![]() |
|
|
Vol. 15, Issue 3, 1224-1232, March 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




* Dipartimento di Sanità Pubblica e Biologia Cellulare, University of Rome "Tor Vergata," 00133 Rome, Italy;
Istituto di Endocrinologia e Oncologia Sperimentale del CNR c/o Dipartimento di Biologia e Patologia Cellulare e Molecolare, University of Naples "Federico II," 80131 Naples, Italy; and
Dipartimento di Medicina Sperimentale, II University of Naples, 80138 Naples, Italy
Submitted September 3, 2003;
Revised November 12, 2003;
Accepted November 18, 2003
Monitoring Editor: Joseph Gall
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The role played by the MAPK pathway in mammalian meiosis is less clear. Deletion of the mos gene has no apparent effect in male meiosis in the mouse, whereas it alters the meiotic divisions of oocytes (Colledge et al., 1994
; Hashimoto et al., 1994
). It was shown that mos-/- oocytes progress normally through the first meiotic division and extrude the first polar body, but they fail to arrest at metaphase II, a prerequisite for physiological fertilization by the sperm. Thus, it was proposed that in mammalian meiosis the MAPK pathway plays a role only in establishing the cytostatic activity that maintains the oocyte arrested at metaphase II until fertilization occurs (Sagata, 1997
; Tunquist and Maller, 2003
). However, a closer look at the phenotype of mos-/- oocytes revealed that meiotic failure was more complicated than initially proposed. Choi and colleagues observed that the first meiotic division of these oocytes often resembles a mitotic division, with production of an abnormally large polar body that often undergoes further cleavage (Choi et al., 1996
). Activation of the MAPK pathway in meiosis is also important for the asymmetric position of the spindle, which ensures unequal segregation of cytoplasm between the oocyte and the polar body (Verlhac et al., 1996
, 2000
). Hence, besides chromatin condensation and DNA duplication, spindle assembly is also under the control of the MAPK pathway in mammalian meiosis.
The lack of in vitro culture systems to study male meiotic progression has hampered the study of the molecular mechanisms involved in the mammalian spermatocyte cell cycle (Handel and Eppig, 1998
). However, hints on the regulation of the male meiotic cell cycle started to occur when it was demonstrated that pachytene spermatocytes can be induced to enter metaphase in culture by treatment with the serinethreonine phosphatase inhibitor okadaic acid (OA) (Wiltshire et al., 1995
; Cobb et al., 1999
). Metaphase chromosomes obtained by this treatment are normal bivalents in which crossing over is completed, the synaptonemal complex has dissolved, and chiasmata are present (Wiltshire et al., 1995
). Spermatocyte G2/M progression is accompanied by activation of maturation promoting factor (MPF), the cyclinBcdc2 complex (Wiltshire et al., 1995
), and MAPKs (Sette et al., 1999
). In particular, activation of the MAPK pathway is required to ensure efficient chromatin condensation into metaphase chromosomes (Sette et al., 1999
). In this regard, it was shown that a chromatin-associated protein, the NIMA-like kinase Nek2, was also activated during the G2/M progression of mouse spermatocytes (Rhee and Wolgemuth, 1997
).
NIMA kinase is required, in addition to Cdc2, for the G2/M progression and chromatin condensation during mitosis in Aspergillus nidulans (Osmani et al., 1991
). We have observed that the MAPK pathway triggers the sequential activation of p90Rsk2 and Nek2 in mouse spermatocytes, thus suggesting that a kinase cascade involving Nek2 plays a role in chromatin condensation in male meiosis (Di Agostino et al., 2002
). However, it is unclear whether Nek2 directly participates to chromatin condensation by phosphorylating proteins associated to DNA. Recently, mouse animal models have indicated that DNA architectural proteins belonging to the HMG superfamily are required for spermatogenesis. It was found that deletion of hmga2 and hmgb2, which belong to two different HMG families (Bustin, 1999
), produce mice that are either sterile or subfertile and display spermatogenic defects and low sperm production (Ronfani et al., 2001
; Chieffi et al., 2002
). HMGA and B proteins act as architectural factors in the chromatin, producing bends that expose DNA to transcriptional factors. Furthermore, their modification by phosphorylation and/or acetylation causes transcriptional regulation and a change in their affinity for DNA (Bustin, 1999
). Interestingly, although HMGA1 and HMGA2 are highly expressed in the actively dividing embryonic tissues, their expression in the adult is confined to the testis and few other tissues (Fedele et al., 2001
); however, their specific function in mouse spermatogenesis remains unknown.
In this work, we demonstrate a specific interaction between Nek2 and HMGA2 in mouse spermatocytes: the interaction is direct and requires the C-terminal regulatory region of the kinase. HMGA2 is phosphorylated in vivo in a MAPK pathway-dependent manner during the G2/M progression of mouse spermatocytes. Moreover, we show that Nek2 directly phosphorylates HMGA2 in vitro and that phosphorylation decreases the affinity of HMGA2 for DNA. Because HMG proteins are abundant components of chromatin that modulate DNA conformation and gene expression (Bustin, 1999
), our data suggest that posttranslation modification of HMGA2 by the MAPK pathway can be part of the mechanisms leading to chromosome condensation in male meiosis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids Construction
pGEX-3XNek2273444 encoding the regulatory domain of Nek2 fused to glutathione S-transferase (GST) has been described previously (Di Agostino et al., 2002
). pGEX-4T1Nek2272294, pGEX-4T1Nek2272369, and pGEX-4T1Nek2294444 were obtained by polymerase chain reaction and cloned into the BamHI and EcoRI sites of pGEX-3X as described previously (Di Agostino et al., 2002
). Full-length Nek2 cDNA was obtained by reverse transcription-polymerase chain reaction from spermatocyte total RNA (GI 6754817) and cloned in the BamHI site of the pCMV5 eukaryotic expression vector. The mycepitope was inserted at the N terminus by cloning Nek2 cDNA in the BamHI site of pCDNA3-myc. A catalytically inactive mutant of Nek2 (Nek2K37R) (Fry et al., 1995
) was created by site-directed mutagenesis of pCDNA3N2myc-Nek2. Mutagenic oligonucleotides were as follows: forward, 5'AGATATTAGTTTGGAGAGAACTTGACTATGGC3'; and reverse, with the underlined codon corresponding to residue 37 in wild-type Nek2. The sequence of wild-type and mutant Nek2 were confirmed by sequence analysis. The pET2c/A2 fusion expression plasmid for expression of His-HMGA2 and pECEFL-HA-HMGA2 for expression in eukaryotic cells have been described previously (Baldassarre et al., 2001
)
Bacterial Protein Expression and Purification
Escherichia coli cells (BL21-DE3) were transformed with the appropriate plasmid, grown at 37°C in LB medium to an optical density (600 nm) of 0.4, and induced with 0.5 mM isopropyl-1-thio-
-galactopyranoside for 3 h at the same temperature. Cells were harvested by centrifugation and lysed in ice-cold phosphate-buffered saline (PBS) containing 0.1% Triton X-100, 1 mM dithiothreitol (DTT), protease inhibitors, by probe sonication (3 cycles of 1 min). After centrifugation at 12,000 x g, supernatant fractions were incubated with either glutathione-Sepharose beads (G 4510; Sigma-Aldrich, St. Louis, MO), for GST-Nek2, or Nichel-Agarose beads (QIAGEN, Valencia, CA), for His-HMGA2, for 1 h at 4°C under constant shaking. After washes in PBS, GST-fusions were eluted with either 100 mM Tris-HCl, pH 8, 250 mM NaCl containing 10 mM glutathione (G 4251; Sigma-Aldrich), whereas His-HMGA2 was eluted with 500 mM imidazole and dialyzed against PBS overnight. Purified protein was stored at -80°C in the same buffer also containing 10% glycerol.
Transfection of Human Embryonic Kidney (HEK)293 Cells and Preparation of Cells Extracts
HEK293 were cultured in 10-cm-diameter dishes and transfected with the calcium phosphate method. Transfected HEK293 were incubated with or without 0.5 µM OA for the last 2 h to activate Nek2. Thirty hours after transfection, cells were collected in lysis buffer (50 mM HEPES, pH 7.5, 100 mM NaCl, 10 mM MgCl2, 5 mM KCl, 5 mM MnCl2, 5 mM EGTA, 2 mM EDTA, 20 mM
-glycerophosphate 0.1 mM sodium orthovanadate, 1 mM DTT, 10 µg/ml leupeptin and aprotinin, 1 mM phenylmethylsulfonyl fluoride, 20 mM NaF, 0.1% Nonidet P-40, 30 µg/ml DNase) and homogenized. After 30 min on ice, cell lysates were centrifuges for 10 min at 10,000 x g, and the supernatants were used for further studies. The same protocol of cell lysis was used for germ cell lysates.
Western Blot Analysis
Solubilized proteins were boiled for 5 min in SDS-PAGE sample buffer [62.5 mM Tris-HCl, pH 6.8, 10% glycerol, 2% (wt/vol) SDS, 0.7 M 2-mercaptoethanol, and 0.0025% (wt/vol) bromphenol blue], and resolved on 10 or 12% SDS-PAGE. Western blot analysis was performed as described previously (Di Agostino et al., 2002
). Primary antibodies, 2 h at room temperature, were as follows: mouse monoclonal anti-myc (1:500 dilution; Santa Cruz Biotechnology, Santa Cruz, CA); mouse monoclonal anti-His (1:1,000 dilution; QIA-GEN); mouse monoclonal anti-hemagglutinin (HA) (1:1000 dilution; QIA-GEN); rabbit anti-HMGA2 (25) (1:1,000 dilution) Baldassare, et al., 2001; rabbit anti-Nek2 R40 (provided by Dr. A.M. Fry, University of Leicester, Leicester, United Kingdom; 1:1,000 dilution); rabbit anti-extracellular signal-regulated kinase (Erk)1 (1:1,000 dilution; Santa Cruz Biotechnology); and goat anti-Nek2 (1:1,000 dilution; Santa Cruz Biotechnology). Secondary antibody conjugated to horseradish peroxidase 1:10,000; Santa Cruz Biotechnology) was incubated with the membranes for 1 h at room temperature. Immunostained bands were detected by chemiluminescent method (Santa Cruz Biotechnology.).
Immunofluorescence Analysis
Slices of frozen adult testis were prepared using a microtome and placed on glass slides and fixed at room temperature for 15 min in 4% paraformaldehyde. Samples were permeabilized for 10 min in 0.1% Triton X-100 and blocked for 1 h in PBS with 5% BSA. After three washes in PBS, samples were incubated over night at 4°C with rabbit anti-HMGA2 (25) (1:100 dilution) or anti-Nek2 (R40; 1:100 dilution) as primary antibody. After five washes in PBS, cells were incubated for 1h at 37°C with rhodamine-conjugate goat anti-rabbit IgG (1:300 dilution; Calbiochem). To stain DNA, Hoechst dye (Sigma-Aldrich) was added for the last 10 min at a final concentration of 0.1 mg/ml. Samples were washed extensively in PBS and slides were mounted in 50% glycerol in PBS.
Immunoprecipitation Experiments
Control or treated spermatocytes (
2 x 106 cell/sample) were collected by centrifugation at 1000 x g for 10 min, and washed twice in ice-cold 1x PBS. Cells were homogenized in Nek2 lysis buffer, and cytosolic fractions were collected as described above. For immunoprecipitation, 1 µg of mouse anti-myc, or rabbit polyclonal anti-Nek2 R40, or anti-HMGA2 antibodies were preincubated for 60 min with a mixture of protein A/G-Sepharose beads (Sigma-Aldrich) in PBS containing 0.05% BSA under constant shaking at 4°C. At the end of the incubation, the beads were washed twice with PBS/0.05% BSA, twice with lysis buffer, and then incubated for 90 min at 4°C with the soluble spermatocyte or HEK293 cell-extracts (0.5 mg of protein) under constant shaking. Sepharose bead-bound immunocomplexes were rinsed three times with lysis buffer and eluted in SDS-sample buffer for Western blot analysis, or washed twice with the appropriate kinase buffer for immunokinase assays.
Immunokinase Assays
Immunocomplexes bound to Sepharose beads obtained from immunoprecipitation of cell extracts were rinsed twice with Nek2-kinase buffer (50 mM HEPES pH 7.5, 5 mM
-glycerophosphate, 5 mM MnCl2, 5 mM NaF, 0.1 mM sodium orthovanadate, 1 mM DTT, 10 µg/ml leupeptin, and 10 µg/ml aprotinin). Kinase reactions were carried out in 50 µl for 20 min at 30°C in kinase buffer supplemented with 10 µM [32P]
-ATP (0.2 µCi/µl), 4 µM ATP, 1 µg of cAMP-dependent protein kinase inhibitor, and the appropriate substrate (1 µg of full-length myelin basic protein (MBP), 2 µg of His-HMGA2). Reactions were stopped by adding SDS-sample buffer and analyzed by SDS-PAGE and autoradiography.
Pull-Down Assay
His-HMGA2 (3 µg) were added to 24 µg of GST fusion proteins adsorbed on glutathione-agarose (Sigma-Aldrich) in 300 µl (final volume) of PBS with 0.05% BSA, protease inhibitors, and 1 mM DTT for 1 h at 4°C under constant shaking. Beads were washed three times with the same PBS without BSA, eluted in 10 mM glutathione solution. Adsorbed proteins were analyzed by Western blot or Coomassie Brilliant Blue R250 staining.
Electrophoretic Mobility Shift Assay
Gel retardation assay reactions were performed according to Sheflin et al. (1993
). Briefly, 0.2 pmol of linearized pGEM T easy (Promega, Madison, WI) was mixed to increasing amounts of nonphosphorylated HMGA2[PNek2K37R] or phosphorylated HMGA2[PNek2] (from 11 to 120 pmol) in binding buffer (50 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM MgCl2, 0.5 mM DTT, 0.1 mM EDTA, and 0.3 µg/ml BSA, final volume of 20 µl). Mixtures were incubated for 15 min at 37°C, 30 min on ice, and an additional 5 min at 37°C. At the end of the incubation, loading dye was added and DNAprotein complexes were run on 0.7% (wt/vol) agarose gels in Tris-phosphate-EDTA. Electrophoresis was run for 1820 h at 7.5 V/cm at room temperature, the gel was stained with 0.5 µg/ml ethidium bromide for 1 h, destained in distilled water for 45 min, and photographed.
[32P]Orthophosphate Metabolic Labeling
Isolated spermatocytes were cultured as described above. Cells were preincubated for 12 h with or without the MAPK cascade inhibitor U0126 (Calbiochem) at a concentration of 10 µM. After 12 h, the medium was replaced with phosphate-free minimal essential medium and carrier-free [32P]orthophosphate (0.3 mCi/ml), and spermatocytes were incubated for an additional 2 h. Hence, cells were treated with or without 0.5 µM OA for 6 h. At the end of the incubation, cells were washed three times with PBS, homogenized in Nek2 lysis buffer supplemented with 0.5% Nonidet P-40, and incubated for 15 min on ice. After centrifugation, supernatants were precleared with Sepharose beads for 1 h to reduce the nonspecific binding and then immunoprecipitated for 2 h at 4°C with anti-HMGA2 with new Sepharose beads in the presence of 0.1% BSA. After three washes, the immunoprecipitates were eluted in sample buffer. Samples were separated on a 10% SDS-PAGE, the gel was dried and radioactivity analyzed by autoradiography.
Cross-Linking Experiment
Isolated spermatocytes cultured as described above were treated with either DMSO or 5 µM okadaic acid for 6 h. In the last 10 min of the incubation, cells were cross-linked by adding 1% formaldehyde to the culture medium. Control cells incubated only with DMSO were also collected to monitor the situation of DNA-bound proteins in the absence of cross-link. Cells were collected by centrifugation and resuspended in 1 ml of TRIzol solution (Invitrogen, Carlsbad, CA). RNA, DNA, and protein fraction extraction were carried out following the manufacturer's instruction. DNA fractions resuspended in TE (10 mM Tris and 1 mM EDTA) were treated with 30 µg/ml DNase for 30 min at 37°C and sonicated. DNA and protein fractions were then diluted in SDS-sample buffer for the subsequent Western blot analysis with either anti-Erk1 or anti-HMGA2 antibodies.
| RESULTS |
|---|
|
|
|---|
|
Nek2 and HMGA2 Physically Interact
Rhee and Wolgemuth reported that Nek2 associates to condensing chromatin during the prophase of the first meiotic division (Rhee and Wolgemuth, 1997
). To test whether Nek2 and the DNA-architectural protein HMGA2 physically interact in mouse spermatocytes, we performed coimmunoprecipitation experiments. Cell extracts from mouse spermatocytes or spermatids were immunoprecipitated using either nonimmune rabbit IgGs or anti-Nek2 IgGs, and the immunopurified proteins were analyzed in Western blot for the presence of HMGA2. As shown in Figure 2A, anti-Nek2 IgGs immunoprecipitated detectable amounts of HMGA2 from spermatocyte extracts where Nek2 is present, but not from spermatid extracts. Furthermore, nonspecific IgGs did not precipitate HMGA2, indicating that the interaction between Nek2 and HMGA2 is specific. When the same samples were stained for p90Rsk2, we found that also p90Rsk2 was coimmunoprecipitated by the Nek2 antibody only from spermatocytes extracts. Interestingly, we observed that Nek2, HMGA2, and p90Rsk2 specifically coimmunoprecipitated from spermatocyte cell extracts also when an anti-HMGA2 antibody was used (Figure 2B). These results suggest that Nek2, its activator p90Rsk2, and the chromatin protein HMGA2 are assembled in a complex in mouse pachytene spermatocytes.
|
The interaction between Nek2 and HMGA2 is not restricted to meiotic cells, because we observed that recombinant myc-Nek2 could coimmunoprecipitate with recombinant HA-HMGA2 when the two proteins were expressed in the same cells (Figure 2C). Next, we tested whether the interaction with HMGA2 depends on the state of activity of Nek2. A source of active and inactive Nek2 was obtained by transfecting Hek293 cells with myc-tagged wild-type or kinase-dead Nek2 and by treating cells for 1 h with okadaic acid to elicit activation of recombinant Nek2 in vivo. Nek2 was immunoprecipitated using the anti-myc antibody and the kinase activity was tested using MBP as substrate. As shown in Figure 3A, okadaic acid strongly stimulated the activity of wild-type Nek2, whereas the effect on kinase-dead Nek2K37N was much less evident. Western blot analysis shows that equal amounts of wild-type or kinase-dead Nek2 were immunoprecipitated by the anti-myc antibody. Next, immunoprecipitated Nek2 was incubated with purified recombinant His-HMGA2 (3 µg). Western blot analysis of the immunocomplexes formed showed that HMGA2 interacted with Nek2 (Figure 3A). Because neither stimulation nor disruption of the catalytic activity of Nek2 affected the binding, the interaction between Nek2 and HMGAs seems to be constitutive. A similar experiment using recombinant HMGA1 gave identical results (our unpublished data), suggesting that Nek2 is capable of interacting with both members of this family.
|
The Regulatory Domain of Nek2 Directly Binds HMGA2
To test whether the interaction between Nek2 and HMGA2 is direct, we used purified recombinant proteins expressed in E. coli. Nek2 is composed of an N-terminal catalytic domain and a C-terminal "regulatory" domain that interacts with the protein phosphatase PP1 (Helps et al., 2000
) and the protein kinase Hec1 (Chen et al., 2002
), and it is supposed to mediate regulatory events (Fry, 2002
). We performed pull-down assays using either GST or GST-Nek2273444, containing the regulatory domain of Nek2. GST proteins were preadsorbed to glutathione-agarose beads and then incubated with 3 µg of purified His-HMGA2 for 90 min. After several washes, the adsorbed proteins were eluted and analyzed in Western blot by using the anti-His antibody. As shown in Figure 3B, GST-Nek2273444 specifically bound to HMGA2, whereas GST did not; Coomassie staining of the gel demonstrated that the amount of GST proteins used for the pull down was comparable (our unpublished data). Analyses of the Nek2 sequence for structural motifs by using the NPS @nalysis program (http://npsa-pbil.ibcp.fr/cgibin/secpred_consensus.pl) indicated that the regulatory domain contains three regions with high probability of
-helix structure: aa 272286, aa 303360, and aa 403430. Thus, we constructed GST-fusion proteins of the regulatory domain to separate these presumptive
-helices: GST-Nek2272294 contains the first helix, GST-Nek2272369 contains the first two, and GST-Nek2294444 contains the second and third helix. Pull-down experiments with purified proteins indicate that HMGA2 preferentially binds to GST-Nek2272369, suggesting that the boundary region between helix 1 and helix 2 of the Nek2 regulatory domain is required for efficient interaction with HMGA2.
Nek2 Phosphorylates HMGA2
To further investigate the role of Nek2 in mouse spermatocyte G2/M progression, we tested whether the kinase was able to phosphorylate its binding partner HMGA2. Indeed, it has been demonstrated that the DNA-binding properties of HMG family members are regulated by posttranslation modifications such as phosphorylation, acetylation, or methylation (Bustin, 1999
; Fedele et al., 2001
). First, we immunoprecipitated wild-type or kinase-dead myc-Nek2 from control or okadaic acid-treated HEK293 cell extracts and used purified HMGA2 as substrate in immunokinase assays in vitro. As shown in Figure 4A, active Nek2 was able to efficiently phosphorylate HMGA2 whereas the Nek2K37R mutant was not, suggesting that phosphorylation of HMGA2 was indeed due to the immunoprecipitated Nek2. In this experiment, MBP was used as positive control of Nek2 activity.
|
Next, we tested whether endogenous Nek2 from spermatocytes was also able to phosphorylate HMGA2 in vitro. We isolated Nek2 by immunoprecipitation either from pachytene spermatocytes, in which the kinase is present with low activity, or from metaphase spermatocytes, in which Nek2 has been activated by the MAPK pathway (Di Agostino et al., 2002
). Immunoprecipitates were used for immunokinase assays by using either MBP, as a control of Nek2 activity, or HMGA2. We found that Nek2 activated during G2/M transition was able to phosphorylate HMGA2 (Figure 4B), whereas only trace amount of kinase activity was immunoprecipitated from pachytene spermatocytes. The kinase activity was due to Nek2 because mock immunoprecipitation of both pachytene and metaphase spermatocyte extracts by using preimmune IgGs did not result in any detectable phosphorylation of HMGA2 (Figure 4B, right).
HMGA2 Phosphorylation in Mouse Spermatocytes
To test whether HMGA2 is phosphorylated during the meiotic progression of mouse spermatocytes, we performed an in vivo metabolic labeling experiment. Pachytene spermatocytes were cultured in phosphate-free medium supplemented with 0.3 mCi/ml [32P]HPO4 for 2 h in the presence or absence of the MEK1/2 inhibitor U0126 (10 µM) to block the MAPK pathway. Hence, cells were treated with or without 0.5 µM OA to trigger the G2/M progression in the presence or absence of MAPK activation. Cell extracts were prepared from spermatocytes cultured in these different conditions and immunoprecipitation was performed using either nonimmune IgGs or anti-HMGA2 antibody. As shown in Figure 5, OA strongly stimulated the phosphorylation of a protein of the size of HMGA2, which was specifically immunoprecipitated by the anti-HMGA2 antibody. Moreover, phosphorylation of this protein was entirely dependent on the activation of the MAPK pathway. This result suggests that HMGA2 is phosphorylated in vivo during the G2/M progression of mouse spermatocytes by the same pathway required for activation of Nek2 and chromosome condensation.
|
Phosphorylation by Nek2 Affects the Interaction of HMGA2 with DNA
Previous reports have demonstrated that HMGA1/2 can be phosphorylated by the Cdc2 and casein kinase 2 kinases during mitosis and that these modifications influence the binding of HMGAs to DNA (Wisniewski et al., 1999
). Thus, we set out to determine whether phosphorylation by Nek2 affects binding of HMGA2 to DNA. To this end, HMGA2 was phosphorylated in vitro by Nek2 (HMGA2[PNek2]) and its DNA-binding ability toward linearized plasmid DNA was measured. As control, we used a nonphosphorylated HMGA2 that had been incubated in vitro with kinase-dead Nek2K37R (HMGA2[PNek2K37R]). Phosphorylated and nonphosphorylated HMGA2 protein were incubated with linearized pGEM-T easy (2.9 kb) at crescent protein:DNA molar ratio and the formation of DNAprotein complexes was monitored by electrophoretic mobility shift assay (Figure 6). As expected, nonphosphorylated HMGA2[PNek2K37R] was able to bind DNA and cause a shift toward high-molecular-weight complexes in a dose-dependent manner (Figure 6). However, we observed that phosphorylation by wild-type Nek2 modifies the binding ability of HMGA2 and causes the occurrence of a faster complex (arrows in the Figure 6), suggesting that phosphorylation decreases the amount of HMGA2 bound to DNA with the formation of a lighter complex in this in vitro binding assay (Wisniewski et al., 1999
).
|
To test whether the interaction of HMGA2 with DNA was modulated during the meiotic G2/M progression in vivo, we performed a cross-link experiment. Spermatocytes were cultured for 6 h in the absence or presence of okadaic acid to induce transition into metaphase (Wiltshire et al., 1995
; Figure 7B), and DNAprotein complexes were fixed by adding 1% formaldehyde in the last 10 min of culture. DNA fraction and protein fraction were isolated from the phenol and chloroform phases obtained with TRIzol lysis of cells and analyzed in Western blot for the presence of HMGA2. As a control, we used pachytene spermatocytes that were not cross-linked with formaldehyde. As shown in Figure 7A (top) in pachytene spermatocytes most of HMGA2 was recovered in the DNA-bound fraction, whereas only trace amount of HMGA2 were detected in the protein fraction. On the contrary, the pattern of distribution of HMGA2 was completely reversed when cells were in metaphase: HMGA2 was now found mainly in the protein fraction with only trace amounts bound to chromatin. Interestingly, when the same fractions were analyzed for Erk1, which was previously shown to be associated with meiotic chromosomes (Di Agostino et al., 2002
), we observed that the MAPK was equally distributed in the protein and DNA fractions and that the cell cycle phase did not affect this distribution dramatically. When cells were not cross-linked, neither HMGA2 nor Erk1 was found in the DNA fraction, indicating that the extraction procedure efficiently separates proteins from DNA. This experiment suggests that phosphorylation of HMGA2 correlates with its exclusion from the chromatin during the G2/M progression of mouse spermatocytes.
|
| DISCUSSION |
|---|
|
|
|---|
Nek2 expression and activity peak in the G2 phase of the mitotic cycle and decrease once the cells have entered mitosis due to degradation by the anaphase promoting complex APCCdc20 (Hames et al., 2001
). Interestingly, Nek2 is activated in meiosis at a cell cycle stage (G2/M) when it is normally degraded in mitotic cells (Di Agostino et al., 2002
); it is possible that during meiosis the APC activator Cdc20 is kept inhibited in the lengthy prophase to delay metaphase and allow completion of meiotic processes such as homologous recombination and homologous chromosome disjunction in diplotene.
The Nek2 homolog NIMA plays a role in chromatin condensation in Aspergillus nidulans and in transfected animal cells (Fry, 2002
). Several observations suggest that Nek2 could also play such role in meiosis: 1) Nek2 was proposed to associate with condensed chromatin in mouse spermatocytes (Rhee and Wolgemuth, 1997
); 2) Nek2 is activated during the G2/M transition of mouse spermatocytes (Rhee and Wolgemuth, 1997
; Di Agostino et al., 2002
); and 3) Nek2 activation requires the MAPK pathway (Di Agostino et al., 2002
), a kinase cascade that promotes chromatin condensation in these cells (Sette et al., 1999
). In the present study, we have investigated whether Nek2 directly interacts with DNA or chromatin proteins. We have demonstrated that Nek2 directly associates with the chromatin architectural protein HMGA2 through its C-terminal regulatory domain. Interestingly, it was shown that both Hec1, a protein kinase phosphorylated by Nek2 and required for faithful chromosome segregation (Chen et al., 2002
), and PP1, a protein phosphatase that acts in the centrosome duplication pathway like Nek2 (Helps et al., 2000
; Eto et al., 2002
), bind to this domain of the kinase. Thus, HMGA2 is the third substrate known to interact with the C-terminal regulatory domain of Nek2. However, we found that HMGA2-binding site (aa 272369) differs from that reported for PP1, (KVHF motif, aa 382385 in mouse Nek2). Because the regulatory domain of NIMA kinases act as dominant negative in vivo (Lu and Means, 1994
), it is likely that these interactions are crucial for the function of Nek2.
Among the known structural chromatin proteins, we have focused our attention on HMGA2 for the following reasons: 1) HMGAs (high-mobility group A proteins) are nonhistone chromosomal proteins that play a role in determining chromatin architecture and in regulating the transcription of several genes (Bustin, 1999
; Fedele et al., 2001
); 2) HMGA2 is highly expressed in the testis in meiotic and postmeiotic cells (Chieffi et al., 2002
; this study); 3) hmga2-/- mice are infertile and present degenerating spermatocytes and a drastically reduced number of postmeiotic round spermatids (Chieffi et al., 2002
). The HMGA class includes the two isoforms 1 and 2, encoded by the hmga1 and hmga2 genes (Bustin, 1999
). HMGAs bind DNA in AT-rich regions through three basic domains called "AT-hooks," and they can regulate transcriptional activity by altering the architecture of chromatin and promoting the accessibility to transcriptional factors (Falvo et al., 1995
; Foti et al., 2003
). Although very similar in function and structure, it was observed that deletion of only one of these genes in mice, hmga2, caused a dramatic phenotype called "pygmy," characterized by a great reduction in fat tissue and slow growth due to a longer cell cycle of embryonic fibroblasts (Zhou et al., 1995
). Thus, HMGA1 is not able to fully complement HMGA2 function, suggesting that two proteins have specific roles during development. A specific function for HMGA2 should also be involved in the regulation of spermatogenesis, because this differentiation program is dramatically hampered in hmga2-/- mice in spite of the presence of HMGA1 (Chieffi et al., 2002
). Although we found that Nek2 is able to interact with and phosphorylate both proteins in vitro (Di Agostino and Sette, unpublished observation), it is possible that in vivo, HMGA2 is the more relevant substrate for the kinase or that additional unique roles for HMGAs are exerted during spermatogenesis. Here, we also show that the Nek2HMGA2 interaction is constitutive and independent of the activation state of Nek2. Hence, we suggest that Nek2 might be anchored to chromatin through the association with HMGA2 before it is activated; after stimulation of the MAPK pathway, Nek2 activity increases and HMGA2 is phosphorylated (Figure 8). In agreement with this model is the observation that HMGA2 is phosphorylated in a MAPK-dependent manner in mouse spermatocyte undergoing the G2/M transition. Because the MAPK pathway plays a role in maintaining the chromatin condensed into chromosomes during vertebrate meiosis (Sette et al., 1999
; Gross et al., 2000
), it is possible that MAPK-dependent phosphorylation of chromatin molecules, such as HMGA2, is crucial to ensure this process.
|
We have observed that purified HMGA2 is a good substrate for recombinant and endogenous Nek2 in vitro. Moreover, we found that phosphorylation by Nek2 decreases the affinity of HMGA2 for DNA in gel-retardation assays. Similar results have been reported for mitotic phosphorylation of HMGAs by kinases that are activated at the G2/M transition, such as casein kinase 2 and cdc2 (Piekielko et al., 2001
). HMG box family proteins are also phosphorylated by mitotic kinases in several organisms (Bustin, 1999
). In most cases, it has been shown that phosphorylation decreases the affinity of HMG proteins for DNA in the same electrophoretic assay that we have used in this study. Our data extend this evidence to Nek2-phosphorylation of HMGA2 in mouse spermatocytes and suggest that a reduction of the affinity of HMG proteins for DNA might be a common feature of the entry into metaphase in both mitotic and meiotic cells. In agreement with this hypothesis, we show that upon G2/M transition HMGA2, which is phosphorylated in a MAPK pathway-dependent manner, is excluded from the chromatin.
In conclusion, we have identified a structural chromatin protein as a possible substrate for Nek2 in vivo, which could participate directly or indirectly to chromosome condensation during the G2/M transition of mouse spermatocytes. Because many transcription factors and DNA-repair enzymes are bound to DNA via their interaction with HMGAs (Bustin, 1999
; Subramanian and Griffith, 2002
), it is possible that Nek2 phosphorylation promotes the release of HMGA2 from the DNA and the turnover of chromatin proteins to allow the entry of other factors involved in condensation of meiotic chromosomes.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Corresponding author. E-mail address: claudio.sette{at}uniroma2.it.
| REFERENCES |
|---|
|
|
|---|
Baldassarre, G., Fedele, M., Battista, S., Vecchione, A., Klein-Szanto, A.J.P., Waldmann, T.A., Azimi, N., Croce, C.M., and Fusco, A. (2001). Onset of Natural Killer Cell Lymphomas in transgenic mice carrying a truncated HMGI-C gene by the chronic stimulation of the IL-2 and IL-15 pathway. Proc. Natl. Acad. Sci. USA 98, 7970-7975.
Bustin, M. (1999). Regulation of DNA-dependent activities by the functional motifs of the high-mobility-group chromosomal proteins. Mol. Cell. Biol. 19, 5237-5246.
Cobb, J., Cargile, B., and Handel, M.A. (1999). Acquisition of competence to condense metaphase I chromosomes during spermatogenesis. Dev. Biol. 205, 49-64.[CrossRef][Medline]
Chieffi, P., Battista, S., Barchi, M., Di Agostino, S., Pierantoni, G.M., Fedele, M., Chiariotti, L., Tramontano, D., and Fusco, A. (2002). HMGA1 and HMGA2 protein expression in mouse spermatogenesis. Oncogene 21, 3644-3650.[CrossRef][Medline]
Chen, Y., Riley, D.J., Zheng, L., Chen, P.L., and Lee, W.H. (2002). Phosphorylation of the mitotic regulator protein Hec1 by Nek2 kinase is essential for faithful chromosome segregation. J. Biol. Chem. 277, 49408-49416.
Choi, T., Fukasawa, K., Zhou, R., Tessarollo, L., Borror, K., Resau, J., and Vande Woude, G.F. (1996). The Mos/mitogen-activated protein kinase (MAPK) pathway regulates the size and degradation of the first polar body in maturing mouse oocytes. Proc. Natl. Acad. Sci. USA 93, 7032-7035.
Colledge, W.H., Carlton, M.B., Udy, G.B., and Evans, M.J. (1994). Disruption of c-mos causes parthenogenetic development of unfertilized mouse eggs. Nature 370, 65-68.[CrossRef][Medline]
Di Agostino, S., Rossi, P., Geremia, R., and Sette, C. (2002). The MAPK pathway triggers activation of Nek2 during chromosome condensation in mouse spermatocytes. Development 129, 1715-1727.
Eto, M., Elliott, E., Prickett, T.D., and Brautigan, D.L. (2002). Inhibitor-2 regulates protein phosphatase-1 complexed with NimA-related kinase to induce centrosome separation. J. Biol. Chem. 277, 44013-44020.
Falvo, J.V., Thanos, D., and Maniatis, T. (1995). Reversal of intrinsic DNA bends in the IFN beta gene enhancer by transcription factors and the architectural protein HMG I(Y). Cell 83, 1101-1111.[CrossRef][Medline]
Fedele, M., Battista, S., Manfioletti, G., Croce, C.M., Giancotti, V., and Fusco, A. (2001). Role of the high mobility group A proteins in human lipomas. Carcinogenesis 22, 1583-1591.
Foti, D., Iuliano, R., Chiefari, E., and Brunetti, A. (2003). A nucleoprotein complex containing Sp1, C/EBP beta, and HMGI-Y controls human insulin receptor gene transcription. Mol. Cell. Biol. 23, 2720-2732.
Fry, A.M., Schultz, S.J., Bartek, J., and Nigg, E.A. (1995). Substrate specificity and cell cycle regulation of the Nek2 protein kinase, a potential human homolog of the mitotic regulator NIMA of Aspergillus nidulans. J. Biol. Chem. 270, 12899-12905.
Fry, A.M., Meraldi, P., and Nigg, E.A. (1998a). A centrosomal function for the human Nek2 protein kinase, a member of the NIMA family of cell cycle regulators. EMBO J. 17, 470-481.[CrossRef][Medline]
Fry, A.M., Mayor, T., Meraldi, P., Stierhof, Y.D., Tanaka, K., and Nigg, E.A. (1998b). C-Nap1, a novel centrosomal coiled-coil protein and candidate substrate of the cell cycle-regulated protein kinase Nek2. J. Cell Biol. 141, 1563-1574.
Fry, A.M. (2002). The Nek2 protein kinase: a novel regulator of centrosome structure. Oncogene 21, 6184-6194.[CrossRef][Medline]
Gross, S.D., Schwab, M.S., Taieb, F.E., Lewellyn, A.L., Qian, Y.W., and Maller, J.L. (2000). The critical role of the MAP kinase pathway in meiosis II in Xenopus oocytes is mediated by p90Rsk. Curr. Biol. 10, 430-438.[CrossRef][Medline]
Hames, R.S., Wattam, S.L., Yamano, H., Bacchieri, R., and Fry, A.M. (2001). APC/C-mediated destruction of the centrosomal kinase Nek2A occurs in early mitosis and depends upon a cyclin A-type D-box. EMBO J. 20, 7117-7127.[CrossRef][Medline]
Handel, M.A., and Eppig, J.J. (1998). Sexual dimorphism in the regulation of mammalian meiosis. Curr. Top. Dev. Biol. 37, 333-358.[Medline]
Hashimoto, N., et al. (1994). Parthenogenetic activation of oocytes in c-mos-deficient mice. Nature 370, 68-71.[CrossRef][Medline]
Helps, N.R., Luo, X., Barker, H.M., and Cohen, P.T. (2000). NIMA-related kinase 2 (Nek2), a cell-cycle-regulated protein kinase localized to centrosomes, is complexed to protein phosphatase 1. Biochem. J. 349, 509-518.[CrossRef][Medline]
Lu, K.P., and Means, A.R. (1994). Expression of the noncatalytic domain of the NIMA kinase causes a G2 arrest in Aspergillus nidulans. EMBO J. 13, 2103-2113.[Medline]
Mayor, T., Hacker, U., Stierhof, Y.D., and Nigg, E.A. (2002). The mechanism regulating the dissociation of the centrosomal protein C-Nap1 from mitotic spindle poles. J. Cell Sci. 115, 3275-3284.
Osmani, A.H., McGuire, S.L., and Osmani, S.A. (1991). Parallel activation of the NIMA and p34cdc2 cell cycle-regulated protein kinases is required to initiate mitosis in A. nidulans. Cell 67, 283-291.[CrossRef][Medline]
Petronczki, M., Siomos, M.F., and Nasmyth, K. (2003). Un menage a quatre: the molecular biology of chromosome segregation in meiosis. Cell 112, 423-440.[CrossRef][Medline]
Piekielko, A., Drung, A., Rogalla, P., Schwanbeck, R., Heyduk, T., Gerharz, M., Bullerdiek, J., and Wisniewski, J.R. (2001). Distinct organization of DNA complexes of various HMGI/Y family proteins and their modulation upon mitotic phosphorylation. J. Biol. Chem. 276, 1984-1992.
Rhee, K., and Wolgemuth, D.J. (1997). The NIMA-related kinase 2, Nek2, is expressed in specific stages of the meiotic cell cycle and associates with meiotic chromosomes. Development 124, 2167-2177.[Abstract]
Roeder, G.S. (1997). Meiotic chromosomes: it takes two to tango. Genes Dev. 11, 2600-2621.
Ronfani, L., Ferraguti, M., Croci, L., Ovitt, C.E., Scholer, H.R., Consalez, G.G., and Bianchi, M. (2001). Reduced fertility and spermatogenesis defects in mice lacking chromosomal protein Hmgb2. Development 128, 1265-1273.[Abstract]
Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P., Ricca, R., and Geremia, R. (1993). Follicle-stimulating hormone induction of steel factor (SLF) mRNA in mouse Sertoli cells and stimulation of DNA synthesis in spermatogonia by soluble SLF. Dev. Biol. 155, 68-74.[CrossRef][Medline]
Sagata, N. (1997). What does Mos do in oocytes and somatic cells? Bioessays 19, 13-21.[CrossRef][Medline]
Sette, C., Barchi, M., Bianchini, A., Conti, M., Rossi, P., and Geremia, R. (1999). Activation of the mitogen-activated protein kinase Erk1 during meiotic progression of mouse pachytene spermatocytes. J. Biol. Chem. 274, 33571-33579.
Sheflin, L.G., Fucile, N.W., and Spaulding, S.W. (1993). The specific interactions of HMG 1 and 2 with negatively supercoiled DNA are modulated by their acidic C-terminal domains and involve cysteine residues in their HMG 1/2 boxes. Biochemistry 32, 3238-3248.[CrossRef][Medline]
Subramanian, D., and Griffith, J.D. (2002). Interactions between p53, hMSH2-hMSH6 and HMG I(Y) on Holliday junctions and bulged bases. Nucleic Acids Res. 30, 2427-2434.
Tanaka, K., Parvinen, M., and Nigg, E.A. (1997). The in vivo expression pattern of mouse Nek2, a NIMA-related kinase, indicates a role in both mitosis and meiosis. Exp. Cell Res. 237, 264-274.[CrossRef][Medline]
Tunquist, B.J., and Maller, J.L. (2003). Under arrest: cytostatic factor (CSF)-mediated metaphase arrest in vertebrate eggs. Genes Dev. 17, 683-710.
Verlhac, M.H., Kubiak, J.Z., Weber, M., Geraud, G., Colledge, W.H., Evans, M.J., and Maro, B. (1996). Mos is required for MAP kinase activation and is involved in microtubule organization during meiotic maturation in the mouse. Development 122, 815-822.[Abstract]
Verlhac, M.H., Lefebvre, C., Guillaud, P., Rassinier, P., and Maro, B. (2000). Asymmetric division in mouse oocytes: with or without Mos. Curr. Biol. 10, 1303-1306.[CrossRef][Medline]
Wiltshire, T., Park, C., Caldwell, K.A., and Handel, M.A. (1995). Induced premature G2/M-phase transition in pachytene spermatocytes includes events unique to meiosis. Dev. Biol. 169, 557-567.[CrossRef][Medline]
Wisniewski, J.R., Szewczuk, Z., Petry, I., Schwanbeck, R., and Renner, U. (1999). Constitutive phosphorylation of the acidic tails of the high mobility group 1 proteins by casein kinase II alters their conformation, stability, and DNA binding specificity. J. Biol. Chem. 274, 20116-20122.
Zhou, X., Benson, K.F., Ashar, H.R., and Chada, K. (1995). Mutation responsible for the mouse pygmy phenotype in the developmentally regulated factor HMGI-C. Nature 376, 771-774.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
X. Cao, C. Clavijo, X. Li, H. H. Lin, Y. Chen, H.-M. Shih, and D. K. Ann SUMOylation of HMGA2: selective destabilization of promyelocytic leukemia protein via proteasome Mol. Cancer Ther., April 1, 2008; 7(4): 923 - 934. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wu, J. E. Baxter, S. L. Wattam, D. G. Hayward, M. Fardilha, A. Knebel, E. M. Ford, E. F. da Cruz e Silva, and A. M. Fry Alternative Splicing Controls Nuclear Translocation of the Cell Cycle-regulated Nek2 Kinase J. Biol. Chem., September 7, 2007; 282(36): 26431 - 26440. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rellos, F. J. Ivins, J. E. Baxter, A. Pike, T. J. Nott, D.-M. Parkinson, S. Das, S. Howell, O. Fedorov, Q. Y. Shen, et al. Structure and Regulation of the Human Nek2 Centrosomal Kinase J. Biol. Chem., March 2, 2007; 282(9): 6833 - 6842. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R.M.O. Crombez, E. M.R. Vanoirbeek, W. J.M. Van de Ven, and M. M.R. Petit Transactivation Functions of the Tumor-Specific HMGA2/LPP Fusion Protein Are Augmented by Wild-Type HMGA2 Mol. Cancer Res., February 1, 2005; 3(2): 63 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Inselman and M. A. Handel Mitogen-Activated Protein Kinase Dynamics During the Meiotic G2/MI Transition of Mouse Spermatocytes Biol Reprod, August 1, 2004; 71(2): 570 - 578. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Venables, C. Dalgliesh, M. P. Paronetto, L. Skitt, J. K. Thornton, P. T. Saunders, C. Sette, K. T. Jones, and D. J. Elliott SIAH1 targets the alternative splicing factor T-STAR for degradation by the proteasome Hum. Mol. Genet., July 15, 2004; 13(14): 1525 - 1534. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Di Agostino, F. Botti, A. Di Carlo, C. Sette, and R. Geremia Meiotic progression of isolated mouse spermatocytes under simulated microgravity Reproduction, July 1, 2004; 128(1): 25 - 32. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||