|
|
|
|
Vol. 15, Issue 10, 4476-4489, October 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of Molecular Genetics and Microbiology, Medicine, and Pharmacology and Cancer Biology, Howard Hughes Medical Institute, Duke University Medical Center, Durham, NC 27710
Submitted May 6, 2004;
Revised July 14, 2004;
Accepted July 15, 2004
Monitoring Editor: Peter Walter
| ABSTRACT |
|---|
|
|
|---|
mating type are more prevalent and can be more virulent than a cells, and basidiospores are thought to be the infectious propagule. Mating in C. neoformans involves cell-cell fusion and the generation of dikaryotic hyphae, processes that involve substantial changes in cell polarity. Two p21-activated kinase (PAK) kinases, Pak1 and Ste20, are required for both mating and virulence in C. neoformans. We show here that Ste20 and Pak1 play crucial roles in polarized morphogenesis at different steps during mating: Pak1 functions during cell fusion, whereas Ste20 fulfills a distinct morphogenic role and is required to maintain polarity in the heterokaryotic mating filament. In conclusion, our studies demonstrate that PAK kinases are necessary for polar growth during mating and that polarity establishment is necessary for mating and may contribute to virulence of C. neoformans. | INTRODUCTION |
|---|
|
|
|---|
In S. cerevisiae, polarity is generated through reorganization of the actin cytoskeleton and is directed by the small GTPase Cdc42. Ste20 and Cla4, members of the highly conserved p21-activated kinase (PAK) family, act as downstream effectors of Cdc42 in a variety of morphogenic processes. Ste20 functions upstream of mitogen-activated protein (MAP) kinase signaling pathways mediating pheromone response, invasive growth, osmosensing, and cell wall integrity (Elion, 2000
). In addition, Ste20 has been implicated in polarisome activation (Goehring et al., 2003
). Cla4 functions in the organization and maintenance of septins at the mother-bud junction (Cvrckova et al., 1995
; Weiss et al., 2000
; Dobbelaere et al., 2003
; Schmidt et al., 2003
; Versele and Thorner, 2004
). Ste20 and Cla4 also share overlapping essential functions in budding and cytokinesis and have recently been shown to function in mitotic exit (Cvrckova et al., 1995
; Holly and Blumer, 1999
; Weiss et al., 2000
; Hofken and Schiebel, 2002
; Jensen et al., 2002
; Seshan et al., 2002
).
We previously identified two PAK kinase homologues from the human fungal pathogen Cryptococcus neoformans, Ste20 and Pak1 (Wang et al., 2002
). Ste20 and Pak1 each contain conserved N-terminal Cdc42-Rac interactive binding (CRIB) regulatory and C-terminal catalytic domains that characterize PAK kinases. In addition, Ste20 contains a pleckstrin homology domain that is found in a subgroup of PAK kinases that includes S. cerevisiae Cla4. C. neoformans is a dimorphic fungus that is the causative agent of cryptococcosis, a life-threatening fungal meningitis (Mitchell and Perfect, 1995
). C. neoformans isolates are classified into four subtypes based on capsular antigens (serotype A var. grubii, serotype D var. neoformans, and serotype B and C var. gattii). Serotype A and D strains account for the majority of cryptococcal infections worldwide and occur most commonly in immunocompromised patients. In contrast, serotype B and C strains are primary pathogens and were recently found to be the causative agent of a cryptococcal outbreak on Vancouver Island, Canada (Speed and Dunt, 1995
; Stephen et al., 2002
; Fraser et al., 2003
).
Several factors contribute to virulence of C. neoformans, including the ability to produce melanin and a polysaccharide capsule, growth at high temperature, and mating-type. C. neoformans is a budding yeast with a bipolar mating-type system. In response to external stimuli, including pheromones and nitrogen deprivation, a and
cells fuse and produce a dikaryotic hyphae. When filamentation ceases, a basidium forms at the filament tip where karyogamy, meiosis, and postmeiotic divisions occur. Multiple basidiospores, the meiotic progeny, bud from the surface of the basidium at four positions to result in four long chains of protruding basidiospores. The life cycle is completed when basidiospores germinate into budding yeast cells (Hull and Heitman, 2002
; Wickes, 2002
).
Because of their small size, basidiospores or desiccated yeast cells are thought to be the infectious propagules that enter the alveoli of the lung. In the clinic, strains of the
mating-type are more prevalent than strains of the a mating-type, and in serotype D
cells are more virulent than a cells in animal models of cyptococcosis (Kwon-Chung and Bennett, 1978
; Kwon-Chung et al., 1992
). The MAT locus of C. neoformans is unusually large, spans >100 kb, and encodes proteins involved in signal transduction (Ste20, Ste11), polar growth and organelle transport (Myo2), and transcription (Ste12 and Sxi1) (Lengeler et al., 2002
). Because of the link between mating type and virulence, the genes contained within the MAT locus are of considerable interest.
Our initial analysis of the C. neoformans PAK kinases provided additional evidence supporting a link between mating-type and virulence in C. neoformans. The genes encoding Ste20
and Ste20a are located in the MAT locus, ste20 mutants are unable to mate, and the virulence of a clinical isolate deleted for STE20
was attenuated in animal models of cryptococcosis. However, we found that Pak1 is also required for mating and virulence in C. neoformans. To explore the links between mating and virulence, we have further analyzed the roles of Ste20 and Pak1 during mating in C. neoformans. We find that both Ste20 and Pak1 mediate cell polarity during mating. However, the roles of Ste20 and Pak1 are functionally and temporally distinct from each other; Pak1 is required during the initial fusion between
and a cells, whereas Ste20 maintains polarity during growth of the dikaryotic filament.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Molecular Biology
Standard methods were performed as described by Sambrook et al., (1989
). C. neoformans genomic DNA for Southern blot analysis was prepared as described previously (Pitkin et al., 1996
). Biolistic transformations were performed as described previously (Toffaletti et al., 1993
; Davidson et al., 2000a
).
Overexpression Analysis
The serotype A STE20
, STE20a, and PAK1 and serotype D STE20
, STE20a, and PAK1 open reading frames were amplified by polymerase chain reaction (PCR) with BamHI sites at each end. The PCR products were subcloned into pCRII-TOPO and sequenced. After digestion with BamHI, each open reading frame was subcloned into BamHI digested C. neoformans vector pRDC83 generating plasmids pCBN12 (serotype A STE20
), pCBN47 (serotype A STE20a), pCBN34 (serotype A PAK1), pCBN19 (serotype D STE20
), pCBN20 (serotype D STE20a), and pCBN23 (serotype D PAK1). Ura- strains PPW96, JF219, CSB51, CSB48, KLB156-1, and CSB25 were transformed with each plasmid, including pRDC83, which served as a control. Transformants were analyzed in bilateral crosses with the appropriate mating partner and for growth at 37 or 39°C (for ste20 transformants).
Northern Blot Analysis
Equal numbers (2 x 107 cells) of JEC21,
cpk1 (RDC5), ste20
(CSB5), and
pak1 (CSB9) cells were grown on separate V8 plates alone or in coculture with equal numbers (2 x 107 cells) of JEC20, ste20a (CSB5), or a pak1 (CSB10) cells for 24 h. Cells were harvested, lyophilized overnight, and RNA was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA). Northern blots were performed according to standard protocols (Ausubel et al., 1992
) by using 10 µg of total RNA per sample. The MF
, MFa, and ACT1 probes were amplified by PCR, radiolabeled with [
-32P]dCTP (Amersham Biosciences, Piscataway, NJ) by using a Rediprime II kit (Amersham Biosciences), and used in hybridization reactions as described previously (Church and Gilbert, 1984
).
Fusion, Recombinant Spore, and Conjugation Assays
Fusion assays were performed as described previously (Alspaugh et al., 2000
) with the following modifications. Bilateral crosses consisting of the wild-type (JEC50 x JEC34 and JEC50 x JEC31), ste20 (CSB11 x KLB1561), and pak1 (CSB8 x CSB27) mutant strains containing equal numbers of cells were pipetted onto V8 agar medium. Each mating partner contained a complementing auxotrophic mutation (lys2 and ura5 or ade2 and ura5) to allow selection of prototrophic fusion products. After 48 h, the mating mixes were excised, resuspended in 1 ml of H2O, and plated in serial dilutions onto minimal medium. Colonies were counted after 3 d of incubation.
Recombinant spore production was assessed in a quantitative mating assay as described previously (Alspaugh et al., 2000
) with the following modifications. Bilateral crosses consisting of the wild-type (JEC21 x JEC53 and JEC155 x JEC53), ste20 (CSB15 x CSB21), and pak1 (CSB23 x CSB10) mutant strains containing equal numbers of cells were pipetted onto V8 agar medium. After 7 d, the mating were excised, resuspended in 1 ml of H2O, and plated in serial dilutions onto 5-fluoroorotic acid agar medium lacking lysine or adenine. Colonies were counted after 3 d of incubation.
The number of conjugation products present in wild-type and pak1 cocultures was determined by mixing together equal numbers of wild-type (JEC21 and JEC30) and pak1 (CSB9 and CSB10) mutant cells on V8 agar medium. After 24 h, the cells were scraped off, resuspended in H2O, and examined microscopically for the presence of fused cells. Fifty cells were counted for each sample and a total of 300 cells were analyzed from each coculture.
Microscopy
Brightfield, differential interference microscopy (DIC) and fluorescent images were captured with a Zeiss Axioskop 2 Plus fluorescent microscope equipped with an AxioCam MRM digital camera. Additional brightfield images were captured with a Nikon Eclipse E400 microscope equipped with a Nikon CoolPix 990 digital camera.
For sterol staining, cells were harvested from V8 agar medium and resuspended in phosphate-buffered saline (PBS). Cells were incubated with 5 µg/ml filipin III (Cayman Chemical, Ann Arbor, MI) for 5 min, rinsed in PBS, and observed immediately. For concanavalin A (ConA)-filipin staining, overnight cultures were diluted and incubated for 1 h in either 50 µg/ml ConA Alexa Fluor 594 (
cells) or ConA Alexa Fluor 488 (a cells) (Molecular Probes, Eugene, OR). Cells were rinsed three times in PBS to remove unbound lectin, mixed, and pipetted onto V8 agar medium. After 4 h cells were harvested, counterstained with filipin, and visualized with the appropriate filters.
For filament staining, slide mounts were prepared as described previously (Fraser et al., 2003
) with the following modifications. After incubation, each slide mating was transferred to a fresh petri dish, washed three times with 10 ml of PBS, fixed in 10 ml 10% formaldehyde for 20 min, washed three times with PBS, permeabilized with 1% Triton X-100 in PBS for 10 min, and washed three times with PBS before staining. To visualize septa and DNA, the slide matings were incubated in a 10-ml preparation of calcofluor (fluorescent brightener 28 F-3397; Sigma-Aldrich, St. Louis, MO) at 40 µg/ml and a 5000x dilution of a 5 mM solution of Sytox Green (Molecular Probes) in PBS for 20 min. Agar sections containing filaments were mounted on fresh microscope slides with 5 µl of antifade (1 mg/ml p-phenylenediamine in 50% glycerol). To visualize actin and DNA, similar mating preparations were fixed and incubated in a 10-ml preparation of rhodamine-conjugated phalloidin (P-195; Sigma-Aldrich) at 10 µg/ml. Agar sections containing filaments were mounted on fresh microscope slides with 5 µl of antifade mix containing 8 µg/ml 4,6-diamidino-2-phenylindole (DAPI) (D-21490; Molecular Probes).
Gene Disruption
The ura5-serotype A strain JF99 was isolated as a 5-fluoroorotic acid spontaneous mutants of KN99a. The construct for precise replacement of the serotype A STE20a open reading frame with the nourseothricin resistance cassette was generated as described previously (Davidson et al., 2002
; Fraser et al., 2003
) using primers to amplify STE20a 5' (JOHE9252 AACGCTAAAGCCATGCCAACA; JOHE9253 AGCTCACATCCTCGCAGCGACGATGAAAGCCTGGTTCTAGGT) and STE20a 3' (JOHE9254 CCGTGTTAATACAGATAAACCCCGCCTTATGATGGTATTTGTCCG; JOHE9255 CAGGTCGCTGGAATATCTTGT), with the overlap construct used to transform JF99 to create JF219 (MATa ste20a::NAT ura5). The construct for precise replacement of the serotype A PAK1 open reading frame with the nourseothricin resistance cassette was generated using primers to amplify PAK1 5' (JOHE10447 AGGCCATCCATCACATTCCTT; JOHE10448 AGCTCACATCCTCGCAGCCCCCTTTTCTATCGCCGCGGTCGC) and PAK1 3' (JOHE10449 CCGTGTTAATACAGATAAACCATTGGGTAGGAACGAAAACGTGGT; 110450 GCAAACTGGTCAATCGCATCT), with the overlap construct used to transform KN99a to create JF265 (MATa pak1::NAT) and JF99 to create JF267 (MATa pak1::NAT ura5). Putative deletion strains were confirmed by PCR and Southern blot analysis.
| RESULTS |
|---|
|
|
|---|
and a cells sense and respond to pheromone and fuse. The resulting dikaryon produces abundant dikaryotic filaments, basidia, and basidiospores (Kwon-Chung, 1976
pak1 x a pak1 and ste20
x ste20a mutant crosses (Wang et al., 2002
To address this question, bilateral mutant crosses were conducted between serotype D ste20a, ste20
, a pak1, and
pak1 strains. Each strain was genetically marked to allow selection of prototrophic isolates formed by cell fusion after 48 h of incubation on mating medium. No prototrophic isolates were obtained from the bilateral pak1 mutant cross, whereas abundant prototrophic isolates were produced from both the wild-type control cross and the bilateral ste20 mutant cross (Figure 1A). Hence, Pak1 is required for cell fusion during mating but Ste20 is not. Ste20 likely functions at a later stage in mating, possibly during filament morphogenesis or hyphal elongation.
|
We also examined fusion in unilateral crosses between pak1 mutant and wild-type strains to determine whether one copy of PAK1 was sufficient for fusion. The number of prototrophic isolates produced from either pak1 unilateral cross was only modestly decreased compared with wild type, demonstrating that one copy of PAK1 suffices for fusion (unpublished data). This is in contrast to cpk1, ste7, and ste11 mitogen-activated protein kinase (MAPK) cascade mutants, which exhibit a fusion defect even in unilateral crosses with a wild-type mating partner (Davidson et al., 2003
).
Pheromone Induction Is Normal in PAK Kinase Mutants
The MF
pheromone genes are induced in response to nutrient limitation and coculture with a cells via the Ste11-Ste7-Cpk1 MAPK cascade (Davidson et al., 2000b
, 2003
; Shen et al., 2002
). If Pak1 were to function as the sole activator of the MAPK cascade then we would expect to observe a defect in MF
pheromone expression in
pak1 cells during coculture with a pak1 cells. MF
expression was examined by Northern blot analysis by using RNA extracted from
wild-type and
cpk1 cells cocultured with a wild-type cells and
pak1 cells cocultured with a pak1 cells. Consistent with previous observations, MF
expression was dramatically induced by 24 h when
cells were cocultured with a cells (Shen et al., 2002
) (Figure 1B). MF
induction was absent in
cpk1 cells cocultured with wild-type a cells (Davidson et al., 2003
), but it was induced when
pak1 cells were cocultured with a pak1 cells (Figure 1B). Wild-type levels of MF
also were observed in ste20
cells cocultured with ste20a cells (Figure 1B). In addition, MFa pheromone induction occurred normally in the bilateral pak1 and ste20 crosses (unpublished data). These results indicate that neither Pak1 nor Ste20 is required for activation of pheromone gene transcription during mating.
pak1 Mutants Fail to Polarize in Response to Pheromone
In S. cerevisiae, both
and a cells respond similarly to pheromone by arresting in G1, reorienting growth toward the pheromone gradient, and fusing with each other (Elion, 2000
). In C. neoformans,
and a cells respond differently when confronted with pheromone;
cells produce conjugation tubes, whereas a cells become enlarged and refractile, and only occasionally produce conjugation tubes (Moore and Edman, 1993
; Davidson et al., 2000b
; Wang et al., 2000
).
Previously, we demonstrated that
pak1 and a pak1 mutants failed to respond morphologically when confronted with mating pheromone, but both are able to produce and secrete pheromone (Wang et al., 2002
). To address the role of the PAK kinases in pheromone-induced polarized growth, the initial morphological changes that
and a cells undergo before and during fusion were monitored using filipin, a fluorescent antibiotic that binds to 3-
-hydroxysterols (Wachtler et al., 2003
). Sterols have recently been shown to be enriched in areas of polarized growth and mating projections in Schizosaccharamyces pombe and in mating projections in S. cerevisiae (Bagnat and Simons, 2002
; Wachtler et al., 2003
). Here, we examined the localization pattern of sterols in actively growing wild-type cells. In C. neoformans, filipin was localized to areas undergoing active polarized growth during vegetative growth: bud tips and septa (Figure 2A). Next, coculture experiments were performed with wild-type and pak1 mutant strains. Cells of opposite mating type were mixed and incubated for 424 h on V8 mating medium, harvested, and live cells were stained with filipin. By 4 h of incubation, morphological changes were discernable in wild-type cells (Figure 2, BE). Whereas budding continued in some cells, the majority of cells (>50%) formed protrusions that stained intensely with filipin (Figure 2B). The protrusions elongated into tubes and grew until fusion occurred with a cell of the opposite mating type (Figure 2, CE). Actin localized to the tips of the C. neoformans mating protrusions, as detected in samples that were fixed and stained with rhodamine-conjugated phalloidin (Figure 2G). In contrast to wild-type cells, only budding cells were observed in pak1 mutant cells at the 4-h time point (Figure 2F). Inspection of cocultured cells from later time points revealed that some fusion events did occur between
pak1 and a pak1 mutant cells, but these were less frequent and were delayed compared with those observed in cocultured wild-type cells.
|
To distinguish between mating types during fusion, wild-type
and a cells were differentially stained with fluorescent conjugates of ConA, a lectin that binds mannose and glucose residues. In C. neoformans, ConA localizes to septa and bud scars (Figure 3; Foster et al., 2004
). Overnight cultures of
and a cells were incubated with Alexa 594 ConA (red) and Alexa Fluor 488 ConA (green) conjugates, respectively, for 1 h. Cells were washed to remove unbound lectin, and equal numbers of each mating partner were mixed and plated onto mating medium. After 4 h, the cells were harvested and counterstained with filipin. Fusion products consisting of ConA-labeled
and a cells were identified demonstrating that both mating types can produce conjugation tubes to fuse with a mating partner (Figure 3).
|
To monitor nuclear migration with respect to cell fusion and postfusion events, we fixed and stained cells from 4-, 12-, and 24-h time points with DAPI. Staining revealed that by 12 h,
and a cells from the wild-type coculture had fused and formed mating filaments into which the
and a nuclei both migrated (Figure 4A); by 24 h, dikaryotic filaments were evident (Figure 4A). In contrast, mating filaments were not detected in the
pak1 x a pak1 coculture until 24 h (Figure 4A). To quantify the defect in pak1 conjugation, we counted the number of fusion products present in the wild-type and
pak1 X a pak1 mutant cocultures incubated for 24 h. On average, the wild-type coculture samples contained 3.8 ± 0.83 conjugation products per 50 cells, whereas the pak1 mutant coculture samples contained only 0.3 ± 0.26 conjugation products per 50 cells. Together, these results demonstrate that cells lacking Pak1 fail to polarize toward a mating partner in response to pheromone and, likely as a consequence, exhibit a relative fusion defect compared with wild-type cells.
|
pak1 Mutants Produce Few Meiotic Progeny
Our results suggest that despite a significant fusion defect, conjugation and filamentation might not be abolished in bilateral pak1 mutant crosses. To determine whether the pak1 fusion products produced functional mating filaments and completed the sexual cycle, we measured the number of viable recombinant meiotic progeny produced from wild-type and pak1 crosses. Cells from wild-type and bilateral pak1 crosses were genetically marked to permit selection of recombinant haploid progeny, mixed, incubated for 7 d on mating medium, and serially plated onto selective medium. A 200-fold reduction in the production of recombinant progeny was observed in the bilateral pak1 cross compared with the wild-type control cross (Figure 4B). Thus,
pak1 and a pak1 mutant cells exhibit a profound fusion defect and only rarely complete the sexual cycle to produce recombinant haploid meiotic progeny.
Filaments Lacking Pak1 Are Mononucleate
Although reduced compared with wild-type, bilateral pak1 crosses do produce filaments. The lack of recombinant progeny indicates that the majority of filaments produced in bilateral pak1 crosses are either dysfunctional, mononucleate, or both. Indeed, microscopic examination of the bilateral pak1 filaments revealed several abnormalities. Wild-type and bilateral pak1 crosses were incubated for 7 d on microscope slides covered in V8 agar medium. The slides were fixed and stained with calcofluor and Sytox Green to visualize clamp cells and nuclei, respectively.
Characteristic features of C. neoformans dikaryotic hypha include two paired nuclei per cell, nuclear migration into clamp cells, and fused clamp cell connections between filament cells (Figure 5A). However, DNA and cell wall staining of pak1 filaments revealed that the filament cells were mononucleate for the most part and contained many unfused clamp-cell-like or blastospore-like structures (Figure 5A). Two nuclei were occasionally observed in the leading filament cell as a result of replication of the single nucleus. Mononucleate filaments containing no or unfused clamp cells also are observed in several other physiological settings including conjugation tubes, asexual filaments (haploid fruiting), and diploid filamentous growth. Previously, we demonstrated that pak1 mutant cells are unable to undergo haploid fruiting, excluding this as a source of the mononucleate filaments observed (Wang et al., 2002
). It is also unlikely that the mononucleate filaments are diploids because diploid fusion products were not recovered in our assay (Figure 1A). A more likely explanation is that the mononucleate filaments arise from pak1 cells that form mating projections but fail to fuse with a partner. In this model, Pak1 also is required for the physical fusion between
and a cells.
|
In C. neoformans, both dikaryotic and mononucleate (either haploid fruiting or diploid) hyphae produce basidia and basidiospores. Neither macroscopic nor microscopic examination of the bilateral pak1 filaments revealed the presence of normal basidia or basidiospores. Instead, the filaments terminated with deformed basidia that lacked basidiospores (Figures 5A and 8A) but did occasionally produce yeast-like cells or blastospores (Figure 5B). These observations suggest that Pak1 may play additional roles in basidia formation, meiosis, and basidiospore development.
|
Ste20 Is Required to Maintain Polarity
In contrast to the few filaments produced by bilateral pak1 crosses, bilateral ste20 mutant crosses produced abundant yet deformed filamentous structures that were rapidly over-grown by vegetative cells. Microscopic inspection revealed these filaments are much more branched than wild-type filaments (Figure 6A). Like other filamentous fungi, wild-type C. neoformans hyphae produce branches or secondary filaments that originate from subapical cells in the main filament (Figure 6A). In addition, branches also can form from the clamp cells that link adjacent filament cells (Kwon-Chung, 1976
). To determine the origin of the branches in the ste20 mutant crosses, we stained the septa and cell walls of wild-type and bilateral ste20 filaments with calcofluor (Figures 5A and 6B). Staining revealed that the unusual branches in the ste20 mutant filaments did not originate from the clamp cells but were caused by the growing tip splitting in half (Figure 6B). Clamp cells were produced but were limited to one of the two branches, and nuclear costaining revealed that the filament cells contained unequal numbers of nuclei as a result. Whereas some filament cells contained two nuclei, others contained one, three, or zero nuclei (Figure 6B).
|
Although not previously described in C. neoformans filaments, tip splitting has been described in Aspergillus nidulans polarity-maintenance mutants as dichotomous branching (Momany, 2002
). Actin localizes as a cap at the tip of A. nidulans filaments and dichotomous branching occurs when the actin cap is perturbed or displaced, creating an additional axis of polarity. To determine whether actin localization was similarly perturbed in the filaments produced by a ste20
x ste20a bilateral cross, actin in wild-type and ste20 mutant filaments was stained with rhodamine-conjugated phalloidin. In wild-type filaments actin was localized in cortical patches and filaments along the length of the filament cell and was concentrated at the growing tip and in clamp cells, both areas of active polarized growth (Figure 7A). Transient actin rings also were observed at sites of septation between filament cells and at clamp connections (Figure 7, B and C). Comparison of wild-type and the ste20 mutant filaments revealed no overall difference in actin polarization (Figure 6C).
|
By microscopic examination, no normal basidia or basidiospores were identified in the bilateral ste20 cross. Instead, the basidia were deformed and either devoid of basidiospores or contained only a few (4 to 8) basidiospores (Figure 8A). Nuclear staining revealed that these basidiospores contain DNA, suggesting that they may be viable (unpublished data). To determine this, we measured the production of recombinant meiotic progeny in bilateral ste20 mutant crosses. Wild-type and ste20 bilateral mutant crosses were incubated for 7 d on mating medium. Each strain was genetically marked to allow for the selection of recombinant progeny. Whereas recombinant colonies were isolated from the bilateral ste20 cross, there was a fivefold reduction compared with a similarly marked auxotrophic wild-type cross (Figure 4B). Thus, bilateral ste20 crosses produce viable recombinant progeny although at a reduced rate. Together, these results indicate that Ste20 is required to maintain filament polarity and that loss of polarity leads to a reduction in the number of viable basidia and basidiospores.
C. neoformans PAK Kinases Are Not Interchangeable
In S. cerevisiae, Ste20 and Cla4 have overlapping functions and can substitute for each other in certain situations. For example, overexpression of Cla4 can suppress the mating and osmosensitivity defects associated with ste20 mutant strains (Sells et al., 1998
; Raitt et al., 2000
). A similar situation has been described in fission yeast Schizosaccharomyces pombe; overexpression of the Cla4 homolog Pak2/Shk2 suppresses the morphology and mating defects associated with deletion of the Ste20 homolog Pak1/Shk1 (Sells et al., 1998
; Yang et al., 1998
).
To determine whether overexpression of C. neoformans Pak1 can suppress the mating and morphology defects of the ste20 mutant or vice versa, we performed bilateral mating assays using
mutant strains overexpressing either the STE20
or the PAK1 gene. Filamentation equivalent to wild type was restored in control crosses (
pak1 + PAK1 x a pak1 and ste20
+ STE20
x ste20a) (Figure 8A and Table 2). However, overexpression of PAK1 in the ste20
mutant strain did not restore filamentation in a bilateral ste20 cross, nor did STE20
restore filamentation in a bilateral pak1 cross when overexpressed in an
pak1 mutant strain (Figure 8A and Table 2). We also examined the ability of Pak1 to suppress the cytokinesis defects exhibited by ste20 mutant strains. Whereas overexpression of STE20
complemented the cytokinesis defect of the ste20
mutant strain, overexpression of PAK1 did not (Figure 8B and Table 2). Together, these results indicate that the C. neoformans PAK kinases play functionally specialized roles in mating and morphology.
|
Ste20 Function Is Mating-Type Independent
In contrast to a ste20 bilateral cross, unilateral ste20
x a and ste20a x
crosses produce abundant filaments with no morphology defects, indicating that one copy of either gene is sufficient. To determine whether there was any mating-type specificity associated with this Ste20 function, we overexpressed STE20
in a ste20a mutant and STE20a in a ste20
mutant. In bilateral ste20 crosses, Ste20
restored normal filament morphology when overexpressed in either a ste20
or a ste20a mutant strain (Table 2). Similarly, Ste20a restored filament morphology when overexpressed in either a ste20a or a ste20
mutant strain (Table 2). In addition, overexpression of Ste20
complemented the cytokinesis defect of the ste20a mutant strain and vice versa. These data indicate that, at least under these experimental conditions, Ste20
and Ste20a perform identical roles during vegetative growth and are redundant during mating. Thus, the functions of Ste20 seem independent of mating type even though the STE20 genes are located in the MAT locus and function in mating.
Ste20 Function Is Serotype Independent
Serotype is correlated with the ability of C. neoformans to cause disease. In the clinic, cryptococcosis caused by serotype A strains predominates over cases involving serotype B, C, or D strains. Recent analyses have shown that certain gene products also have a serotype-dependent impact on C. neoformans virulence. For example, the Ste12 transcription factor is important for virulence in a serotype D strain but not in a serotype A strain (Yue et al., 1999
). Conversely, Ste20 is required for virulence in serotype A but not in serotype D. In addition, whereas both serotype A and D ste20 mutants exhibit defects in cytokinesis and mating filament polarity, only serotype A ste20
mutants are temperature sensitive for growth (Wang et al., 2002
).
To address the role of Ste20 serotype specificity, we generated a serotype A ste20a mutant by disrupting STE20a in the serotype A MATa strain KN99a (Nielsen et al., 2003
). Our previous analysis of Ste20 in serotype A was limited to ste20
due to the unavailability of a serotype A MATa strain. The serotype A ste20a mutant behaved exactly as the serotype A ste20
mutant with respect to cytokinesis and high-temperature growth (unpublished data) (Wang et al., 2002
). In addition, the few filaments produced in a bilateral serotype A ste20 cross exhibited defects similar to the filaments produced in a bilateral serotype D ste20 cross (Figure 9). Next, we overexpressed the serotype A STE20
gene in the serotype D ste20
mutant and the serotype D STE20
gene in the serotype A ste20
mutant. When overexpressed, serotype D Ste20
complemented the cytokinesis defect, high-temperature growth defect, and mating filamentation defect of the serotype A ste20
mutant (Table 2). Similarly, serotype A Ste20
overexpression complemented the cytokinesis and mating filamentation defects of the serotype D ste20
mutant (Table 2). Identical results were obtained using serotype A and D STE20a genes (Table 2). Additionally, overexpression of serotype A STE20
complemented the serotype D ste20a mutant (summarized in Table 2). In summary, Ste20 function is independent of both serotype and mating type.
|
Pak1 Function Is Serotype Dependent
We also examined whether Pak1 could function between the divergent serotypes. To this end, we first attempted to generate a serotype A a pak1 mutant by crossing the serotype A
pak1 mutant with the congenic mating partner KN99a. However, in contrast to serotype D pak1 unilateral crosses, very few filaments were produced (Figure 9). In an alternative approach, we generated a serotype A a pak1 mutant strain by targeted gene disruption. Similar to a serotype A
pak1 unilateral cross, few filaments were produced when the serotype A a pak1 mutant was crossed to a wild-type
strain (Figure 9). No filamentation was observed in the serotype A bilateral pak1 cross (Figure 9). Interestingly, no filamentation was observed in crosses between ste20
and a pak1 mutants or between
pak1 and ste20a mutants (Figure 9).
Overexpression of serotype A PAK1 in either
or a A pak1 mutants restored filamentation in unilateral crosses (Table 2). However, overexpression of the serotype A PAK1 gene in the serotype D pak1 mutant did not restore filamentation to a serotype D pak1 bilateral cross (Table 2). Similar results were obtained with serotype D PAK1; overexpression of serotype D PAK1 complemented the serotype D pak1 mutant but not the serotype A pak1 mutant (Table 2). Thus, in contrast to Ste20, Pak1 function is serotype specific.
| DISCUSSION |
|---|
|
|
|---|
A PAK Kinase for Cell Fusion
We find that in response to pheromone, C. neoformans
and a cells generate mating projections and conjugation tubes and that Pak1 is required for this response. Mating projections and conjugation tubes occur by 4 h, the same time that pheromone transcript levels increase (Shen et al., 2002
; Chang et al., 2003
). In the basidiomycete Ustilago maydis, pheromone gene induction and conjugation tube formation also coincide and are regulated by a pheromone-responsive MAP kinase cascade (Muller et al., 2003
). The C. neoformans pheromone-responsive MAP kinase pathway, composed of Ste11, Ste7, and Cpk1, is required for pheromone gene induction and cell fusion (Davidson et al., 2000b
, 2003
). In S. cerevisiae the PAK kinase Ste20 activates the pheromone-responsive MAP kinase cascade which in turn induces the processes required for mating, including shmoo formation and cell fusion (Elion, 2000
). In U. maydis, the Ste20 homolog Smu1 has been recently characterized and smu1 mutant strains exhibit mating defects and decreased pheromone expression (Smith et al., 2004
). C. neoformans Pak1 is most closely related to S. cerevisiae Ste20. However, our data show that pheromone induction is not compromised in pak1 mutants, indicating that the fusion defect is either independent of MAP kinase cascade activation or that Pak1 functions downstream of the MAP kinase cascade, or plays a redundant role with other elements that activate MAP kinase signaling.
Why then do pak1 mutants fail to fuse? In S. cerevisiae, Ste20 has additional roles in bud and shmoo morphogenesis. Polarization at the bud tip is maintained by a complex of proteins called the polarisome. This complex consists of Spa1, Pea2, Bud6, and Bni1. Ste20 is thought to activate the polarisome via phosphorylation of Bni1, a formin homology protein and a Cdc42 effector (Goehring et al., 2003
). Polarisome components, including Bni1, are required for shmoo formation and cell fusion (Gehrung and Snyder, 1990
; Chenevert et al., 1994
; Dorer et al., 1997
; Evangelista et al., 1997
; Gammie et al., 1998
). Our findings are consistent with a model that C. neoformans Pak1 induces mating projection formation by activating polarisome components.
Origin of pak1 Filaments
The filaments produced in bilateral pak1 crosses seem similar to the conjugation tubes produced by haploid or diploid cells (unpublished data). Typically, fusion occurs only between
and a cells, leading to the production of a dikaroytic filament, basidia, and basidiospores. However, filamentation is thermally repressed and fusion products incubated at 37°C undergo nuclear fusion and become diploid. When grown at 24°C these diploids reenter the sexual cycle and form monokaroytic filaments, basidia, and basidiospores. Also, haploid cells can reproduce asexually (haploid fruiting) under nutrient-limiting conditions by forming monokaryotic filaments. Common to all three processes is the ability of haploid cells to form conjugation tubes during nutrient-limiting conditions, suggesting that this may be a default mechanism. A possible explanation for this model is given by the appearance of mononucleate filaments in pak1 crosses. The pak1 mutant cells are unable to respond to pheromone and identify a mating partner, and as a consequence form long conjugation tubes that mature into mononulceate filaments. Our data support this interpretation, but other possibilities also can be considered. For example, pak1 filaments may originate from cell fusion but are unable to maintain both nuclei, either as a diploid or as a dikaryon, thus resulting in mononucleate filaments.
In contrast to mononucleate filaments produced by haploid fruiting or diploid filaments, pak1 mutant filaments do not produce normal basidia or basidiospores; either no basidiospores are formed on the basidia or budding cells are produced instead. Little is known about C. neoformans basidia and basidiospore development. In other filamentous fungi, asexual spores form from a specialized structure called a conidiophore. Polarity mutants defective in spore and conidiophore formation have been identified and include a Cla4 homolog from the rice blast fungus Magnaporthe grisea, a septin homolog from Aspergillus nidulans, a Rac homolog from the human pathogen Penicillium marneffei, and a Ras homolog from the alfalfa pathogen Colletotrichum trifolii (Truesdell et al., 1999
; Westfall and Momany, 2002
; Boyce et al., 2003
; Li et al., 2004
). Interestingly, both Rac and Ras are signaling components known to function in mediating PAK kinase activation (Daniels and Bokoch, 1999
; Pruyne and Bretscher, 2000
).
A PAK Kinase for Polarity Maintenance
The tip-branching defect exhibited by ste20 mutants during filamentous growth implicates Ste20 in hyphal tip maintenance. PAK kinase homologues from filamentous fungi have been characterized and play roles in filament establishment and hyphal maturation; however, none has been implicated in hyphal tip maintenance (Leberer et al., 1996
; Leberer et al., 1997
; Ayad-Durieux et al., 2000
; Szabo, 2001
; Smith et al., 2004
). Proteins involved in tip maintenance have been identified in P. marneffei, A. nidulans, and Neurospora crassa. Not surprisingly, some of the genes corresponding to the tip-branching mutants encode cytoskeletal-related proteins, including the Rac homolog CflA (P. marneffei), actin (N. crassa), and a Bni1 homolog SepA (A. nidulans) (Sharpless and Harris, 2002
; Seiler and Plamann, 2003
; Virag and Griffiths, 2004
). Because Bni1 homologues are involved in both tip splitting and shmoo formation, albeit in different organisms, it raises the intriguing possibility that a C. neoformans formin protein may be a common target for both Pak1 and Ste20 during morphogenesis. Although no formin proteins have been identified in C. neoformans, our BLAST searches of C. neoformans sequence databases have revealed that formin domain sequences are present.
In C. neoformans,
and a nuclei must be segregated to maintain the dikaryotic filament. In contrast, P. marneffei, A. nidulans, and N. crassa filaments contain multiple nuclei per filament cell (Coppin et al., 1997
). Thus, in C. neoformans, tip-splitting has a unique and detrimental impact on nuclear segregation during filamentous growth that affects subsequent basidiospore formation and viability, and Ste20 has a pivotal role in this process.
Dosage Dependency and Serotype Specificity of PAK Kinases
During our analysis we found that a single copy of PAK1 was sufficient for function, and this also held true for STE20, where a single copy of either MAT variant would suffice for mating to occur. This redundancy of STE20 function, specifically the lack of discrimination between the mating-typespecific alleles of the gene, was highly unexpected. It is thought that the products of the MAT locus contribute to
- and a-specific signaling pathways controlling reproduction and virulence (Hull and Heitman, 2002
; Fraser and Heitman, 2003
). The finding that the allelic components of MAT may be interchangeable between mating types without alteration of phenotype implies that despite the large cohort of genes present in this structure, the different MAT alleles may be functionally equivalent with the exception of those components considered the most ancient; the homeodomain protein Sxi1
(Hull et al., 2002
) and the pheromones/pheromone receptors (Chang et al., 2003
).
Also puzzling is the serotype specificity of Pak1 compared with Ste20. Serotype A and D Ste20
and Pak1 are 94 and 90% identical at the amino acid level, respectively. However, serotype A Pak1 contains several short insertions not shared by serotype D Pak1. Population genetic studies show that C. neoformans A and D serotypes diverged
18 million years thus it is likely that the serotype A and D Pak1 homologues have acquired unique functions during mating (Fan et al., 1994; Xu et al., 2000). However, the two different STE20 alleles of each serotype have clearly been diverging for a much longer time due to their presence in the nonrecombining MAT locus. In contrast to the divergence between the serotype alleles of each gene, at the nucleotide level the coding sequences of the MATa and MAT
alleles of STE20 are only 66% identical. The divergence of function of the PAK1 genes between serotype A and D is therefore all the more exceptional; the function has changed dramatically over the past
20 million years, where the STE20 genes (which are much more divergent) each seem to encode identical functions.
Cell Polarity and Virulence
One goal of our study was to gain insight into the connections between mating and virulence in C. neoformans. In U. maydis, the hyphal form is pathogenic and the sexual cycle occurs in the host thus there is a clear connection between mating and virulence. For example, mutations in components of the pheromone responsive MAP kinase cascade or the Ste20 homolog Smu1 exhibit reduced virulence (Mayorga and Gold, 1999
; Muller et al., 1999
, 2003
; Smith et al., 2004
). In contrast, there is no evidence that mating or filamentation occurs during cryptococcal infections. However, there is a link between mating and virulence and many of the gene products found to impact virulence also are required for mating. In the specific case of Ste20, the link between mating and virulence may result from the temperature-sensitive growth defect exhibited by serotype A ste20 mutants. Serotype D ste20 mutants exhibit a cytokinesis defect, but they are not temperature sensitive for growth and exhibit no virulence defect (Wang et al., 2002
).
In contrast, pak1 mutants are not temperature sensitive nor do they exhibit defects in any known virulence factor. Why then are pak1 mutants avirulant in animal models of cyptococcosis? Within the host, C. neoformans cells encounter a combination of stresses, including high temperature, limiting nutrients, and high osmolarity. Our results indicate that Pak1 plays a positive role establishing polarity during mating. During stress, Pak1 also may be required for bud morphogenesis or some other essential function. However, pak1 mutant strains do not seem to be stress sensitive and are slightly more resistant to salt stress than wild-type strains incubated at 37°C (unpublished data). In conclusion, our studies reveal an intriguing association between cell polarity mechanisms and virulence in the human pathogen C. neoformans. Further characterization of Pak1 and Ste20 and the identification of their downstream targets will be necessary to elucidate the connections between mating, cell polarity, and virulence.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
* Corresponding author. E-mail address: heitm001{at}duke.edu.
| REFERENCES |
|---|
|
|
|---|
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. ((1992). ). Current Protocols in Molecular Biology, New York: Greene Publishing Associates and Wiley-Interscience.
Ayad-Durieux, Y., Knechtle, P., Goff, S., Dietrich, F., and Philippsen, P. ((2000). ). A PAK-like protein kinase is required for maturation of young hyphae and septation in the filamentous ascomycete Ashbya gossypii. J. Cell Sci. 113, , 4563-4575.[Abstract]
Bagnat, M., and Simons, K. ((2002). ). Cell surface polarization during yeast mating. Proc. Natl. Acad. Sci. USA 99, , 14183-14188.
Boyce, K.J., Hynes, M.J., and Andrianopoulos, A. ((2003). ). Control of morphogenesis and actin localization by the Penicillium marneffei RAC homolog. J. Cell Sci. 116, , 1249-1260.
Chang, Y.C., Miller, G.F., and Kwon-Chung, K.J. ((2003). ). Importance of a developmentally regulated pheromone receptor of Cryptococcus neoformans for virulence. Infect. Immun. 71, , 4953-4960.
Chenevert, J., Valtz, N., and Herskowitz, I. ((1994). ). Identification of genes required for normal pheromone-induced cell polarization in Saccharomyces cerevisiae. Genetics 136, , 1287-1296.[Abstract]
Church, G.M., and Gilbert, W. ((1984). ). Genomic sequencing. Proc. Natl. Acad. Sci. USA 81, , 1991-1995.
Coppin, E., Debuchy, R., Arnaise, S., and Picard, M. ((1997). ). Mating types and sexual development in filamentous ascomycetes. Microbiol. Mol. Biol. Rev. 61, , 411-428.[Abstract]
Cvrckova, F., De Virgilio, C., Manser, E., Pringle, J.R., and Nasmyth, K. ((1995). ). Ste20-like protein kinases are required for normal localization of cell growth and for cytokinesis in budding yeast. Genes Dev. 9, , 1817-1830.
Daniels, R.H., and Bokoch, G.M. ((1999). ). p21-Activated protein kinase: a crucial component of morphological signaling? Trends Biochem. Sci. 24, , 350-355.[CrossRef]