-Ness, A. (1995). Rab 7, an important regulator of late endocytic membrane traffic. J. Cell Biol. 131, 14351452.
Forbes, J.R., and Gros, P. (2001). Divalent-metal transport by NRAMP proteins at the interface of host-pathogen interactions. Trends Microbiol. 9, 397403.[CrossRef][Medline]
Fratti, R.A., Backer, J.M., Gruenberg, J., Corvera, S., and
Deretic, V. (2001). Role of phosphatidylinositol 3-kinase and
Rab5 effectors in phagosomal biogenesis and mycobacterial phagosome maturation
arrest. J. Cell Biol. 154,
631644.
Fratti, R.A., Chua, J., and Deretic, V. (2002).
Cellubrevin alterations and Mycobacterium tuberculosis phagosome
maturation arrest. J. Biol. Chem.
277,
1732017326.
Govoni, G., Vidal, S., Cellier, M., Lepage, P., Malo, D., and Gros, P. (1995). Genomic structure, promoter sequence, and induction of expression of the mouse Nramp1 gene in macrophages. Genomics 27, 919.[CrossRef][Medline]
Li, G. (1996). Rab5 GTPase and endocytosis. Biocell 20, 325330.[Medline]
Li, G., Barbieri, M.A., Colombo, M.I., and Stahl, P.D.
(1994). Structural features of the GTP-binding defective Rab5
mutants required for their inhibitory activity on endocytosis. J. Biol.
Chem. 269,
1463114635.
Lounis, N., Truffot-Pernot, C., Grosset, J., Gordeuk, V.R., and Boelaert, J.R. (2001). Iron and Mycobacterium tuberculosis infection. J. Clin. Virol. 20, 123126.[CrossRef][Medline]
Martinez, O., and Goud, B. (1998). Rab proteins. Biochim. Biophys. Acta 1404, 101112.[Medline]
McCaffrey, M.W., Bielli, A., Cantalupo, G., Mora, S., Roberti, V., Santillo, M., Drummond, F., and Bucci, C. (2001). Rab4 affects both recycling and degradative endosomal trafficking. FEBS Lett. 495, 2130.[CrossRef][Medline]
Michiels, F., van der Kammen, R.A., Janssen, L., Nolan, G., and Collard, J.G. (2000). Expression of Rho GTPases using retroviral vectors. Methods Enzymol. 325, 295302.[Medline]
Mohrmann, K., and van der Sluijs, P. (1999). Regulation of membrane transport through the endocytic pathway by rabGTPases. Mol. Membr. Biol. 16, 8187.[CrossRef][Medline]
Murray, M.J., Murray, A.B., Murray, M.B., and Murray, C.J. (1978). The adverse effect of iron repletion on the course of certain infections. Br. Med. J. 2, 11131115.
Olakanmi, O., Schlesinger, L.S., Ahmed, A., and Britigan, B.E.
(2002). Intraphagosomal Mycobacterium tuberculosis acquires iron
from both extracellular transferrin and intracellular iron pools. J.
Biol. Chem. 277,
4972749734.
Olakanmi, O., Britigan, B.E., and Schlesinger, L.S.
(2000). Gallium disrupts iron metabolism of mycobacteria residing
within human macrophages. Infect. Immun.
68,
56195627.
Olakanmi, O., Stokes, J.B., and Britigan, B.E. (1994). Acquisition of iron bound to low molecular weight chelates by human monocyte-derived macrophages. J. Immunol. 153, 26912703.[Abstract]
Palacios, F., Price, L., Schweitzer, J., Collard, J.G., and D'Souza-Schorey, C. (2001). An essential role for ARF6-regulated membrane traffic in adherens junction turnover and epithelial cell migration. EMBO J. 20, 49734986.[CrossRef][Medline]
Racoosin, E.L., and Swanson, J.A. (1993).
Macropinosome maturation and fusion with tubular lysosomes in macrophages.
J. Cell Biol. 121,
10111020.
Raghu, B., Sarma, G.R., and Venkatesan, P. (1993). Effect of iron on the growth and siderophore production of mycobacteria. Biochem. Mol. Biol. Int. 31, 341348.[Medline]
Roach, S.K., and Schorey, J.S. (2002). Differential
regulation of the mitogen-activated protein kinases by pathogenic and
nonpathogenic mycobacteria. Infect. Immun.
70,
30403052.
Russell, D.G., Dant, J., and Sturgill-Koszycki, S. (1996). Mycobacterium avium- and Mycobacterium tuberculosis-containing vacuoles are dynamic, fusion-competent vesicles that are accessible to glycosphingolipids from the host cell plasmalemma. J. Immunol. 156, 47644773.[Abstract]
Russell, D.G., Sturgill-Koszycki, S., Vanheyningen, T., Collins,
H., and Schaible, U.E. (1997). Why intracellular parasitism need
not be a degrading experience for Mycobacterium. Philos. Trans. R Soc.
Lond. B Biol. Sci. 352,
13031310.
Scaccabarozzi, A. et al. (2000). Relationship between TNF-alpha and iron metabolism in differentiating human monocytic THP-1 cells. Br. J. Haematol. 110, 978984.[CrossRef][Medline]
Schaible, U.E., Collins, H.L., Priem, F., and Kaufmann, S.
(2002). Correction of the iron overload defect in
-2-microglobulin knockout mice by lactoferrin abolishes their increased
susceptibility to tuberculosis. J. Exp. Med.
196,
15071513.
Somsel Rodman, J., and Wandinger-Ness, A. (2000). Rab GTPases coordinate endocytosis. J. Cell Sci. 113(Pt 2), 183192.[Abstract]
Stenmark, H., Parton, R.G., Steele-Mortimer, O., Lutcke, A., Gruenberg, J., and Zerial, M. (1994). Inhibition of rab5 GTPase activity stimulates membrane fusion in endocytosis. EMBO J. 13, 12871296.[Medline]
Sturgill-Koszycki, S. et al. (1994). Lack of
acidification in Mycobacterium phagosomes produced by exclusion of the
vesicular proton-ATPase. Science
263,
678681.
Thilo, L., Stroud, E., and Haylett, T. (1995). Maturation of early endosomes and vesicular traffic to lysosomes in relation to membrane recycling. J. Cell Sci. 108, 17911803.[Abstract]
Via, L.E., Deretic, D., Ulmer, R.J., Hibler, N.S., Huber, L.A., and
Deretic, V. (1997). Arrest of mycobacterial phagosome maturation
is caused by a block in vesicle fusion between stages controlled by rab5 and
rab7. J. Biol. Chem. 272,
1332613331.
Vidal, S., Gros, P., and Skamene, E. (1995). Natural resistance to infection with intracellular parasites: molecular genetics identifies Nramp1 as the Bcg/Ity/Lsh locus. J Leukoc. Biol. 58, 382390.[Abstract]
Vitelli, R., Santillo, M., Lattero, D., Chiariello, M., Bifulco,
M., Bruni, C.B., and Bucci, C. (1997). Role of the small GTPase
Rab7 in the late endocytic pathway. J. Biol. Chem.
272,
43914397.
Woodman, P.G. (2000a). Biogenesis of the sorting endosome: the role of Rab5. Traffic 1, 695701.[CrossRef][Medline]
Woodman, P.G. (2000b). Biogenesis of the sorting endosome: the role of Rab5. Traffic 1, 695701.
Xu, S., Cooper, A., Sturgill-Koszycki, S., van Heyningen, T., Chatterjee, D., Orme, I., Allen, P., and Russell, D.G. (1994). Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J. Immunol. 153, 25682578.[Abstract]
Zerial, M. (1993). Regulation of endocytosis by the small GTP-ase rab5. Cytotechnology 11, S47S49.
This article has been cited by other articles:
![]() |
S. K. Rampini, P. Selchow, C. Keller, S. Ehlers, E. C. Bottger, and P. Sander LspA inactivation in Mycobacterium tuberculosis results in attenuation without affecting phagosome maturation arrest Microbiology, October 1, 2008; 154(10): 2991 - 3001. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Weiss, C. D. Souza, O. A. Evanson, M. Sanders, and M. Rutherford Bovine monocyte TLR2 receptors differentially regulate the intracellular fate of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium J. Leukoc. Biol., January 1, 2008; 83(1): 48 - 55. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhatnagar, K. Shinagawa, F. J. Castellino, and J. S. Schorey Exosomes released from macrophages infected with intracellular pathogens stimulate a proinflammatory response in vitro and in vivo Blood, November 1, 2007; 110(9): 3234 - 3244. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Doherty and P. Andersen Vaccines for Tuberculosis: Novel Concepts and Recent Progress Clin. Microbiol. Rev., October 1, 2005; 18(4): 687 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Philips, E. J. Rubin, and N. Perrimon Drosophila RNAi Screen Reveals CD36 Family Member Required for Mycobacterial Infection Science, August 19, 2005; 309(5738): 1251 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Pethe, D. L. Swenson, S. Alonso, J. Anderson, C. Wang, and D. G. Russell Isolation of Mycobacterium tuberculosis mutants defective in the arrest of phagosome maturation PNAS, September 14, 2004; 101(37): 13642 - 13647. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Marsman, I. Jordens, C. Kuijl, L. Janssen, and J. Neefjes Dynein-mediated Vesicle Transport Controls Intracellular Salmonella Replication Mol. Biol. Cell, June 1, 2004; 15(6): 2954 - 2964. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Vergne, R. A. Fratti, P. J. Hill, J. Chua, J. Belisle, and V. Deretic Mycobacterium tuberculosis Phagosome Maturation Arrest: Mycobacterial Phosphatidylinositol Analog Phosphatidylinositol Mannoside Stimulates Early Endosomal Fusion Mol. Biol. Cell, February 1, 2004; 15(2): 751 - 760. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||