![]() |
|
|
Vol. 15, Issue 2, 678-687, February 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*Departamento de Inmunología, Hospital Universitario de la Princesa, 28006 Madrid, Spain
Submitted July 24, 2003;
Revised November 7, 2003;
Accepted November 7, 2003
Monitoring Editor: Martin Schwartz
| ABSTRACT |
|---|
|
|
|---|
v
3 integrin colocalize at endothelial motility-associated extensions. Remarkably, caveolae traffic is required for proper MT1-MMP localization, activity, and function in migratory ECs as demonstrated by both treatment with caveolae-disrupting agents or selective targeting caveolin-1 expression by interference RNA. Thus, caveolae-mediated traffic constitutes a novel mechanism for MT1-MMP regulation in ECs during angiogenesis. | INTRODUCTION |
|---|
|
|
|---|
v integrins, or tissue transglutaminase (Werb, 1997
ECM can regulate the localization and internalization of MT1-MMP, although the underlying mechanism is unknown yet (Gálvez et al., 2002
). ECM provides an array of ligands to interact with multiple cell surface integrins, which generate biochemical phosphorylation cascades involving mediators such as FAK, Raf, Ras, mitogen-activated protein kinases (extracellular signal-regulated kinases), or Rho GTPases (Fukata et al., 1999
; Martin et al., 2002
). This induced signaling modulates cell shape, migration, and invasion by acting on distinct effector proteins. Thus, Rho GTPases are involved in regulating integrin-mediated cell-substratum adhesion, cadherin-mediated cell-cell adhesion, actin cytoskeleton and cell motility, and endocytic traffic (Hall, 1998
; Ellis and Mellor, 2000
; Fukata and Kaibuchi, 2001
; Etienne-Manneville and Hall, 2002
).
Subcellular compartmentalization and traffic of MT1-MMP seem to be important for its function because MT1-MMP internalization via clathrin-coated pits regulates its activity (Jiang et al., 2001
; Uekita et al., 2001
). MT1-MMP has also been found at caveolae in tumor and EC cell lines (Annabi et al., 2001
; Puyraimond et al., 2001
; Remacle et al., 2003
). Caveolae are cholesterol-rich microdomains involved in clathrin-independent internalization of receptors, recycling of molecules to the Golgi complex, and signal transduction (Parton et al., 1994
; Conrad et al., 1995
; Stahlhut and van Deurs, 2000
). Caveolae are abundant in ECs, and their endocytosis can be regulated by actin cytoskeleton and phosphorylation (Parton et al., 1994
; Smart et al., 1999
; Stahlhut and van Deurs, 2000
; Schlegel et al., 2001
). They are mainly composed of cholesterol and sphingolipids and are characterized by the presence of a 22-kDa protein termed caveolin-1. Caveolin-1 interacts with a variety of signaling molecules and surface receptors regulating their localization and function (Okamoto et al., 1998
; Kurzchalia and Parton, 1999
). Thus, caveolin-1 can associate to
1 integrins and regulate anchorage-dependent cell growth or uPAR-dependent cell functions (Wary et al., 1998
; Wei et al., 1999
). Caveolin-1 may also interact with RhoA-modulating cell shape (Gingras et al., 1998
).
In the present study, we have determined that MT1-MMP is present at endothelial caveolae with caveolin-1 and that caveolae constitute a novel pathway for MT1-MMP internalization in human ECs. Moreover, caveolae-mediated MT1-MMP traffic regulates protease localization, activity, and function in ECs during angiogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
1 integrins TS2/16 and LIA1/2, anti-
v integrins ABA 6D1, anti-VE-cadherin TEA1/31, anti-
v
3 integrin LM609, anti-transferrin receptor FG2/12, and anti-MT1-MMP LEM-2/15 and LEM-2/63 have been described previously (Gálvez et al., 2001
Anti-tubulin mAb, type IV gelatin (GEL),
-methyl-cyclodextrin (cdx), filipin, okadaic acid, sphingosine-1-phosphate (SPP), and cholesterol were from Sigma-Aldrich (St. Louis, MO). Collagen type I (COL I) was from ICN Biomedicals (Costa Mesa, CA). Human plasma plasminogen-depleted fibrinogen and C3 ADP-ribosylating exoenzyme were from Calbiochem-Novabiochem (Darmstadt, Germany).
Cells and Cell Cultures
Human ECs from umbilical vein were obtained and cultured up to the third passage as described previously (Gálvez et al., 2001
). ECs were seeded on dishes coated with 1% GEL or 10 µg/ml COL I and changed to serum-free medium HE-SFM from Invitrogen (Karlsruhe, Germany) before performing the functional assays.
Flow Cytometry and Analysis of Receptor Internalization
ECs were incubated with the primary mAb at room temperature previously for 20 min, exhaustively washed with phosphate-buffered saline (PBS), and transferred to 37°C in the presence or not of different agents, 10 µg/ml C3, 1 µM SPP, 10 µM okadaic acid, 10 µg/ml filipin, or 1 µM cdx, for 6 h to allow receptor internalization. Half of the cells were then fixed and permeabilized for 10 min at 4°C with lysis buffer from BD Biosciences and all processed for flow cytometry as described previously (Gálvez et al., 2002
).
Immunofluorescence Microscopy
Subconfluent ECs on glass coverslips coated with GEL or COL I were incubated or not with different agents, 10 µg/ml C3, 1 µM SPP, or 1 µM cdx for 6 h. Cells were first incubated with the primary antibody (anti-caveolin-1, anti-
v
3 LM609, or anti-
1 integrin TS2/16 mAbs) and labeled with a secondary rhodamine X-conjugated goat anti-mouse. After saturating with mouse serum, cells were labeled with the anti-MT1-MMP LEM-2/15 biotinylated mAb, and streptavidin-Alexa 488. Samples were examined in a Leica DMR photomicroscope with a 63x oil immersion objective and images recorded using a charge-coupled device camera from Leica (Wetzlar, Germany).
Western Blot Assays
ECs were washed twice with PBS and directly lysed in Laemmli buffer on ice. Lysates were analyzed by Western blot as described previously (Gálvez et al., 2001
).
Rho Small GTPase Activity Assays
GST-C21, which recognizes active RhoA, was prepared and pull-down experiments performed as described previously (Sander et al., 1999
). Additionally, glutathione S-transferase (GST)-C21 or GST as control were used to stain ECs by immunofluorescence. Briefly, cells fixed in 4% paraformaldehyde were incubated with 100 ng of GST-C21 or GST for 30 min at 37°C. After washing with PBS, cells were stained with the anti-GST mAb and an Alexa 488-anti-mouse secondary antibody.
Zymography Assays
ECs were grown on GEL or COL I and stimulated or not to migrate in serum-free medium in the absence or presence of 10 µg/ml C3, 1 µM SPP, 1 µM cdx, or 10 µg/ml filipin. Cell lysates were analyzed by zymography as described previously (Gálvez et al., 2001
). Densitometric analysis was performed on scanned images with the Multi Analist Software from Bio-Rad (Hercules, CA) and specific activity estimated (active MT1-MMP/total MT1-MMP).
Lipid Raft Isolation
Confluent ECs on GEL or COL I were lysed in buffer 25 mM MES, 0.15 mM NaCl, 0.5% Triton X-100 and after ultracentrifugation in a discontinuous sucrose gradient (40-30-5%) distinct fractions were recovered. Precipitated proteins were run in SDS-PAGE and analyzed by Western blot as described previously (Gálvez et al., 2001
).
Cell Transmigration, Collagen Gel Invasion, and In Vitro Angiogenesis Assays
Functional assays were performed as described previously (Gálvez et al., 2001
), but cells were pretreated or not with 1 µM cdx or 10 µg/ml filipin for 12 h. In transmigration assays, cholesterol replenishment was achieved by adding or not 1 mg/ml cholesterol for 1 h before the assay.
Interference RNA
Sequence AAATGAATTAAAGTGGACCAA of human caveolin-1 mRNA was targeted by designing and synthesizing specific (cav-1) or scrambled (sc cav-1) small interfering RNA (siRNA) according to manufacturer's instructions (Ambion, Austin, TX). siRNAs were transfected in primary ECs by using oligofectAMINE (Invitrogen). Transfected ECs were used for Western blot, immunofluorescence staining, receptor internalization, fibrinogen zymography, or functional assays as described.
Statistical Analysis
Tested and control samples in the functional assays were compared for statistical significance by using the Student's t test.
| RESULTS |
|---|
|
|
|---|
v
3 integrin at the cell-cell contacts on GEL, whereas C3 impaired MT1-MMP intercellular localization on COL I without affecting the presence of the junctional marker VE-cadherin or
1 integrins at these sites; moreover, C3 did not interfere with the clustered localization of MT1-MMP at elongated extensions of subconfluent ECs (Figure 1B; our unpublished data). Additionally, SPP-induced MT1-MMP relocalization correlated with a decrease in its activity in confluent ECs on GEL, whereas a restoration of protease activity was achieved by C3 treatment of ECs on COL I (Figure 1C). Finally, in confluent ECs, SPP also blocked constitutive MT1-MMP recycling on GEL, whereas C3 restored MT1-MMP internalization on COL I but did not have any effect on its internalization in subconfluent ECs regardless the ECM (Figure 1D; our unpublished data). Thus, activation of RhoA in confluent ECs by SPP or by COL I but not by GEL would result in the recruitment of MT1-MMP to intercellular contacts, in the blockade of its traffic, and in the decrease of its activity.
|
Caveolae Mediate MT1-MMP Traffic in Human ECs
Because SPP and C3 modulated MT1-MMP internalization in confluent ECs without affecting clathrin-dependent transferrin receptor (TnfR) endocytosis (Figure 1D), alternative pathways for MT1-MMP recycling were investigated by using different agents (Smart et al., 1999
). The protein phosphatase inhibitor okadaic acid, which stimulates caveolae-mediated endocytosis and inhibits the formation of clathrin-coated vesicles, induced MT1-MMP internalization in confluent ECs on COL I and slightly reduced MT1-MMP internalization on GEL without affecting wound healing-induced internalization regardless the ECM (Figure 2A, top). In contrast, the sterol binding agent filipin, which inhibits the internalization of caveolae, and cdx, which sequesters cholesterol thus disrupting caveolae formation, almost blocked MT1-MMP internalization in all conditions being the effects particularly drastic in migratory ECs in which the blockade was close to 100% (Figure 2A, bottom). EC viability was 98, 95, and 93% after 6 h of treatment with okadaic acid, filipin, or cdx, respectively. Moreover, clathrin-dependent TnfR endocytosis was abolished by okadaic acid and unaffected by filipin or cdx treatment at the low doses used. Thus, caveolae seem to be the major MT1-MMP internalization pathway in migratory ECs; in confluent ECs, caveolae constitute the main endocytic route on GEL but this pathway is blocked on COL I. In addition, MT1-MMP was shown to colocalize with caveolin-1 but not with clathrin in vesicles and clusters along elongated extensions of migratory ECs regardless the ECM but not at cell-cell contacts in confluent ECs on COL I (Figure 2B; our unpublished data). Finally, caveolin-1 also colocalized with
v
3 integrin at lamellipodia but not with
1 integrins at the cell-cell contacts of subconfluent ECs (Figure 2C).
|
MT1-MMP Is Present at Caveolae Domains
MT1-MMP colocalization with caveolin-1 prompted us to directly assess whether these two proteins were present at the same subcellular compartments by performing lipid raft isolation. As shown in Figure 3A, MT1-MMP was found at caveolae (caveolin-1-positive fractions) in confluent ECs on either GEL or COL I. Interestingly, however, a shift in the presence of MT1-MMP but not of
v or
1 integrins in noncaveolae fractions was observed in ECs on COL I compared with GEL. Thus, MT1-MMP was found at fractions corresponding to plasma membrane (VE-cadherin-positive fractions) in confluent ECs on COL I as opposed to the presence of MT1-MMP at fractions corresponding to cytosol (tubulin-positive fractions) on GEL in accordance with the differential MT1-MMP subcellular localization in confluent ECs at either membrane cell-cell contacts on COL I or diffuse on GEL (Figure 3A; Gálvez et al., 2002
).
|
Because caveolin-1 can modulate the activity of different proteins (Okamoto et al., 1998
; Kurzchalia and Parton, 1999
), we took advantage of the presence of MT1-MMP at caveolin-1-positive and -negative fractions to check its activity at distinct subcellular compartments by fibrinogen zymography. MT1-MMP proteolytic activity was detected in both caveolae and noncaveolae (cytosolic and membrane) fractions in confluent ECs regardless the ECM; MT1-MMP specific activity was optimal at caveolae and cytosolic fractions, but it was significantly lower at plasma membrane fractions of confluent ECs on COL I in accordance to our previous data with total cell lysates (Figure 3B; Gálvez et al., 2002
).
Caveolae Integrity Is Required for MT1-MMP Function in Migratory ECs
The relevance of caveolae traffic in regulating MT1-MMP activity during endothelial migration was then analyzed. Besides impairing MT1-MMP internalization (Figure 2A, bottom), both cdx or filipin pretreatment of migratory ECs resulted in the decrease of MT1-MMP activity without affecting total protease expression (Figure 4A; our unpublished data). Because cdx disrupts caveolae and filipin mainly affects caveolae traffic, our data point to caveolae-mediated MT1-MMP traffic as relevant for protease activity regulation in migratory ECs. In addition, both cdx and filipin induced the loss of MT1-MMP, caveolin-1, and
v
3 integrin from motility-associated extensions of migratory ECs without interfering with MT1-MMP/
1 integrin presence at cell-cell contacts on COL I nor with EC morphology assessed by F-actin staining (Figure 4B; our unpublished data). Thus, the presence of caveolin-1 together with MT1-MMP and
v
3 integrin at caveolae might be involved in the mobilization of this complex to motility-associated structures, thus regulating proteolytic activity during endothelial migration.
|
The requirement of caveolae traffic for MT1-MMP-dependent functions during angiogenesis was then analyzed. cdx or filipin per se decreased endothelial migration, COL I gel invasion, and formation of capillary tubes without affecting EC viability (Figure 5, A and B; see above). Remarkably, the inhibitory anti-MT1-MMP mAb LEM-2/15 that significantly impaired EC migration, COL I gel invasion, and capillary formation in control cells, lost its inhibitory ability upon pretreatment of ECs with cdx or filipin (Figure 5, A and B). Cholesterol replenishment restored, however, the anti-MT1-MMP mAb inhibitory ability on endothelial transmigration (Figure 5A). In contrast, the functional effects of the activatory anti-
1 integrin mAb TS2/16 and the neutralizing anti-
1 integrin mAb LIA1/2 were significant in both untreated and cdx- or filipin-treated ECs (Figure 5, A and B). These data point to an important requirement of caveolae traffic for proper regulation of MT1-MMP function in ECs.
|
Targeting Caveolin-1 Expression Impairs MT1-MMP Function in Human ECs
The functional relevance of caveolae traffic in regulating MT1-MMP function was additionally investigated by specifically targeting caveolin-1 expression by interference RNA. Caveolin-1 but not MT1-MMP protein level decreased in a dose-dependent manner by transfection of specific but not scrambled cav-1 siRNA in human ECs (Figure 6A). No MT1-MMP localization at clusters and only a diffuse perinuclear pattern of both MT1-MMP and remaining caveolin-1 similar to cdx-treated ECs (Figure 4C) was observed in subconfluent ECs transfected with specific cav-1 siRNA in contrast to abundant presence of MT1-MMP at clusters in ECs transfected with scrambled cav-1 siRNA (Figure 6B). Interestingly, MT1-MMP internalization and activity were also decreased by transfection of specific cav-1 siRNA compared with scrambled siRNA in subconfluent ECs (Figure 6, C and D). Finally, MT1-MMP function in angiogenesis was tested by the ability of the inhibitory anti-MT1-MMP mAb LEM-2/15 of impairing endothelial transmigration and formation of capillary tubes. As shown in Figure 6E, the anti-MT1-MMP LEM-2/15 mAb significantly decreased both processes in ECs transfected with the scrambled but not the specific cav-1 siRNA in contrast to the significant effects of the anti-
1 integrin mAbs regardless the siRNA transfected. Thus, the presence of caveolin-1 is required for proper regulation of MT1-MMP traffic and function in migratory ECs.
|
| DISCUSSION |
|---|
|
|
|---|
|
MT1-MMP was previously found to be distinctly modulated by the ECM (Gálvez et al., 2002
). Herein, we have identified the small GTPase RhoA like a mediator of such effect. Although the role of these GTPases in regulating cellular morphology and migration has been well established (Etienne-Manneville and Hall, 2002
; Martin et al., 2002
) and no differences in RhoA activation could be observed in migrating ECs, we have demonstrated that RhoA is distinctly activated in confluent nonmigratory ECs in an ECM-dependent manner. This differential RhoA activation by specific ECM-cellular interactions has also been reported during cell spreading on fibronectin by binding to
5
1 or
v
3 integrins (Danen et al., 2002
). Interestingly, RhoA activation in confluent ECs accounts for recruitment of MT1-MMP to cell-cell contacts as previously shown for endothelial junction components such as VE-cadherin or
-catenins (Lee et al., 1999
; Charrasse et al., 2002
) as well as for blockade of its traffic. RhoA-induced MT1-MMP relocalization to the junctions seemed to be independent of actin polymerization because it was still observed in the presence of cytochalasin D (our unpublished data). Our data support that ECM-mediated RhoA activation might regulate MT1-MMP in two different ways: regulation might be direct in confluent ECs by favoring the recruitment of MT1-MMP to the cell-cell contacts on COL I but indirect if any in subconfluent ECs likely by modulating cell morphology and migration. Thus, a novel functional link between ECM, integrins, RhoA, and MT1-MMP in primary human ECs is now established.
It has recently been reported that MT1-MMP can be internalized via clathrin-coated pits in transformed cells (Jiang et al., 2001
; Uekita et al., 2001
). The blockade of MT1-MMP internalization by RhoA activation without apparently affecting clathrin-mediated TnfR endocytosis in confluent ECs led us to analyze alternative pathways for MT1-MMP traffic. Herein, we have demonstrated that MT1-MMP internalization in ECs takes place through caveolae. This pathway has first been demonstrated by treatment with agents that interfere with caveolae traffic such as filipin or cdx. Although cdx has been reported to also impair clathrin-dependent endocytosis, no effect on TnfR internalization was observed at 1 µM dose of cdx, much lower than the usual 1 mM reported, thus reinforcing the specificity of cdx effects on caveolae in our system (Rodal et al., 1999
; Subtil et al., 1999
). Furthermore, to avoid any putative unspecific or toxic effects of these inhibitors (although EC viability was unaffected), targeting of caveolin-1 expression by interference RNA was performed in human primary ECs; this approach was very efficient and confirmed all the functional effects observed with the inhibitors. Caveolae are herein demonstrated to be key for MT1-MMP traffic in ECs during wound healing-induced migration and important in confluent ECs on GEL; a partial contribution of the classic endocytic pathway during MT1-MMP internalization in confluent ECs on GEL is not ruled out because okadaic acid slightly inhibited this process. This dual contribution is in agreement with a recent report about MT1-MMP traffic in tumor cells (Remacle et al., 2003
). The apparent contrast of our data with the previous unique role assigned to clathrin-dependent endocytosis in MT1-MMP internalization might be related to the use of transformed cells, which contain few or none caveolae, as well as of a dynamin mutant that can also interfere with caveolae traffic (Koleske et al., 1995
; Schnitzer et al., 1996
).
Caveolae involvement on MT1-MMP traffic is further supported by the colocalization of MT1-MMP and caveolin-1 in ECs. Although this colocalization had previously been proposed (Puyraimond et al., 2001
), here it is demonstrated that the two proteins colocalize at clusters in extensions of migratory human ECs. This is in accordance with the presence of caveolin-1 reported at the leading edge of ECs and at membrane ruffles of melanoma cells together with uPA (Isshiki et al., 1998
; Stahl and Mueller, 1995
). Moreover, we observed an increase in caveolin-1 expression upon induction of endothelial migration (our unpublished results). Caveolin-1 together with MT1-MMP also colocalized with
v
3 integrin that is involved in endothelial migration and has been preferentially found in lipid microdomains from carcinoma and melanoma cells (Green et al., 1999
). In contrast, MT1-MMP at endothelial cell-cell contacts together with
1 integrins does not colocalize with caveolin-1, which is absent from these sites in ECs, although other groups have reported caveolin-1 intercellular staining on adipocytes and on human vascular smooth muscle cells (Parton et al., 1994
; Wei et al., 1999
). Caveolae disruption by cdx or filipin or by caveolin-1 siRNA results in the disappearance of MT1-MMP, caveolin-1, and
v
3 integrin from motility-associated structures but not of
1 integrins from cell-cell contacts indicating a role for caveolae in receptor compartmentalization. Therefore, caveolae might constitute a mechanism for MT1-MMP mobilization to cellular migratory sites.
Direct assessment of MT1-MMP compartmentalization in lipid microdomains has also been addressed. Thus, MT1-MMP is demonstrated to be present at caveolae in confluent ECs on GEL or COL I, as recently reported in tumor cells (Annabi et al., 2001
; Remacle et al., 2003
). In confluent ECs on COL I, MT1-MMP might be associated to ventral caveolae in contrast to mobile caveolae throughout the cell on GEL as suggested by the internalization data as well as by the staining of proteins associated to the ECM after mild cell solubilization (our unpublished results). Coimmunoprecipitation assays suggested an indirect if any association of MT1-MMP and caveolin-1 through either lipid domains or other proteins (our unpublished results). In this regard,
v but not
1 integrins are present at caveolin-positive domains in human ECs in accordance with the colocalization data.
Caveolin-1 can modulate the activity and function of different proteins (Stahl and Mueller, 1995
; Okamoto et al., 1998
). In this regard, MT1-MMP at caveolae and at noncaveolae cytosolic fractions seemed to display optimal specific activity compared with MT1-MMP at membrane fractions in confluent ECs on COL I, pointing to protease subcellular compartmentalization as a relevant mechanism for controlling protease activity. In this regard, the MT1-MMP 63-kDa mature form present at caveolae of fibrosarcoma cells had previously been shown to be processed to a 43-kDa MT1-MMP form after concanavalin A stimulation (Annabi et al., 2001
). The requirement of caveolae traffic for MT1-MMP proper activity in migratory ECs was additionally demonstrated by both pretreatment with caveolae disrupting agents as well as by targeting caveolin-1 with siRNA. Caveolae-mediated internalization seems to be the requirement for regulating MT1-MMP activity because filipin, which mainly affects caveolae traffic, interfered with MT1-MMP activity. This is in accordance with the requirement of clathrin-mediated endocytosis for proper MT1-MMP activity reported previously (Jiang et al., 2001
). Mobilization of caveolae to migratory sites might facilitate MT1-MMP clustering and oligomerization known to be important for its activation (Itoh et al., 2001
; Lehti et al., 2002
). In this regard, clustering of uPAR/uPA in caveolae has been shown to promote efficient cell surface plasminogen activation (Stahl and Mueller, 1995
). On the other hand, internalization might be a mechanism for recycling and removal of already inactive forms of the protease as proposed (Uekita et al., 2001
).
MT1-MMP plays an active role in endothelial cell migration, invasion, and formation of capillary tubes (Gálvez et al., 2001
). This ability of MT1-MMP is, however, lost in the absence of caveolae traffic achieved by pretreatment with cdx or filipin or by selectively targeting caveolin-1 expression. The function of other receptors like
1 integrins is however preserved under these conditions. Defects in caveolin-1 might interfere with MT1-MMP/
v
3 integrin association and activity but preserve
1 integrin function because no caveolin-1/
1 integrin colocalization is detected in ECs. cdx or filipin treatment per se reduced endothelial motility but the restoration of MT1-MMP-mediated endothelial functions upon cholesterol replenishment pointed to a specific effect in this proteolytic pathway that is reinforced by data obtained with siRNA. In contrast, some studies have shown that the overexpression of caveolin-1 resulted in a loss of MT1-MMP-dependent migration in MT1-MMP-transfected COS7 cells (Annabi et al., 2001
). Primary and tumor cells might be differently regulated in this respect because tumor cells often deprived of caveolae would lack of such regulatory mechanism (Koleske et al., 1995
; Annabi et al., 2001
). Therefore, caveolae and caveolin-1 are important for endothelial migration, invasion, and capillary formation because they might allow a regulated MT1-MMP endocytosis necessary for these functions. In this regard, impaired internalization of cytosolic-truncated MT1-MMP also resulted in inhibition of migration and invasion of transfected-Chinese hamster ovary cells (Uekita et al., 2001
).
The relevance of caveolae in pathology is highlighted by the development of lung and muscle disease in animal models deficient in different caveolins and so in caveolae as well as by the presence of caveolin-1 mutations in invasive human breast carcinomas (Razani and Lisanti, 2001
). Moreover, caveolin-1 knockout mice show an increase in matrix deposition in the lungs that might be related to an impaired ECM remodeling due to the absence of regulated MT1-MMP activity (Holmbeck et al., 1999
; Drab et al., 2001
; Razani et al., 2001
). This could be relevant for the design of novel therapeutic approaches interfering specifically with the presence of MT1-MMP at caveolae thus selectively targeting active MT1-MMP in disease.
In summary, we have reported caveolae-mediated traffic as a novel mechanism regulating MT1-MMP localization, activity, and function in human ECs. Moreover, the ECM via a RhoA-dependent signaling can modulate this pathway in quiescent ECs. Therefore, there is a delicate communication between ECM and MT1-MMP allowing its proper activity and function during angiogenesis.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
v and anti-
v
3 integrin mAbs, Dr. John Collard (The Netherlands Cancer Institute, Amsterdam) for the GST-C21 construction, and Dr. M.A. Alonso for critical comments. We are extremely grateful to E. López and C. Zaragoza for help and advice with caveolae isolation and iRNA technique. B.G.G. is a predoctoral fellow from the Comunidad Autónoma de Madrid. This work was supported by Ayuda de Investigación Básica Juan March 2002 to F.S.-M. and grants FIS00/0114 from Fondo de Investigaciones Sanitarias, CAM 08.3/0015.1/2001 from Comunidad Autónoma de Madrid, and SAF2002-00068 from Ministerio de Ciencia y Tecnología to A.G.A. | Footnotes |
|---|
Abbreviations used: cdx, cyclodextrin; COL I, collagen type I; EC, endothelial cell; ECM, extracellular matrix; GEL, gelatin; MMP, matrix metalloproteinase; MT1-MMP, membrane-type 1 matrix metalloproteinase; TnfR, transferrin receptor.
Present address: Centro de Investigaciones Biológicas, CSIC, Madrid, Spain. ![]()
* Corresponding author. E-mail address: agarciaa.hlpr{at}salud.madrid.org.
| REFERENCES |
|---|
|
|
|---|
Conrad, P.A., Smart, E.J., Ying, Y.S., Anderson, R.G., and Bloom, G.S. (1995). Caveolin cycles between plasma membrane caveolae and the Golgi complex by microtubule-dependent and microtubule-independent steps. J. Cell Biol. 131, 1421-1433.
Charrasse, S., Meriane, M., Comunale, F., Blangy, A., and Gauthier-Rouviere, C. (2002). N-cadherin-dependent cell-cell contact regulates Rho GTPases and
-catenin localization in mouse C2C12 myoblasts. J. Cell Biol. 158, 953-965.
Danen, E.H., Sonneveld, P., Brakebusch, C., Fassler, R., and Sonnenberg, A. (2002). The fibronectin-binding integrins
5
1 and
v
3 differentially modulate RhoA-GTP loading, organization of cell matrix adhesions, and fibronectin fibrillogenesis. J. Cell Biol. 159, 1071-1086.
Drab, M., et al. (2001). Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science 293, 2449-2452.
Ellis, S., and Mellor, H. (2000). Regulation of endocytic traffic by rho family GTPases. Trends Cell Biol. 10, 85-88.[CrossRef][Medline]
Etienne-Manneville, S., and Hall, A. (2002). Rho GTPases in cell biology. Nature 420, 629-635.[CrossRef][Medline]
Fukata, M., and Kaibuchi, K. (2001). Rho-family GTPases in cadherin-mediated cell-cell adhesion. Nat. Rev. Mol. Cell. Biol. 2, 887-897.[CrossRef][Medline]
Fukata, M., Nakagawa, M., Kuroda, S., and Kaibuchi, K. (1999). Cell adhesion and Rho small GTPases. J. Cell Sci. 112, 4491-4500.[Abstract]
Gálvez, B.G., Matías-Román, S., Albar, J.P., Sánchez-Madrid, F., and Arroyo, A.G. (2001). Membrane type 1-matrix metalloproteinase is activated during migration of human endothelial cells and modulates endothelial motility and matrix remodeling. J. Biol. Chem. 276, 37491-37500.
Gálvez, B.G., Matías-Román, S., Yáñez-Mó, M., Sánchez-Madrid, F., and Arroyo, A.G. (2002). ECM regulates MT1-MMP localization with
1 or
v
3 integrins at distinct cell compartments modulating its internalization and activity on human endothelial cells. J. Cell Biol. 159, 509-521.
Gingras, D., Gauthier, F., Lamy, S., Desrosiers, R.R., and Beliveau, R. (1998). Localization of RhoA GTPase to endothelial caveolae-enriched membrane domains. Biochem. Biophys. Res. Commun. 247, 888-893.[CrossRef][Medline]
Green, J.M., Zhelesnyak, A., Chung, J., Lindberg, F.P., Sarfati, M., Frazier, W.A., and Brown, E.J. (1999). Role of cholesterol in formation and function of a signaling complex involving
v
3, integrin-associated protein (CD47), and heterotrimeric G proteins. J. Cell Biol. 146, 673-682.
Hall, A. (1998). Rho GTPases and the actin cytoskeleton. Science 279, 509-514.
Holmbeck, K., et al. (1999). MT1-MMP-deficient mice develop dwarfism, osteopenia, arthritis, and connective tissue disease due to inadequate collagen turnover. Cell 99, 81-92.[CrossRef][Medline]
Isshiki, M., Ando, J., Korenaga, R., Kogo, H., Fujimoto, T., Fujita, T., and Kamiya, A. (1998). Endothelial Ca2+ waves preferentially originate at specific loci in caveolin-rich cell edges. Proc. Natl. Acad. Sci. USA 95, 5009-5014.
Itoh, Y., Takamura, A., Ito, N., Maru, Y., Sato, H., Suenaga, N., Aoki, T., and Seiki, M. (2001). Homophilic complex formation of MT1-MMP facilitates proMMP-2 activation on the cell surface and promotes tumor cell invasion. EMBO J. 20, 4782-4793.[CrossRef][Medline]
Jiang, A., Lehti, K., Wang, X., Weiss, S.J., Keski-Oja, J., and Pei, D. (2001). Regulation of membrane-type matrix metalloproteinase 1 activity by dynamin-mediated endocytosis. Proc. Natl. Acad. Sci. USA 98, 13693-13698.
Kajita, M., Itoh, Y., Chiba, T., Mori, H., Okada, A., Kinoh, H., and Seiki, M. (2001). Membrane-type 1 matrix metalloproteinase cleaves CD44 and promotes cell migration. J. Cell Biol. 153, 893-904.
Koleske, A.J., Baltimore, D., and Lisanti, M.P. (1995). Reduction of caveolin and caveolae in oncogenically transformed cells. Proc. Natl. Acad. Sci. USA 92, 1381-1385.
Kurzchalia, T.V., and Parton, R.G. (1999). Membrane microdomains and caveolae. Curr. Opin. Cell Biol. 11, 424-431.[CrossRef][Medline]
Lee, M.J., Thangada, S., Claffey, K.P., Ancellin, N., Liu, C.H., Kluk, M., Volpi, M., Sha'afi, R.I., and Hla, T. (1999). Vascular endothelial cell adherens junction assembly and morphogenesis induced by sphingosine-1-phosphate. Cell 99, 301-312.[CrossRef][Medline]
Lehti, K., Lohi, J., Juntunen, M., Pei, D., and Keski-Oja, J. (2002). Oligomerization through hemopexin and cytoplasmic domains regulates the activity and turnover of membrane-type 1 matrix metalloproteinase (MT1-MMP). J. Biol. Chem. 277, 8440-8448.
Martin, K.H., Slack, J.K., Boerner, S.A., Martin, C.C., and Parsons, J.T. (2002). Integrin connections map: to infinity and beyond. Science 296, 1652-1653.
McCawley, L.J., and Matrisian, L.M. (2001). Matrix metalloproteinases: they're not just for matrix anymore! Curr. Opin. Cell Biol. 13, 534-540.[CrossRef][Medline]
Nabeshima, K., Inoue, T., Shimao, Y., Okada, Y., Itoh, Y., Seiki, M., and Koono, M. (2000). Front-cell-specific expression of membrane-type 1 matrix metalloproteinase and gelatinase A during cohort migration of colon carcinoma cells induced by hepatocyte growth factor/scatter factor. Cancer Res. 60, 3363-3369.
Okamoto, T., Schlegel, A., Scherer, P.E., and Lisanti, M.P. (1998). Caveolins, a family of scaffolding proteins for organizing "preassembled signaling complexes" at the plasma membrane. J. Biol. Chem. 273, 5419-5422.
Parton, R.G., Joggerst, B., and Simons, K. (1994). Regulated internalization of caveolae. J. Cell Biol. 127, 1199-1215.
Puyraimond, A., Fridman, R., Lemesle, M., Arbeille, B., and Menashi, S. (2001). MMP-2 colocalizes with caveolae on the surface of endothelial cells. Exp. Cell Res. 262, 28-36.[CrossRef][Medline]
Ratnikov, B.I., Rozanov, D.V., Postnova, T.I., Baciu, P.G., Zhang, H., DiScipio, R.G., Chestukhina, G.G., Smith, J.W., Deryugina, E.I., and Strongin, A.Y. (2002). An alternative processing of integrin
v subunit in tumor cells by membrane type-1 matrix metalloproteinase. J. Biol. Chem. 277, 7377-7385.
Razani, B., et al. (2001). Caveolin-1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities. J. Biol. Chem. 276, 38121-38138.
Razani, B., and Lisanti, M.P. (2001). Caveolin-deficient mice: insights into caveolae function and human disease. J. Clin. Investig. 108, 1553-1561.[CrossRef][Medline]
Remacle, A., Murphy, G., and Roghi, C. (2003). Membrane type 1-matrix metalloproteinase (MT1-MMP) is internalised by two different pathways and is recycled to the cell surface. J. Cell Sci. 116, 3905-3916.
Rodal, S.K., Skretting, G., Garred, O., Vilhardt, F., van Deurs, B., and Sandvig, K. (1999). Extraction of cholesterol with methyl-
-cyclodextrin perturbs formation of clathrin-coated endocytic vesicles. Mol. Biol. Cell 10, 961-974.
Sander, E.E., ten Klooster, J.P., van Delft, S., van der Kammen, R.A., and Collard, J.G. (1999). Rac downregulates Rho activity: reciprocal balance between both GTPases determines cellular morphology and migratory behavior. J. Cell Biol. 147, 1009-1022.
Sato, H., Takino, T., Okada, Y., Cao, J., Shinagawa, A., Yamamoto, E., and Seiki, M. (1994). A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature 370, 61-65.[CrossRef][Medline]
Schlegel, A., Arvan, P., and Lisanti, M.P. (2001). Caveolin-1 binding to endoplasmic reticulum membranes and entry into the regulated secretory pathway are regulated by serine phosphorylation. Protein sorting at the level of the endoplasmic reticulum. J. Biol. Chem. 276, 4398-4408.
Schnitzer, J.E., Oh, P., and McIntosh, D.P. (1996). Role of GTP hydrolysis in fission of caveolae directly from plasma membranes. Science 274, 239-242.
Seiki, M. (2002). The cell surface: the stage for matrix metalloproteinase regulation of migration. Curr. Opin. Cell Biol. 14, 624-632.[CrossRef][Medline]
Smart, E.J., Graf, G.A., McNiven, M.A., Sessa, W.C., Engelman, J.A., Scherer, P.E., Okamoto, T., and Lisanti, M.P. (1999). Caveolins, liquid-ordered domains, and signal transduction. Mol. Cell. Biol. 19, 7289-7304.
Stahl, A., and Mueller, B.M. (1995). The urokinase-type plasminogen activator receptor, a GPI-linked protein, is localized in caveolae. J. Cell Biol. 129, 335-344.
Stahlhut, M., and van Deurs, B. (2000). Identification of filamin as a novel ligand for caveolin-1, evidence for the organization of caveolin-1-associated membrane domains by the actin cytoskeleton. Mol. Biol. Cell 11, 325-337.
Subtil, A., Gaidarov, I., Kobylarz, K., Lampson, M.A., Keen, J.H., and McGraw, T.E. (1999). Acute cholesterol depletion inhibits clathrin-coated pit budding. Proc. Natl. Acad. Sci. USA 96, 6775-6780.
Uekita, T., Itoh, Y., Yana, I., Ohno, H., and Seiki, M. (2001). Cytoplasmic tail-dependent internalization of membrane-type 1 matrix metalloproteinase is important for its invasion-promoting activity. J. Cell Biol. 155, 1345-1356.
Wary, K.K., Mariotti, A., Zurzolo, C., and Giancotti, F.G. (1998). A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell 94, 625-634.[CrossRef][Medline]
Wei, Y., Yang, X., Liu, Q., Wilkins, J.A., and Chapman, H.A. (1999). A role for caveolin and the urokinase receptor in integrin-mediated adhesion and signaling. J. Cell Biol. 144, 1285-1294.
Werb, Z. (1997). ECM and cell surface proteolysis: regulating cellular ecology. Cell 91, 439-442.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Yamaguchi, Y. Takeo, S. Yoshida, Z. Kouchi, Y. Nakamura, and K. Fukami Lipid Rafts and Caveolin-1 Are Required for Invadopodia Formation and Extracellular Matrix Degradation by Human Breast Cancer Cells Cancer Res., November 15, 2009; 69(22): 8594 - 8602. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Deshmukh, A. McLachlan, J. J. Atkinson, W. D. Hardie, T. R. Korfhagen, M. Dietsch, Y. Liu, P. Y. P. Di, S. C. Wesselkamper, M. T. Borchers, et al. Matrix Metalloproteinase-14 Mediates a Phenotypic Shift in the Airways to Increase Mucin Production Am. J. Respir. Crit. Care Med., November 1, 2009; 180(9): 834 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Alcazar, A. M. Hawkridge, T. S. Collier, S. W. Cousins, S. K. Bhattacharya, D. C. Muddiman, and M. E. Marin-Castano Proteomics Characterization of Cell Membrane Blebs in Human Retinal Pigment Epithelium Cells Mol. Cell. Proteomics, October 1, 2009; 8(10): 2201 - 2211. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Lizarbe, C. Tarin, M. Gomez, B. Lavin, E. Aracil, L. M. Orte, and C. Zaragoza Nitric Oxide Induces the Progression of Abdominal Aortic Aneurysms through the Matrix Metalloproteinase Inducer EMMPRIN Am. J. Pathol., October 1, 2009; 175(4): 1421 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Poincloux, F. Lizarraga, and P. Chavrier Matrix invasion by tumour cells: a focus on MT1-MMP trafficking to invadopodia J. Cell Sci., September 1, 2009; 122(17): 3015 - 3024. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yanez-Mo, O. Barreiro, P. Gonzalo, A. Batista, D. Megias, L. Genis, N. Sachs, M. Sala-Valdes, M. A. Alonso, M. C. Montoya, et al. MT1-MMP collagenolytic activity is regulated through association with tetraspanin CD151 in primary endothelial cells Blood, October 15, 2008; 112(8): 3217 - 3226. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Lizarbe, C. Garcia-Rama, C. Tarin, M. Saura, E. Calvo, J. A. Lopez, C. Lopez-Otin, A. R. Folgueras, S. Lamas, and C. Zaragoza Nitric oxide elicits functional MMP-13 protein-tyrosine nitration during wound repair FASEB J, September 1, 2008; 22(9): 3207 - 3215. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ispanovic, D. Serio, and T. L. Haas Cdc42 and RhoA have opposing roles in regulating membrane type 1-matrix metalloproteinase localization and matrix metalloproteinase-2 activation Am J Physiol Cell Physiol, September 1, 2008; 295(3): C600 - C610. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Alfranca, J. M. Lopez-Oliva, L. Genis, D. Lopez-Maderuelo, I. Mirones, D. Salvado, A. J. Quesada, A. G. Arroyo, and J. M. Redondo PGE2 induces angiogenesis via MT1-MMP-mediated activation of the TGF{beta}/Alk5 signaling pathway Blood, August 15, 2008; 112(4): 1120 - 1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. W.M. van Hinsbergh and P. Koolwijk Endothelial sprouting and angiogenesis: matrix metalloproteinases in the lead Cardiovasc Res, May 1, 2008; 78(2): 203 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takino, H. Saeki, H. Miyamori, T. Kudo, and H. Sato Inhibition of Membrane-Type 1 Matrix Metalloproteinase at Cell-Matrix Adhesions Cancer Res., December 15, 2007; 67(24): 11621 - 11629. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Genis, P. Gonzalo, A. S. Tutor, B. G. Galvez, A. Martinez-Ruiz, C. Zaragoza, S. Lamas, K. Tryggvason, S. S. Apte, and A. G. Arroyo Functional interplay between endothelial nitric oxide synthase and membrane type 1 matrix metalloproteinase in migrating endothelial cells Blood, October 15, 2007; 110(8): 2916 - 2923. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Nyalendo, M. Michaud, E. Beaulieu, C. Roghi, G. Murphy, D. Gingras, and R. Beliveau Src-dependent Phosphorylation of Membrane Type I Matrix Metalloproteinase on Cytoplasmic Tyrosine 573: ROLE IN ENDOTHELIAL AND TUMOR CELL MIGRATION J. Biol. Chem., May 25, 2007; 282(21): 15690 - 15699. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grande-Garcia, A. Echarri, J. de Rooij, N. B. Alderson, C. M. Waterman-Storer, J. M. Valdivielso, and M. A. del Pozo Caveolin-1 regulates cell polarization and directional migration through Src kinase and Rho GTPases J. Cell Biol., May 21, 2007; 177(4): 683 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Miki, Y. Takegami, K. Okawa, T. Muraguchi, M. Noda, and C. Takahashi The Reversion-inducing Cysteine-rich Protein with Kazal Motifs (RECK) Interacts with Membrane Type 1 Matrix Metalloproteinase and CD13/Aminopeptidase N and Modulates Their Endocytic Pathways J. Biol. Chem., April 20, 2007; 282(16): 12341 - 12352. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nie, J. Pei, M. Blumenthal, and D. Pei Complete Restoration of Cell Surface Activity of Transmembrane-truncated MT1-MMP by a Glycosylphosphatidylinositol Anchor: IMPLICATIONS FOR MT1-MMP-MEDIATED PROMMP2 ACTIVATION AND COLLAGENOLYSIS IN THREE-DIMENSIONS J. Biol. Chem., March 2, 2007; 282(9): 6438 - 6443. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ning, T. Buranda, and L. G. Hudson Activated Epidermal Growth Factor Receptor Induces Integrin {alpha}2 Internalization via Caveolae/Raft-dependent Endocytic Pathway J. Biol. Chem., March 2, 2007; 282(9): 6380 - 6387. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ispanovic and T. L. Haas JNK and PI3K differentially regulate MMP-2 and MT1-MMP mRNA and protein in response to actin cytoskeleton reorganization in endothelial cells Am J Physiol Cell Physiol, October 1, 2006; 291(4): C579 - C588. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. W.M. van Hinsbergh, M. A. Engelse, and P. H.A. Quax Pericellular Proteases in Angiogenesis and Vasculogenesis Arterioscler Thromb Vasc Biol, April 1, 2006; 26(4): 716 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lafleur, F. A. Mercuri, N. Ruangpanit, M. Seiki, H. Sato, and E. W. Thompson Type I Collagen Abrogates the Clathrin-mediated Internalization of Membrane Type 1 Matrix Metalloproteinase (MT1-MMP) via the MT1-MMP Hemopexin Domain J. Biol. Chem., March 10, 2006; 281(10): 6826 - 6840. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Osenkowski, S. O. Meroueh, D. Pavel, S. Mobashery, and R. Fridman Mutational and Structural Analyses of the Hinge Region of Membrane Type 1-Matrix Metalloproteinase and Enzyme Processing J. Biol. Chem., July 15, 2005; 280(28): 26160 - 26168. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cambier, S. Gline, D. Mu, R. Collins, J. Araya, G. Dolganov, S. Einheber, N. Boudreau, and S. L. Nishimura Integrin {alpha}v{beta}8-Mediated Activation of Transforming Growth Factor-{beta} by Perivascular Astrocytes: An Angiogenic Control Switch Am. J. Pathol., June 1, 2005; 166(6): 1883 - 1894. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lehti, E. Allen, H. Birkedal-Hansen, K. Holmbeck, Y. Miyake, T.-H. Chun, and S. J. Weiss An MT1-MMP-PDGF receptor-{beta} axis regulates mural cell investment of the microvasculature Genes & Dev., April 15, 2005; 19(8): 979 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cavallo-Medved, J. Mai, J. Dosescu, M. Sameni, and B. F. Sloane Caveolin-1 mediates the expression and localization of cathepsin B, pro-urokinase plasminogen activator and their cell-surface receptors in human colorectal carcinoma cells J. Cell Sci., April 1, 2005; 118(7): 1493 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Williams and M. P. Lisanti Caveolin-1 in oncogenic transformation, cancer, and metastasis Am J Physiol Cell Physiol, March 1, 2005; 288(3): C494 - C506. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Galvez, L. Genis, S. Matias-Roman, S. A. Oblander, K. Tryggvason, S. S. Apte, and A. G. Arroyo Membrane Type 1-Matrix Metalloproteinase Is Regulated by Chemokines Monocyte-Chemoattractant Protein-1/CCL2 and Interleukin-8/CXCL8 in Endothelial Cells during Angiogenesis J. Biol. Chem., January 14, 2005; 280(2): 1292 - 1298. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Emonard, G. Bellon, L. Troeberg, A. Berton, A. Robinet, P. Henriet, E. Marbaix, K. Kirkegaard, L. Patthy, Y. Eeckhout, et al. Low Density Lipoprotein Receptor-related Protein Mediates Endocytic Clearance of Pro-MMP-2{middle dot}TIMP-2 Complex through a Thrombospondin-independent Mechanism J. Biol. Chem., December 24, 2004; 279(52): 54944 - 54951. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Labrecque, C. Nyalendo, S. Langlois, Y. Durocher, C. Roghi, G. Murphy, D. Gingras, and R. Beliveau Src-mediated Tyrosine Phosphorylation of Caveolin-1 Induces Its Association with Membrane Type 1 Matrix Metalloproteinase J. Biol. Chem., December 10, 2004; 279(50): 52132 - 52140. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Williams, F. Medina, I. Badano, R. B. Hazan, J. Hutchinson, W. J. Muller, N. G. Chopra, P. E. Scherer, R. G. Pestell, and M. P. Lisanti Caveolin-1 Gene Disruption Promotes Mammary Tumorigenesis and Dramatically Enhances Lung Metastasis in Vivo: ROLE OF CAV-1 IN CELL INVASIVENESS AND MATRIX METALLOPROTEINASE (MMP-2/9) SECRETION J. Biol. Chem., December 3, 2004; 279(49): 51630 - 51646. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gonzalez, A. Nagiel, A. J. Lin, D. E. Golan, and T. Michel Small Interfering RNA-mediated Down-regulation of Caveolin-1 Differentially Modulates Signaling Pathways in Endothelial Cells J. Biol. Chem., September 24, 2004; 279(39): 40659 - 40669. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||