QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 14, Issue 9, 3507-3518, September 2003

This Article Abstract Full Text (PDF) All Versions of this Article: E02-12-0824v1 14/9/3507    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yeh, M.-G. Articles by Kramer, R. H. Search for Related Content PubMed PubMed Citation Articles by Yeh, M.-G. Articles by Kramer, R. H.

The 1 Cytoplasmic Domain Regulates the Laminin-binding Specificity of the 7X1 Integrin

Ming-Guang Yeh ^*, Barry L. Ziober ^* , Baomei Liu ^*, Galina Lipkina ^*, Ioannis S. Vizirianakis ^* , and Randall H. Kramer ^*  ||

^* Department of Stomatology, University of California at San Francisco, San Francisco, CA 94143-0512; Department of Anatomy, University of California at San Francisco, San Francisco, CA 94143-0512

Submitted December 15, 2002; Revised May 16, 2003; Accepted May 18, 2003
Monitoring Editor: Jean Schwarzbauer

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

 
During muscle development, the laminin-specific 7 integrin is alternatively spliced in the putative ligand-binding domain to yield either the 7X1 or the 7X2 variant. The relative level of 7X1 and 7X2 is developmentally regulated. Similarly, the partner 1 integrin cytoplasmic domain is converted from the 1A to the 1D splice variant. To determine whether 1D modulates the activity of the 7 receptor, cells were transfected with 7X1 and 1D cDNA. 7X1 coupled with 1A failed to adhere to laminin-1, whereas cotransfectants expressing 7X1 and 1D showed strong adhesion. Interestingly, 7X1 complexed with 1A and 1D displayed the same level of poor adhesion to laminin-2/4 or strong adhesion to laminin-10/11. These findings indicate that 7 function is regulated not only by X1/X2 in its extracellular domain but also by 1 cytoplasmic splice variants. It is likely that expression of 1D alters 7X1 binding to laminin isoforms by a process related to ligand affinity modulation. Functional regulation of 71 by developmentally regulated splicing events may be important during myogenic differentiation and repair because the integrin mediates adhesion, motility, and cell survival.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

 
The dynamic interaction between myoblasts and laminins is important for skeletal muscle development, regeneration, and myotube stability and survival (Vachon et al., 1997; Gullberg et al., 1999; Colognato and Yurchenco, 2000). The laminin-binding 71 integrin, expressed in mouse skeletal muscle as early as E10.5 d of development, mediates myoblast motility on laminin substrates (Kaufman et al., 1980; Kaufman et al., 1991; Yao et al., 1996a,b; Crawley et al., 1997; von der Mark et al., 2002). In mature skeletal muscle, the 7 receptor is associated with costameres and the myotendinous and neuromuscular junctions (Bao et al., 1993; Belkin et al., 1996; Martin et al., 1996; van der Flier et al., 1997). The physiological importance of 7 is demonstrated in 7-null mutant mice, which develop a form of muscular dystrophy with myotendinous junction (MTJ) defects (Mayer et al., 1997), and in humans with mutations in 7 gene, which develop congenital myopathies (Hayashi et al., 1998; Pegoraro et al., 2002).

The 7 integrin subunit is alternatively spliced in both the extracellular (X1 and X2) (Ziober et al., 1993) and the cytoplasmic (A and B) domains (Song et al., 1993; Ziober et al., 1993). During the differentiation of myoblasts to myotubes, the cytoplasmic domain of the 1 integrin is converted from isoform A to D (van der Flier et al., 1995; Zhidkova et al., 1995; Belkin et al., 1996). 1D begins to be expressed in late fetal life and eventually displaces 1A in mature muscle (Brancaccio et al., 1998). Previous studies have shown that the presence of 1D is correlated with altered adhesion and is associated with enhanced interaction with actin cytoskeleton (Belkin et al., 1996; Belkin et al., 1997; Pfaff et al., 1998). This complex differentiation-dependent pattern of 7 and 1 splicing allows the generation of a unique set of variant 71 complexes that are structurally, and presumably functionally, distinct.

Laminins, the only known ligand for 7, also undergo a complex pattern of expression during muscle development (Gullberg et al., 1999; Colognato and Yurchenco, 2000; Pedrosa-Domellof et al., 2000). Laminin-1 is expressed during embryonic and fetal stages. Interestingly, laminin-1 is concentrated at the MTJ of fetal human skeletal muscle and persists until birth. As development of muscle continues, laminin-2 and 4 become the dominant isoforms.

The X1/X2 alternative splicing of 7 is developmentally regulated (Ziober et al., 1993). In early muscle differentiation of rodent limb, 7X1 shows a relative increase in expression but postnatally the X2/X1 ratio increases (Hodges et al., 1997). Previously, we transfected mouse 7X1 and 7X2 isoforms into human MCF-7 cells, which normally adhere poorly to laminin-1 (Yao et al., 1996a; Ziober et al., 1997). In the transfectants, 7X2 bound laminin-1 readily, but 7X1 bound only when activated by the 1-activating monoclonal antibody (mAb) TS2/16. However, both X1 and X2 were functional when expressed in the HT-1080 cell line. These results indicated that alternative splicing regulates 71 ligand-binding competence in a cell-specific manner. Recently, von der Mark and collaborators reported that the X1/X2 variants have different binding specificity and affinities for laminin isoforms (von der Mark et al., 2002).

We proposed that the X1 isoform is important during dynamic adhesion related to muscle development and repair (motility, fusion, and matrix assembly), whereas the X2 variant performs more stable adhesion functions (mature junctional assembles) (Ziober et al., 1997). This is consistent with the dynamics of the expression of 7 and 1 alternatively spliced variants during development (Ziober et al., 1993) and muscle regeneration (Kaariainen et al., 2001; Kaariainen et al., 2002). Laminin isoform expression also changes during muscle development and repair (reviewed in Colognato and Yurchenco, 2000) and so the expression of integrin and potential ligand is coordinately coupled.

Integrins are capable of changing their function dynamically (Diamond and Springer, 1994; Humphries, 1996; Mould, 1996; Hughes and Pfaff, 1998). It has been proposed that certain intracellular events lead to alterations in integrin conformation, resulting in enhanced adhesion to ligand (inside-out signaling) (reviewed in Liddington and Ginsberg, 2002). Alternatively, the process of ligand binding may regulate activity of the integrin receptor (outside-in signaling). In the case of inside-out signaling, there is strong evidence that the actin cytoskeleton and its link proteins (e.g., talin) are one mechanism that can regulate integrin activation. This process may represent changes in integrin affinity or integrin-clustering events leading to increased avidity (Zent et al., 2000). However, it remains controversial whether events such as lateral rearrangements that may modulate receptor avidity can play a role in integrin function (reviewed in Shimaoka et al., 2002). As stated above, after myoblast differentiation into myotubes and mature muscle, the 1 integrin cytoplasmic alternative splice shifts from A to D. Given the consensus that the cytoplasmic domains of integrins can regulate the conformation and activity of integrin subunits, it is possible that the 1D isoform controls 7X1/X2 function. To investigate this possibility, we examined the functionality of 7 integrin in the presence of the 1A or 1D cytoplasmic domain.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

 
Materials
For cell adhesion studies, several different ligands were used as described previously. Laminin-1 isolated from the mouse EHS tumor was obtained from Invitrogen (Carlsbad, CA). Human placental merosin, consisting of laminin-2/4 isoforms purified by EDTA extraction and followed by ion-exchange chromatography was purchased from Invitrogen. Human laminin-10/11, isolated from placenta by mild pepsin digestion and by affinity chromatography on mAb 4C7-coupled Sepharose, was also from Invitrogen. A sample of recombinant laminin-10 was kindly provided by Masayuki Doi (University of Okayama, Okayama, Japan) and Karl Tryggvason (Karolinska Institute, Stockholm, Sweden). Collagen was obtained from Cohesion (Palo Alto, CA). Human vitronectin and fibronectin were gifts from Caroline Damsky (University of California, San Francisco, San Francisco, CA).

Antibodies against integrin subunits, including rat anti-human 1 (mAb AIIB2), mouse anti-human 2 (mAb VM1), rat anti-human 6 (mAb GoH3), and rabbit anti-mouse 1D cytodomain (polyclonal antibody anti-1D), were kindly provided by Caroline Damsky and Vera Morhenn (SRI International, Menlo Park, CA), Arnond Sonnenberg (Netherlands Cancer Center, Amsterdam, The Netherlands), and Eva Engvall (Burnham Institute, La Jolla Cancer Research Center, CA), respectively. Mouse anti-3 (mAb J143) was from the American Type Culture Collection (American Type Culture Collection, Manassas, VA), rat anti-mouse 1 (mAb MB1.2) and mouse anti-human 1 (mAb 2000) were from Chemicon International (Temecula, CA), rat anti-mouse 7 (mAb CY8), mouse antihuman 7 (mAb 9.1), rabbit anti-human 1 cytodomain (polyclonal antibody [pAb] 22778), and rabbit anti-mouse 7 light chain (pAb 1211) were from our laboratory, as described previously (Yao et al., 1996b, 1997; Vizirianakis et al., 2001). Fluorescein-conjugated secondary antibodies were obtained from Jackson Immunoresearch Laboratories (West Grove, PA).

Construction of Mouse 1D cDNA
The full-length mouse 1D cDNA was prepared by reverse transcription followed by polymerase chain reaction (PCR) from a mouse skeletal muscle cDNA library (BD Biosciences Clontech, Palo Alto, CA). The two primers for PCR were reverse primer, 5'-CTAGTCTAGAATTCAGAGACCAGCTTTACGTCCATAG and forward primer, 5'-CGCGGATCCGAATTCAAGATGAATTTGCAACTGGTTTCCTG. The sequence of full-length mouse 1D was verified at the Biomolecular Resource Center (University of California, San Francisco). The mouse 1D cDNA was then ligated into BamHI and XbaI sites of pcDNA3.1/Hygro (Invitrogen). Full-length mouse 1A cDNA was obtained from Louis Reichardt (University of California, San Francisco) and was cloned into the regulatable expression vector in the same manner as 1D (see below).

Cloning of Human 7X1
Full-length human 7X2 cDNA (Vizirianakis et al., 2001) was used as a template for the generation of full-length human 7X1. The X2 exon was replaced with the X1 exon by uracil DNA glycosylase excision to generate cohesive ends on the PCR product of the X1 exon. Specifically, we designed primers containing uracil that matched the corresponding T in the splicing regions. We then used these primers to generate the X1 exon by PCR from human 7 cDNA by using human fetus limb muscle RNA as template (forward primer, 5'-AAGGGUACUGCCAGGGTGGAGCTCTGTG; reverse primer, 5'-AGAAGCCAAAGUA GCUGTTGGCAGGGA). The full-length cDNA proximal to the splicing site was also generated by PCR (forward primer, 5'-CCGGGATCCATGGCCGGGGCTCGGAGCCG; reverse primer, 5'-AGTACCCUUCCAATTATAGGTTCCTGGGG). The primers for full-length cDNA distal to the splicing site were as follows: forward primer, 5'-AGCTACTTTGGCUUCUCT ATTGACTCGGGGAAAGGTCTG; reverse primer, 5'-CCGCTCGAGCTAGGCGG TGCCTGGCCCT. The three pieces of PCR products were first treated with uracil DNA glycosylase according to the manufacturer's protocol (Invitrogen) and then ligated. The ligation product was purified by gel electrophoresis followed by cloning into pCDNA3.1/Hygro and verified by sequencing.

Generation of Cell Lines
MCF-7 human carcinoma cells and the 7-transfected cells were cultured as described previously (Yao et al., 1996a; Ziober et al., 1997). MCF-7 cells do not adhere well to laminin-1 even though they express moderate levels of integrins 2, 3, and 6, which are potential receptors for this ligand. Previously, we generated MCF-7 cells expressing full-length mouse 7 cDNA containing either the X1 or X2 splice form, which formed heterodimers with the partner 1A subunit. MCF-7 cells expressing the splicing isoform 7X2 were active in binding laminin-1, whereas cells expressing 7X1 lacked ligand-binding activity (Ziober et al., 1997). The original X1/A-p expressing population was further enriched by fluorescence-activated cell sorting (FACS) by using mAb CY8 against mouse 7 to yield the X1/A cell line used in the current experiments. The X2/A cell line was derived from MCF-7 cells transfected with mouse 7X2, which heterodimerizes with the endogenous human 1A (Yao et al., 1996a).

Expression of mouse 1D in MCF-7 cells was generated in two different systems. In the first, the X1/A-p cells were stably transfected with mouse 1D cDNA by the calcium phosphate procedure (Mammalian Transfection kit; Stratagene, La Jolla, CA). After selection with hygromycin, the double transfectants (7X1/1D) were enriched by FACS after labeling with anti-mouse 1 antibody (mAb MB1.2; Chemicon International). The enriched population was thereafter called X1/D. In addition, a total of 20 single cell clones were isolated either by single cell sorting by FACS or by limiting dilution into individual wells of 96-well plates. The expression of mouse 1D was verified by immunoblot analysis with 1D-specific pAb from Eva Engvall and by flow cytometry with mAb MB1.2. A number of clones with a range of 7 and 1D levels, as determined by FACS, were chosen for further study.

In the second approach, MCF-7 cells were transfected with pTet-Off (pUHD15-1 neo; BD Biosciences Clontech), and the expression of tTA-vp16 was verified. The MCF-7 Tet-Off cells were then transfected with the full-length cDNA for either human 7X1 integrin (as described above) or human 7X2 integrin (Vizirianakis et al., 2001). We used anti-human 7 mAb 9.1 to enrich the 7-expressing population by FACS. Retroviral transduction was then used to introduce the pRevTRE plasmids (BD Biosciences Clontech) with mouse 1A or mouse 1D into the human 7 stable transfectants. In brief, Phoenix Ampho retrovirus packaging cells from American Type Culture Collection were transfected with pRevTRE 1A/1D via calcium phosphate. The mouse 1D or mouse 1A cDNA was cloned downstream of the tetracycline-responsive element and the minimal immediate early promoter of cytomegalovirus (P_minCMV). Retroviral supernatants were then used to infect 7-expressing cells. To test the regulation of expression, cells were cultured with various concentrations of doxycycline. After retroviral induction, cells were screened by FACS with mAb MB1.2 against mouse 1 ectodomain, and cell lines with high expression of mouse 1 integrin in the absence of doxycycline and low background in the presence of doxycycline were selected for further study. MCF-7 Tet-Off cells with human 7X1/mouse 1A, human 7X1/mouse 1D, or human 7X2/mouse 1A were designated HuX1/A, HuX1/D, and HuX2/A, respectively. For adhesion assays, cells were typically cultured for 5–7 d in the presence of doxycycline (0.3 ng/ml or less) to stabilize integrin expression levels.

Flow Cytometry
Standard procedures for flow cytometry were followed (Yao et al., 1996a). Briefly, cells (10⁶/ml) were incubated with predetermined optimal concentrations of primary antibodies, washed, and incubated with secondary FITC-conjugated fluorescein-labeled antibodies (affinity-purified goat anti-mouse or anti-rat antibodies; Jackson Immunoresearch Laboratories). After washing, the cells were stained with propidium iodide and processed for flow cytometry on an FACScan (BD Biosciences, San Jose, CA). Samples without primary or secondary antibody were always included as a control. Data are expressed as the mean fluorescence intensity after subtraction of background staining produced by secondary antibody alone (<5% of signal).

Cell Adhesion Assay
Cell attachment was measured using a published protocol (Yao et al., 1996a; Ziober et al., 1997). Briefly, microtiter plates (96-well Immulon 1B plates; Thermo Labsystems, Franklin, MA) were coated with matrix proteins at the indicated concentrations in phosphate-buffered saline for 1 h at 37°C. Single cell suspensions were prepared and assayed in triplicate in 96-well plates with an incubation period of 30–60 min at 37°C. Normally, cell adhesion assays were performed using a short time of incubation (30 min) at the lower range of ligand-coating concentrations to preferentially study early stages of adhesion. Adherent cells were fixed, stained with crystal violet, and solubilized in 2% SDS. Absorbance was read at 562 nm. Background cell adhesion to 1% bovine serum albumin-coated wells (usually <5% of value) was subtracted from all readings. Values for total cell input per well to represent 100% attachment were determined by seeding cells on a separate microtiter plate coated with collagen type I or polylysine (10 µg/ml) followed by incubation at 37°C for 120 min. The 100% attachment value was then estimated by fixation on the monolayer and staining with crystal violet as described above. The effect of specific blocking antibodies was tested by preincubating the cells with an optimal blocking concentration of mAb on ice for 30 min before the assay. Optional concentrations of the blocking antibodies were predetermined and used as described previously (Yao et al., 1996a; Ziober et al., 1997). The concentrations of integrin function-blocking mAb were as follows: 10 µg/ml purified GoH3 (anti-6) and J143 (anti-3). VM1 (anti-human 2) ascites were used at a dilution of 1:400. Both CY8 (anti-mouse 7) and AIIB2 (anti-human 1) ascites were used at a dilution of 1:300. Cytochalasin D was purchased from Sigma-Aldrich (St. Louis, MO) and dissolved in dimethyl sulfoxide (DMSO). Adhesion assays included control cells treated with DMSO alone (final concentration, 0.2%). The cells were processed as described above except that they were pretreated with 20 µM cytochalasin D or DMSO alone for 20 min on ice before the assay.

Immunoprecipitation and Western Blotting of Cell Lysates
Cell lysates were prepared by extraction of cells with lysis buffer (1% Triton x 100 in 50 mM Tris-HCl, pH 7.5, 1 mM CaCl₂, with 2 mM phenylmethylsulfonyl fluoride, 1 mM N-ethylmaleimide, and 2 mM leupeptin as protease inhibitors) for 90 min and centrifuged. The supernatants were precleared with agarose beads coupled with secondary antibodies overnight. For the purpose of depletion analysis, aliquots of cell lysates (600 µg of protein) were immunoprecipitated with antibody against 2, 3, or 7 for three consecutive rounds. The beads were pooled and washed with wash buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM MgCl₂, 0.5% Nonidet P-40, and 0.1% bovine serum albumin) three times and heated at 100°C with SDS sample buffer. Samples including controls for whole cell lysates (10 µg protein/lane) were processed for SDS-PAGE under nonreducing conditions and then transferred to Immobilon-P membranes (Millipore, Bedford, MA). The membranes were incubated with rabbit antibody against human integrin 1 (pAb 22778) (Martin et al., 1996; Yao et al., 1997) or mouse 1 (mAb 2000; Chemicon International). In a different approach to assess the 7 preference to 1A or 1D, equal amounts of cell lysate (500 µg of protein) prepared from X1/D-27 cells (a clone of X1/D cells) were immunoprecipitated with human 1A or mouse 1D antibody for three consecutive rounds. The samples were then processed as described above except under reducing conditions for immunoblotting and probed with rabbit antibody (pAb 1211) against mouse 7 (Yao et al., 1997).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

 
Expression and Adhesive Activity of 7X1/1D Transfectants
To test the hypothesis that alternatively spliced amino acid sequences in the 1 cytoplasmic domain may regulate the activity of the 7 integrin, we transfected human MCF-7 cells with mouse 7X1 alone (X1/A cell line) or with both mouse 7X1 and 1D cDNA (X1/D cell line). After selection, the transfectants expressed high levels of 7X1 and 1D at their surface, as detected by flow cytometry with mAb directed against 7 (CY8) or mouse 1 (MB1.2) (Table 1). The level of 7 expression in the X1/A AND X2/A cell lines were found to be similar. In the case of the double transfectant X1/D, the X1 level was somewhat lower than that of the X1/A cell line from which it was derived.

View this table: [in this window] [in a new window]   Table 1. Expression levels of mouse 7 in transfectants

To assess whether X1/D and X1/A cells displayed different adhesion profiles, we used standard adhesion assays to examine their ligand binding to the extracellular matrix components vitronectin and type I collagen. On these immobilized ligands, X1/A and X1/D cells showed a similar ligand dose-response pattern (Figure 1, A and B) over a range of ligand-coating concentrations. Thus, expression of 1D did not alter the adhesion of 7X1-expressing cells to these components. Previous reports showed that in MCF-7 cells, adhesion to vitronectin and type I collagen was mediated primarily by v1 (Maemura et al., 1995) and 21 integrins (Jones et al., 1995; Maemura et al., 1995), respectively. This result indicated that there was no change in the general adhesion activity toward type I collagen or vitronectin in the transfectants.

View larger version (13K): [in this window] [in a new window]   Figure 1. Adhesion of X1/A and X1/D transfectants to matrix molecules. Ligand dose-response analysis of adhesion to vitronectin (A), type I collagen (B), and laminin-1 (C). Effect of anti-integrin antibodies on adhesion to laminin-1 (D). Cell adhesion was assayed as described in MATERIAL AND METHODS. Values are the mean of triplicate wells; bars indicate SE. In D, ligand coating concentration was 12 µg/ml.

We previously reported that MCF-7 cells expressing 7X1 with the endogenous human 1A partner adhered poorly to laminin-1 (Ziober et al., 1997). However, after transfection with cDNA of the mouse 1D subunit, X1/D cells acquired the capacity to strongly bind laminin-1 (Figure 1C). This increase in adhesion was evident at coating concentrations above 8 µg/ml. We also generated 20 single cell clones by limiting dilution and by single cell sorting (see below). A number of representative clones were chosen for the same assay, and the results were similar (our unpublished data). Because the stimulatory effect of 1D on adhesion was restricted to laminin-1 and not vitronectin or collagen I, this suggested that laminin-binding integrins such as 7X1, but not other potential 1 partner subunits, were involved. The poor adhesion of X1/A cells to laminin-1 was not related solely to the level of 7X1 expressed at the surface, because this cell line had a significantly higher expression level of 7X1 than did X1/D cells (Table 1).

Enhanced Adhesion of 1D Transfectants to Laminin-1 Is 7 Specific
To establish that the 1D-induced increase in laminin-1 adhesion was attributable specifically to 7X1, we performed standard adhesion assays with blocking mAb against other expressed subunits (Figure 1D). The 7X1-expressing cells (X1/A) showed poor adhesion to laminin-1, and adhesion could be diminished further by treatment with a cocktail of blocking mAb to 2, 3, and 6 integrins. In contrast, the X1/D cells expressing 1D showed strong adhesion to laminin-1, and most of this activity was resistant to the mixture of antibodies to 2, 3, and 6 integrins. Importantly, blocking mAb CY8 to 7 completely ablated adhesion to laminin-1.

Analysis of Integrin Complexes in the 1D Transfectants
To determine what fraction of the 7 subunit was partnered with endogenous 1A or transfected 1D, two different strategies were used. In the first, lysates prepared from X1/D cells were exhaustively immunoprecipitated with mAb specific to either human 1 or mouse 1, followed by immunoblotting for partner 7 (Figure 2A). The results show that the fraction of 7 that heterodimerized with either the mouse 1D (lane 5) or the human 1A (lane 6) isoform was approximately equal. Thus, neither subunit seems to have any preferential affinity for 7 during integrin heterodimerization.

View larger version (34K): [in this window] [in a new window]   Figure 2. Association of 7 with 1D. (A) Immunodepletion of lysates with antibody against 1. To determine the relative association of 7 with human 1 or with mouse 1, X1/D double transfectant cells were processed for immunodepletion experiments by using antibodies against the 1D (mouse) or 1A (human) subunit as described in MATERIALS AND METHODS. Cell lysates were prepared from X2/A cells (lane 1) or X1/D cells (lane 2) as controls for 7 expression. Equal amounts of X1/D cell lysate were subjected to preclear control (beads and secondary antibody only, lanes 3 and 4). X1/D cell lysate was exhaustively precipitated with mAb against mouse 1 (mAb MB1.2, lane 5) or against human 1 (mAb AIIB2, lane 6), and after depletion with mouse 1 (lane 7) or human 1 (lane 8) of X1/D cell lysates, supernatants were subjected to a final additional round of immunoprecipitation to confirm depletion. Immunoprecipitates were analyzed by SDS-PAGE under reducing conditions, followed by Western blotting with anti-7 antibody and visualized by chemiluminescence. The position of the 38-kDa 7 light chain is indicated. (B) Immunodepletion of cell lysates with antibody against 7. Cell lysate from X1/D-27 cells (a clone of X1/D cells) were immunoprecipitated with mAb to 7. Immunoprecipitates were processed for immunoblotting under nonreducing conditions and probed with rabbit antibodies specific to 1A (left) or 1D (right) and by chemiluminescence. Lane 1, whole cell lysate; lane 2, control anti-rat IgG-beads; lane 3, anti-7. The position of the mature 1 subunit is indicated. (C) Same procedures as in (B) except the lysates (lane 1) were processed for immunoprecipitation with anti-2 integrin (mAb VM1 [lane 2]) and anti-3 integrin (mAb J143 [lane 3]) and blotted with antibodies against 1A (left) or 1D (right).

In the second approach to estimate the relative pairing of 7 integrin subunit with endogenous 1A or transfected 1D, we used the X1/D-27 cell line, which expresses high levels of both 7X1 and 1D (Figure 2B). Cells were first processed for immunoprecipitation with anti-7 antibody, followed by immunoblotting analysis with antibody specific for either human 1(A isoform) or mouse 1(D isoform). Again, similar levels of 1A and 1D were detected in the immunoprecipitates (Figure 2B, lane 3, left and right panels). There seemed to be an abundance of 1D precursor (Figure 2B, lane 1; right) compared with the mature, fully processed form of the subunit. In contrast, nearly all of the endogenous 1A subunit was present in the mature form (Figure 2B, lane 1; left). Similarly, we found that 2 and 3 integrin subunits were associated with equivalent proportions of 1A and 1D (Figure 2C). In other studies, we examined the amount of integrin subunits associated with 1A and 1D by immunoprecipitation of [³⁵S]methionine-labeled cells; similar results were observed (our unpublished data). On the basis of these studies, we concluded that 7 as well as 2 and 3 subunits were able to complex with similar efficiency to 1A and 1D subunits.

Adhesion to Laminin-1 Correlates with 7X1 and 1D Levels
To further define the relationship between 1D and 7 activity, we compared the relative adhesion to laminin-1 of a large series of 7/1D-expressing clones and cell lines. A three-dimensional scatter plot summarizing these results indicates that adhesion to laminin-1 strictly correlated not only with the expression of 7, but also with the relative level of expression of 1D (Figure 3). The parental cells with endogenous 1A (MCF-7) or cells transfected with 7X1 alone (X1/A) showed poor adhesion to laminin-1. The 7X1 and 1D double transfectants (X1/D and clones 10, 12, 13, 17, 21, and 27) showed a strong correlation between levels of 7 and 1D expression. Thus, the expression of mouse 1D in MCF-7 cells transfected with 7X1 consistently enhanced the expression of 7 in this system. The level of 7 increased in parallel with that of the transfected mouse 1D and correlated with correspondingly greater adhesion to laminin-1. Furthermore, transfection of cells with mouse 1A or 1D in the absence of 7 to yield the 1A or 1D cell lines did not result in enhanced adhesion to laminin-1. This result indicated that the overexpression of mouse 1A or 1D was unable to augment adhesion activity of endogenous 2, 3, or 6 integrins for laminin-1. In other studies, we generated human 7X1- and 7X2-expressing MCF-7 Tet-Off cells and found that these transfectants showed a similar adhesion profile to laminin-1, with 7X1 showing poor binding to laminin-1 and 7X2 showing strong binding (our unpublished data).

View larger version (49K): [in this window] [in a new window]   Figure 3. Adherence to laminin-1 correlates with the surface expression level of 1D. MCF-7 transfectants and clones derived from X1/D double transfectants were compared in standard adhesion assay as described in Figure 1. Parental cells (MCF-7), transfectants expressing 7X1 (X1/A), mouse 1A (1A), or mouse 1D (1D) all showed poor adhesion to laminin-1. The 7X1 and 1D double transfectants (X1/D and its derived cell clones) showed increased adhesion to laminin-1 that correlated closely with the relative level of 1D and 7X1 integrin expression.

Functionality of Human 7X1 in Cells Expressing Tetracycline-regulatable 1D
In a parallel approach to establish the role of integrin 1 cytoplasmic variants on the expression and function of human 7, we created stable cell lines constitutively expressing either the human 7X1 or 7X2 isoform and tetracycline-regulatable mouse 1A or 1D integrin. These cell lines were designated as HuX1/A, HuX1/D, and HuX2/A were selected for further study. To regulate the expression of mouse 1 integrin, cells were cultured in medium containing increasing concentrations of doxycycline, and integrin expression was then measured by FACS by using mAb to 7 integrin and mouse 1 integrin. Doxycycline suppressed the expression of mouse 1 integrin in a dose-dependent manner (Figure 4A) and at the lower range of doxycycline shown the integrin expression was linear. The sensitivity to regulation by doxycycline repression of HuX1/A and HuX1/D differed slightly; the HuX1/D required about twice the doxycycline concentration to suppress mouse 1 integrin expression compared with that required for the HuX1/A. Expression of mouse integrin was completely suppressed with a doxycycline concentration of >1 ng/ml for 1D and 0.65 ng/ml for 1A. By modulating the levels of doxycycline, comparable levels of mouse 1 integrin expression were reached for both cells (Figure 4A). Due to the difference in sensitivity to doxycycline repression, we chose to use 0.1 and 0.3 ng/ml doxycycline for HuX1/A and HuX1/D, respectively, for subsequent adhesion assays on laminin-1. HuX1/A, HuX1/D, and HuX2/D cells were cultured at this low concentration of doxycycline, the integrin profile as detected by FACS is summarized in Table 2. Importantly, for the Tet-Off cells, high levels of human 7 and the mouse 1 level are maintained at increasingly higher levels as the doxycycline concentration was lowered. The mouse 1 seems to be the dominant subunit compared with the endogenous human 1A. As the level of mouse 1A or 1D integrin was increased after induction, we observed a corresponding increase in 7 surface expression (Figure 4B). The levels of induced expression of 7 were 5–6 times that of the background expression at high doxycycline concentrations. If the concentration of doxycycline was further reduced, the increase in integrin expression eventually reached a plateau (our published data). Analysis of integrin profiles revealed that, besides 7 and 1D subunits, other major endogenous integrins (human 2, 3, and 1A) remained relatively stable as the regulatable 1D was modulated (Figure 4C and Table 2). It is interesting that as the level of regulatable mouse 1D expression was increased there was no significant increase in the surface expression of 2, 3 integrins (Figure 4C). This may be due to the high level of 7 precursor that is able to compete for available 1. Presumably, as more mouse 1 is synthesized, the 7 heterodimers continue to be preferentially assembled and expressed at the surface.

View larger version (21K): [in this window] [in a new window]   Figure 4. 1D expression promotes adhesion of human 7X1 Tet-Off cells to laminin-1. MCF-7 cells expressing human 7X1 and transfected with tetracycline-regulatable mouse 1A or 1D, were tested for adhesion to laminin-1. The double transfectants (HuX1/A and HuX1/D) were cultured with the indicated concentration of doxycycline (dox) and then processed for adhesion. Expression levels of mouse 1 (A) and human 7X1 (B) was determined by FACS analysis as detailed in the text. Data is expressed as the mean fluorescence intensity (MFI) of 10,000 cells scanned. (C) Expression levels of endogenous 2, 3, and 1A integrins were determined for HuX1/D cells as in (A). (D) Corresponding adhesion efficiency to laminin-1. Values are the mean of triplicate wells; bars indicate SE. x-axis, the concentration of dox used for HuX1/D and HuX1/A are indicated. Cell adhesion was performed as described in Figure 1 with a ligand-coating concentration of 12 µg/ml.

View this table: [in this window] [in a new window]   Table 2. Expression levels of human 7 in tetracycline-regulatable double transfectants

We also analyzed the influence of relative 7X1 and 1 expression on the adhesion of doxycycline-regulatable cells to laminin-1 in standard attachment assays (Figure 4D). Mouse 1A-expressing cells showed poor adhesion at all levels of 1A integrin expression even though 7X1 was increased several fold over the range of doxycycline treatment (Figure 4B). In contrast, induction of 1D at low doxycycline concentrations resulted in a strong adhesive response to laminin-1 that corresponded to elevated 1D and 7X1 expression levels. In fact, the elevation in adhesion to laminin-1 correlated closely to the increase in 7X1 expression. For comparison, we also analyzed the adhesion efficiency of Tet-Off cells expressing 7X2/A and 7X2/D. We found no significant difference in adhesion to laminin-1 between 7X2 cells expressing either 1A or 1D (our unpublished data). Both double transfectants adhered strongly to laminin-1 (70–85%). This result indicated that 7X2 is fully functional for adhesion to laminin-1 and that exogenous 1D did not enhance the adhesion further.

Expression of 1D Does Not Alter Adhesion of 7X1 to Laminin-2/4 or Laminin-10/11
The above-mentioned results indicate that 1D was able to modify the binding of 7X1 to laminin-1. We compared the relative adhesion efficiency of 7X1-expressing cells in the presence of 1A or 1D to available laminin isoforms. We first tested the adhesion of 7-expressing cells on preparations of human placental merosin. Previous analyses have indicated that these preparations contain primarily human laminin-4 (221, S-merosin) with lesser amounts of laminin-2 (211, merosin) (Delwel et al., 1994; Spinardi et al., 1995; Yao et al., 1996a). Thus, we tested the relative adhesion of HuX1/A, HuX1/D, and HuX2/A to human merosin (laminin-2/4) (Figure 5A). Interestingly, cells expressing 7X1/1A (HuX1/A) or 7X1/1D (HuX1/D) adhered poorly. In contrast, cells expressing 7X2/1A (HuX2/A) showed strong attachment. Adhesion by HuX2/A cells to laminin-2/4 was not sensitive to a mixture of mAbs to 2, 3, and 6 integrins, but adhesion was completely blocked by anti-7 mAb 9.1 (Figure 5B).

View larger version (21K): [in this window] [in a new window]   Figure 5. Expression of 1D does not enhance the adhesion of 7X1 to laminin-2/4. HuX1/A, HuX1/D, and HuX2/A cells were tested for their adhesion to laminin-2/4. (A) Ligand dose-response analysis was done in the presence of a mixture of blocking antibodies to integrins 2, 3, and 6. (B) 7 integrin mediates adhesion of HuX2/A to laminin-2/4. The addition of 7-perturbing antibody completely blocked the adhesion of X2/A cells to laminin-2/4. The ligand-coating concentration was 15 µg/ml. Values are the mean of triplicate wells; bars indicate SE.

In a similar manner, we examined the adhesion capacity of these three cell lines to laminin-10/11 (Figure 6A). In contrast to adhesion on laminin-2/4 substrates, HuX2/A adhered poorly to laminin-10/11. Whereas HuX1/A and HuX1/D both attached well to this substrate, HuX2/A displayed poor adhesion even at high ligand coating concentrations. Treatment of cells with anti-human 7 blocking mAb effectively inhibited adhesion confirming that this receptor is mediating binding (Figure 6B). Similar results were obtained using recombinant human laminin-10 (our unpublished data). Together, these results show that replacing 1A with 1D confers activity of 7X1 for laminin-1 but does not alter binding of the double transfectants to laminin-2/4 or laminin-10/11 substrates.

View larger version (20K): [in this window] [in a new window]   Figure 6. Expression of 1D does not alter adhesion of 7X1 to laminin-10/11. HuX1/A, HuX1/D, and HuX2/A cells were tested for their adhesion to laminin 10/11. (A) Ligand dose-response analysis was done in the presence of a mixture of blocking antibodies to integrins 2, 3, and 6 (Figure 5 legend). (B) Addition of 7-perturbing antibody blocked the adhesion of HuX1/A and HuX1/D cells to laminin 10/11. The coating concentration was 7 µg/ml. Values are the mean of triplicate wells; bars indicate SE.

Cytochalasin D Modulates HuX1/D Adhesion to Laminin-1
Integrin–cytoskeletal interactions have been shown to influence both integrin clustering and extracellular domain conformation. It is well established that integrins connect to the cytoskeleton through the cytoplasmic domain of the subunit and evidence indicates that talin may play an important role in regulating integrin activity by binding to the 1 cytoplasmic domain (Liddington and Ginsberg, 2002). Furthermore, it has been shown that the 1D tail binds talin better than the 1A cytoplasmic domain (Belkin et al., 1997; Pfaff et al., 1998). To test the potential importance of cytoskeleton linkage to the adhesion activity of 7X1-expressing cells, we assayed binding of MCF-7 Tet-Off double transfectants to laminin-1 substrates in the presence of cytochalasin D, an inhibitor of actin polymerization. Treatment of cells with 20 µM cytochalasin D did not affect the adhesion of the HuX1/A and HuX2/A cell lines to laminin-1 substrates (Figure 7). However, the presence of the drug reduced HuX1/D cell adhesion to laminin-1 by nearly 70%. Adhesion of all cell lines to type I collagen was unaffected by cytochalasin D (our unpublished data). These results suggest that the formation of polymerized actin during the adhesive process was necessary for the 1D to confer enhanced binding of 7X1 to laminin-1.

View larger version (14K): [in this window] [in a new window]   Figure 7. Cytochalasin D modulates adhesion of HuX1/D cells to laminin-1. HuX1/A, HuX1/D, and HuX2/A cells were assayed for adhesion to laminin-1 in the presence or absence of cytochalasin D. Cells were preincubated with cytochalasin D (20 µM) or DMSO carrier (0.2%) on ice for 20 min before the adhesion assay. The ligand coating concentration was 12 µg/ml. For the HuX1/A or HuX2/A cells, treatment with cytochalasin D did not alter the binding to laminin-1. However, for HuX1/D cells, cytochalasin D treatment significantly reduced adhesion to laminin-1. Values are the mean of triplicate wells; bars indicate SE.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

 
We demonstrate that when the 7X1 alternatively spliced integrin heterodimerizes with the muscle 1D subunit, the ligand specificity is enhanced. If 7X1 is coupled to 1A, it is unable to induce cell adhesion to laminin-1 but can efficiently mediate adhesion to laminin-10/11. After the exchange of 1A for 1D, the receptor can then also promote cell binding to laminin-1. These results show that the replacement of 1A with 1D may induce a higher order of activation of 7, thereby permitting the receptor to bind not only to laminin-10/11 but also to laminin-1. This effect seems to represent an example of ligand affinity modulation of an integrin by the companion cytoplasmic domain.

The alternative splicing of 7X1/X2 occurs between the III and IV homology repeat domains, a region implicated in ligand specificity, and affinity. Springer originally proposed that the extracellular portion of integrin chain is organized in a cyclic- propeller structure (Springer, 1997), and this has been confirmed by x-ray crystallography (Xiong et al., 2002). In this model, the alternatively spliced segment of 7, which is predicted to be located outside the "blade" structure joined by the two-homology repeat domains, may modulate folding of these adjacent sheets, thereby controlling integrin conformation and function. We speculate that 7X1, when bound to the 1D variant, forms a modified active ligand-binding pocket capable of binding laminin-1 and may partially resemble the structure formed by the constitutively active 7X2/1A. Yet both integrins are functionally distinct because they differentially bind laminin-2 and -10/11.

Exogenous 1D expression in MCF-7 cells did not enhance cell adhesion to laminin-1 in the absence of 7 and, in the presence of 7X1 and 1D, the enhancement of adhesion was mainly attributed to 7 and not to the other moderately expressed 2, 3, or 6 integrins that could potentially bind laminin-1. Because there is no preference in the coupling of these subunits to 1A or 1D (Belkin et al., 1997; Pfaff et al., 1998; this study), our results indicate that 1D-induced functional augmentation in MCF-7 cells is specific for the 7X1 integrin. MCF-7 cells have 1 integrin receptors for other ligands, including 21 for collagen 1 (Jones et al., 1995; Maemura et al., 1995) and v1 for vitronectin (Wong et al., 1998). Adhesion to these two ligands was not altered by the expression of 1D. In addition, the forced expression of 1D in the fully functional 7X2 cells did not further enhance the adhesion to laminin-2/4 or -10/11 (our unpublished data). These results suggest that the 1D partner subunit can selectively alter 7X1 functionality. However, it is possible that in these cases that the integrin (e.g., 2 or 7x2) may already be at a fully activated level and that binding activity cannot be further enhanced by coupling with 1D.

Affinity modulation can occur by inside-out signaling via transmembrane conformational transitions (Faull et al., 1994; Schwartz et al., 1995; Hughes and Pfaff, 1998; Longhurst and Jennings, 1998; Liddington and Ginsberg, 2002). Previous studies with cells transfected with 1D indicated that the subunit induced a number of cellular alterations that included decreased spreading and migration, increased binding of fibronectin, and incorporation into matrix (Belkin et al., 1997). These results are consistent with stabilized integrin–cytoskeleton interaction that seems to be mediated by increased binding of 1D with talin and elevated levels of integrin activation. In the context of the current studies, 7X1/1A seems to exist in a partially active conformation as indicated by the finding that the TS2/16 mAb could switch this integrin to a functional laminin-1 receptor (Ziober et al., 1997). Formation of the 7/1D complex seems to induce a similar conversion from an intermediate level of activation to a fully active state. There is precedence for intermediate affinity states (Takagi et al., 2002).

Alternatively, 1D-induced activation of 7X1 may be related to postreceptor occupancy events such as receptor clustering and avidity regulation. For example, enhanced tethering of integrins to the cytoskeleton and localized clustering may lead to strengthened adhesion as a result of increased avidity. However, as Springer and colleagues (Shimaoka et al., 2002) have summarized, the data supporting this mechanism of increased integrin activity (avidity modulation) remain controversial. Furthermore, the cellular environment can also modulate integrin function (Zhang et al., 1996; Hughes et al., 1997). Thus, in contrast to MCF-7 cells, when HT-1080 cells that express only 1A were transfected with 7 splice variants, both X1 and X2 isoforms were fully active for binding to laminin-1 (Ziober et al., 1997), indicating that factors related to cell-type specificity are important in regulating 7 integrin function. Additional studies are needed to further define the specific mechanism responsible for 1D-induced functional modulation of 7X1.

Differences in the interaction of 1 alternatively spliced cytoplasmic tails with the cytoskeleton have been reported. Previous work by Belkin et al. (1997) has shown that overexpression of 1D physically displaces endogenous 1A normally found at adhesion sites with the extracellular matrix. As a result of this displacement of 1A by 1D integrins, cells exhibited a dominant positive phenotype and formed a stronger interaction with the underlying matrix. This activity is apparently related to differences in how 1D and 1A interact with the cytoskeleton. The muscle-specific 1D splice variant has been shown to bind talin with higher affinity than 1A (Belkin et al., 1997; Pfaff et al., 1998). Conversely, the 1A tail has been reported to bind filamin and -actinin more strongly than does 1D (Belkin et al., 1997; Pfaff et al., 1998). It is possible that in the current experiments the effect of 1D on 7X1 activity is a result of this increased interaction with the actin cytoskeleton. In support of this possibility we found that treatment of HuX1/D cells with cytochalasin D resulted in the loss of 1D induced stimulation of adhesion to laminin-1 (Figure 7). Yet the effect seems to be specific to 7 since other integrins, e.g., 2, which were shown to associate with 1D, did not show any enhanced adherence to collagen I. As mentioned above, this may be explained by the possibility that the 2 integrin is already fully activated and adhesion cannot be enhanced further by complexing with 1D. Interestingly, Gimond et al. reported that replacement of 1A with 1D in embryonic stem cells did not lead to either faster rates or a higher extent of cell adhesion to either fibronectin or laminin 1 substrates via the 51 and 61 integrin, respectively (Gimond et al., 2000). In fact, on both substrates, the 1D cells bound much less efficiently than the 1A cells. This may suggest that depending on the chain that is complexed with 1D, the effect on integrin function may vary.

We found that cells expressing 7X1/1A (HuX1/A) adhered poorly to laminin-2/4. In contrast, cells expressing 7X2/1A (HuX2/A) showed strong attachment to this ligand. On laminin-10/11, HuX2/A cells adhered poorly whereas HuX1/A cells showed strong affinity. von der Mark and collaborators recently showed that soluble double truncated forms of 7X1 and 7X2 bind differently to various laminin isoforms (von der Mark et al., 2002). Our results are similar in that 7X1 expressing cells bound to laminin-10/11 substrates whereas 7X2 bound preferentially to laminin-1. However, our data differ with regard to 7X1 and laminin-2/4 substrates. In the previous study, both receptors showed intermediate affinities to purified laminin-2. The divergent results may be due to the nature of the laminin preparations used.

We have investigated the mechanism underlying functional regulation of the alternatively spliced 7 variants by its partner 1 integrin. The physiological importance of the 7 and 1 splice variants is related to the varied roles of 7 as the major laminin-binding receptor in skeletal muscle, where it has multiple functions not only during myoblast motility and differentiation but also in maintenance of mature fiber anchorage and assembly of its underlying basement membrane. When myoblasts begin to differentiate into myotubes, the partner integrin switches from the 1A to the 1D cytoplasmic form. Our results indicate that coupling of the 7X1 variant with the 1D isoform modifies the receptor's ligand binding specificity and converts 7X1 to a promiscuous receptor that can mediate adhesion to laminin-1 and other laminin isoforms.

In summary, we have demonstrated that the cytoplasmic domain of the 1 integrin can modulate the functionality and ligand specificity of the 7 receptor. We show that when coupled to the 1D partner, 7X1 splice variant shows a broader spectrum of ligand specificity and can efficiently bind and mediate adhesion to laminin-1. The formation 7X1/1D in vivo seems likely given that both subunits are present during the late embryonic stage of skeletal muscle development. This suggests that the simultaneous expression of 7X1 along with 1D could facilitate the organization and stability of the MTJ during the early stages of muscle fiber maturation.

	ACKNOWLEDGMENTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

 
This research was supported by National Institutes of Health grants DE13479. We thank Drs. Caroline Damsky and Louis Reichardt for critical review of this manuscript.

	Footnotes

 
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E02–12–0824. Article and publication date are available at www.molbiolcell.org/cgi/doi/10.1091/mbc.E02-12-0824.

Abbreviations used: DMSO, dimethyl sulfoxide; FACS, fluorescence-activated cell sorting; FITC, fluorescein isothiocyanate; mAb, monoclonal antibody; MTJ, myotendinous junction; NMJ, neuromuscular junction; pAb, polyclonal antibody; PCR, polymerase chain reaction.

Present addresses: Department of Otorhinolaryngology, University of Pennsylvania, Philadelphia, PA 19104

Present addresses: Laboratory of Pharmacology, Department of Pharmaceutical Sciences, Aristotle University of Thessaloniki, GR-54006, Thessaloniki, Greece.

^|| Corresponding author. E-mail address: rkramer{at}itsa.ucsf.edu.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGMENTS REFERENCES

 
Bao, Z.Z., Lakonishok, M., Kaufman, S., and Horwitz, A.F. (1993). Alpha7beta1 integrin is a component of the myotendinous junction on skeletal muscle. J. Cell Sci. 106, 579–589.[Abstract]

Belkin, A.M., Retta, S.F., Pletjushkina, O.Y., Balzac, F., Silengo, L., Fassler, R., Koteliansky, V.E., Burridge, K., and Tarone, G. (1997). Muscle beta1D integrin reinforces the cytoskeleton-matrix link: modulation of integrin adhesive function by alternative splicing. J. Cell Biol. 139, 1583–1595.[Abstract/Free Full Text]

Belkin, A.M., Zhidkova, N.I., Balzac, F., Altruda, F., Tomatis, D., Maier, A., Tarone, G., Koteliansky, V.E., and Burridge, K. (1996). Beta 1D integrin displaces the beta 1A isoform in striated muscles: localization at junctional structures and signaling potential in nonmuscle cells. J. Cell Biol. 132, 211–226.[Abstract/Free Full Text]

Brancaccio, M., Cabodi, S., Belkin, A.M., Collo, G., Koteliansky, V.E., Tomatis, D., Altruda, F., Silengo, L., and Tarone, G. (1998). Differential onset of expression of alpha7 and beta1D integrins during mouse heart and skeletal muscle development [In Process Citation]. Cell Adhes. Commun. 5, 193–205.[Medline]

Colognato, H., and Yurchenco, P.D. (2000). Form and function: the laminin family of heterotrimers. Dev. Dyn. 218, 213–234.[CrossRef][Medline]

Crawley, S., Farrell, E.M., Wang, W., Gu, M., Huang, H.Y., Huynh, V., Hodges, B.L., Cooper, D.N., and Kaufman, S.J. (1997). The alpha7beta1 integrin mediates adhesion and migration of skeletal myoblasts on laminin. Exp. Cell Res. 235, 274–286.[CrossRef][Medline]

Delwel, G.O., de Melker, A.A., Hogervorst, F., Jaspars, L.H., Fles, D.L., Kuikman, I., Lindblom, A., Paulsson, M., Timpl, R., and Sonnenberg, A. (1994). Distinct and overlapping ligand specificities of the alpha3Abeta1 and alpha6Abeta 1 integrins: recognition of laminin isoforms. Mol. Biol. Cell 5, 203–215.[Abstract]

Diamond, M.S., and Springer, T.A. (1994). The dynamic regulation of integrin adhesiveness. Curr. Biol. 4, 506–517.[CrossRef][Medline]

Faull, R.J., Kovach, N.L., Harian, J.M., and Ginsberg, M.H. (1994). Stimulation of integrin-mediated adhesion of T lymphocytes and monocytes: two mechanisms with divergent biological consequences. J. Exp. Med. 179, 1307–1316.[Abstract/Free Full Text]

Gimond, C., Baudoin, and Sonnenberg, A. (2000). Defects in adhesion and migration, but not in proliferation and differentiation, of embryonic stem cells upon replacement of integrin subunit beta1A by beta1D. Differentiation 66, 93–105.[CrossRef][Medline]

Gullberg, D., Tiger, C.F., and Velling, T. (1999). Laminins during muscle development and in muscular dystrophies. Cell Mol. Life Sci. 56, 442–460.[CrossRef][Medline]

Hayashi, Y.K., et al. (1998). Mutations in the integrin alpha7 gene cause congenital myopathy. Nat. Genet. 19, 94–97.[CrossRef][Medline]

Hodges, B.L., Hayashi, Y.K., Nonaka, I., Wang, W., Arahata, K., and Kaufman, S.J. (1997). Altered expression of the alpha7beta1 integrin in human and murine muscular dystrophies. J. Cell Sci. 110, 2873–2881.[Abstract]

Hughes, P.E., and Pfaff, M. (1998). Integrin affinity modulation. Trends Cell. Biol. 8, 359–364.[CrossRef][Medline]

Hughes, P.E., Renshaw, M.W., Pfaff, M., Forsyth, J., Keivens, V.M., Schwartz, M.A., and Ginsberg, M.H. (1997). Suppression of integrin activation: a novel function of a Ras/Raf-initiated MAP kinase pathway. Cell 88, 521–530.[CrossRef][Medline]

Humphries, M.J. (1996). Integrin activation: the link between ligand binding and signal transduction. Curr. Opin. Cell Biol. 8, 632–640.[CrossRef][Medline]

Jones, J.I., Doerr, M.E., and Clemmons, D.R. (1995). Cell migration: interactions among integrins, IGFs and IGFBPs. Prog. Growth Factor Res. 6, 319–327.[CrossRef][Medline]

Kaariainen, M., Nissinen, L., Kaufman, S., Sonnenberg, A., M., J., Heino, J., and Kalimo, H. (2002). Expression of alpha7Beta1 integrin splicing variants during skeletal muscle regeneration. Am. J. Pathol. 161, 1023–1031.[Abstract/Free Full Text]

Kaariainen, M., Liljamoa, T., Pelto-Huikko, M., Heino, J., and Kalimo, H. (2001). Regulation of a7 integrin by mechanical stress during skeletal muscle regeneration. Neuromuscul. Disord. 11, 360–369.[CrossRef][Medline]

Kaufman, S.J., George-Weinstein, M., and Foster, R.F. (1991). In vitro development of precursor cells in the myogenic lineage. Dev. Biol. 146, 228–238.[CrossRef][Medline]

Kaufman, S.J., Parks, C.M., Bohn, J., and Faiman, L.F. (1980). Transformation is an alternative to normal skeletal muscle development. Exp. Cell. Res. 125, 333–349.[CrossRef][Medline]

Liddington, R.C., and Ginsberg, M.H. (2002). Integrin activation takes shape. J. Cell Biol. 158, 833–839.[Abstract/Free Full Text]

Longhurst, C.M., and Jennings, L.K. (1998). Integrin-mediated signal transduction. Cell Mol. Life Sci. 54, 514–526.[CrossRef][Medline]

Maemura, M., Akiyama, S.K., Woods, V.L., Jr., and Dickson, R.B. (1995). Expression and ligand binding of alpha 2 beta 1 integrin on breast carcinoma cells. Clin. Exp. Metastasis 13, 223–235.[CrossRef][Medline]

Martin, P.T., Kaufman, S.J., Kramer, R.H., and Sanes, J.R. (1996). Synaptic integrins in developing, adult, and mutant muscle: selective association of alpha1, alpha7A, and alpha7B integrins with the neuromuscular junction. Dev. Biol. 174, 125–139.[CrossRef][Medline]

Mayer, U., Saher, G., Fassler, R., Bornemann, A., Echtermeyer, F., von der Mark, H., Miosge, N., Poschl, E., and von der Mark, K. (1997). Absence of integrin alpha 7 causes a novel form of muscular dystrophy. Nat. Genet. 17, 318–323.[Medline]

Mould, A.P. (1996). Getting integrins into shape: recent insights into how integrin activity is regulated by conformational changes. J. Cell Sci. 109, 2613–2618.[Medline]

Pedrosa-Domellof, F., Tiger, C.F., Virtanen, I., Thornell, L.E., and Gullberg, D. (2000). Laminin chains in developing and adult human myotendinous junctions. J. Histochem. Cytochem. 48, 201–210.[Abstract/Free Full Text]

Pegoraro, E., et al. (2002). Integrin alpha 7 beta 1 in muscular dystrophy/myopathy of unknown etiology. Am. J. Pathol. 160, 2135–2143.[Abstract/Free Full Text]

Pfaff, M., Liu, S., Erle, D.J., and Ginsberg, M.H. (1998). Integrin beta cytoplasmic domains differentially bind to cytoskeletal proteins. J. Biol. Chem. 273, 6104–6109.[Abstract/Free Full Text]

Schwartz, M.A., Schaller, M.D., and Ginsberg, M.H. (1995). Integrins: emerging paradigms of signal transduction. Annu. Rev. Cell Dev. Biol. 11, 549–599.[CrossRef][Medline]

Shimaoka, M., Takagi, J., Springer, T.A. (2002). Conformational regulation of integrin structure and function. Annu. Rev. Biophys. Biomol. Struct. 31, 485–516.[CrossRef][Medline]

Song, W.K., Wang, W., Sato, H., Bielser, D.A., and Kaufman, S.J. (1993). Expression of alpha 7 integrin cytoplasmic domains during skeletal muscle development: alternate forms, conformational change, and homologies with serine/threonine kinases and tyrosine phosphatases. J. Cell Sci. 106, 1139–1152.[Abstract]

Spinardi, L., Einheber, S., Cullen, T., Milner, T.A., and Giancotti, F.G. (1995). A recombinant tail-less integrin beta 4 subunit disrupts hemidesmosomes, but does not suppress alpha 6 beta 4-mediated cell adhesion to laminins. J. Cell Biol. 129, 473–487.[Abstract/Free Full Text]

Springer, T.A. (1997). Folding of the N-terminal, ligand-binding region of integrin alpha-subunits into a beta-propeller domain. Proc. Natl. Acad. Sci. USA 94, 65–72.[Abstract/Free Full Text]

Takagi, J., Petre, B.M., Walz, T., Springer, T.A. (2002). Global conformational rearrangements in integrin extracellular domains in outside-in and inside-out signaling. Cell 110, 599–611.[CrossRef][Medline]

Vachon, P.H., Xu, H., Liu, L., Loechel, F., Hayashi, Y., Arahata, K., Reed, J.C., Wewer, U.M., and Engvall, E. (1997). Integrins (alpha7beta1) in muscle function and survival. Disrupted expression in merosin-deficient congenital muscular dystrophy. J. Clin. Invest. 100, 1870–1881.[Medline]

van der Flier, A., Gaspar, A.C., Thorsteinsdottir, S., Baudoin, C., Groeneveld, E., Mummery, C.L., and Sonnenberg, A. (1997). Spatial and temporal expression of the beta1D integrin during mouse development. Dev. Dyn. 210, 472–486.[CrossRef][Medline]

van der Flier, A., Kuikman, I., Baudoin, C., van der Neut, R., and Sonnenberg, A. (1995). A novel beta1 integrin isoform produced by alternative splicing: unique expression in cardiac and skeletal muscle. FEBS Lett. 369, 340–344.[CrossRef][Medline]

Vizirianakis, I.S., Yao, C.C., Chen, Y., Ziober, B.L., Tsiftsoglou, A.S., and Kramer, R.H. (2001). Transfection of MCF-7 carcinoma cells with human integrin alpha7 cDNA promotes adhesion to laminin. Arch. Biochem. Biophys. 385, 108–116.[CrossRef][Medline]

von der Mark, H., Williams, I., Wendler, O., Sorokin, L., von der Mark, K., and Poschl, E. (2002). Alternative splice variants of alpha7beta1 integrin selectively recognize different laminin isoforms. J. Biol. Chem. 277, 6012–6016.[Abstract/Free Full Text]

Wong, N.C., Mueller, B.M., Barbas, C.F., Ruminski, P., Quaranta, V., Lin, E.C., and Smith, J.W. (1998). Alphav integrins mediate adhesion and migration of breast carcinoma cell lines. Clin. Exp. Metastasis 16, 50–61.[CrossRef][Medline]

Xiong, J.P., Stehle, T., Zhang, R., Joachimiak, A., Frech, M., Goodman, S.L., and Arnaout, M.A. (2002). Crystal structure of the extracellular segment of integrin alpha Vbeta3 in complex with an Arg-Gly-Asp ligand. Science 296, 151–155.[Abstract/Free Full Text]

Yao, C.C., Breuss, J., Pytela, R., and Kramer, R.H. (1997). Functional expression of the alpha 7 integrin receptor in differentiated smooth muscle cells. J. Cell Sci. 110, 1477–1487.[Abstract]

Yao, C.C., Ziober, B.L., Squillace, R.M., and Kramer, R.H. (1996a). Alpha7 integrin mediates cell adhesion and migration on specific laminin isoforms. J. Biol. Chem. 271, 25598–25603.[Abstract/Free Full Text]

Yao, C.C., Ziober, B.L., Sutherland, A.E., Mendrick, D.L., and Kramer, R.H. (1996b). Laminins promote the locomotion of skeletal myoblasts via the alpha7 integrin receptor. J. Cell Sci. 109, 3139–3150.[Abstract]

Zent, R., Fenczik, C.A., Calderwood, D.A., Liu, S., Dellos, M., and Ginsberg, M.H. (2000). Class- and splice variant-specific association of CD98 with integrin beta cytoplasmic domains. J. Biol. Chem. 275, 5059–5064.[Abstract/Free Full Text]

Zhang, Z., Vuori, K., Wang, H., Reed, J.C., and Ruoslahti, E. (1996). Integrin activation by R-ras. Cell 85, 61–69.[CrossRef][Medline]

Zhidkova, N.I., Belkin, A.M., and Mayne, R. (1995). Novel isoform of beta 1 integrin expressed in skeletal and cardiac muscle. Biochem. Biophys. Res. Commun. 214, 279–285.[CrossRef][Medline]

Ziober, B.L., Chen, Y.Q., and Kramer, R.H. (1997). The laminin-binding activity of the alpha7 integrin receptor is defined by developmentally regulated splicing in the extracellular domain. Mol. Biol. Cell 8, 1723–1734.[Abstract]

Ziober, B.L., Vu, M.P., Waleh, N., Crawford, J., Lin, C.S., and Kramer, R.H. (1993). Alternative extracellular and cytoplasmic domains of the integrin alpha 7 subunit are differentially expressed during development. J. Biol. Chem. 268, 26773–26783.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. Liu, P. B. Gurpur, and S. J. Kaufman Genetically Determined Proteolytic Cleavage Modulates {alpha}7{beta}1 Integrin Function J. Biol. Chem., December 19, 2008; 283(51): 35668 - 35678. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: E02-12-0824v1 14/9/3507    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yeh, M.-G. Articles by Kramer, R. H. Search for Related Content PubMed PubMed Citation Articles by Yeh, M.-G. Articles by Kramer, R. H.