![]() |
|
|
Vol. 15, Issue 3, 1262-1272, March 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
and 








* Department of Obstetrics, Gynecology, and Reproductive Sciences, University of California San Francisco, San Francisco, California 94143-0556;
Department of Cellular and Molecular Pharmacology, Center for Reproductive Sciences, University of California San Francisco, San Francisco, California 94143-0556; and
GeneTex, Inc., San Antonio, Texas 78245
Submitted June 4, 2003;
Revised November 7, 2003;
Accepted November 19, 2003
Monitoring Editor: Marvin P. Wickens
| ABSTRACT |
|---|
|
|
|---|
and
to activate or repress gene transcription. To understand how estrogens and SERMs exert tissue-specific effects, we performed microarray analysis to determine whether ER
or ER
regulate different target genes in response to estrogens and SERMs. We prepared human U2OS osteosarcoma cells that are stably transfected with a tetracycline-inducible vector to express ER
or ER
. Western blotting, immunohistochemistry, and immunoprecipitation studies confirmed that U2OS-ER
cells synthesized only ER
and that U2OS-ER
cells expressed exclusively ER
. U2OS-ER
and U2OS-ER
cells were treated either with 17
-estradiol (E2), raloxifene, and tamoxifen for 18 h. Labeled cRNAs were hybridized with U95Av2 GeneChips (Affymetrix). A total of 228, 190, and 236 genes were significantly activated or repressed at least 1.74-fold in U2OS-ER
and U2OS-ER
cells by E2, raloxifene, and tamoxifen, respectively. Most genes regulated in ER
cells in response to E2, raloxifene, and tamoxifen were distinct from those regulated in ER
cells. Only 38 of the 228 (17%) genes were regulated by E2 in both U2OS-ER
and U2OS-ER
cells. Raloxifene and tamoxifen regulated only 27% of the same genes in both the ER
and ER
cells. A subset of genes involved in bone-related activities regulated by E2, raloxifene, and tamoxifen were also distinct. Our results demonstrate that most genes regulated by ER
are distinct from those regulated by ER
in response to E2 and SERMs. These results indicate that estrogens and SERMs exert tissue-specific effects by regulating unique sets of targets genes through ER
and ER
| INTRODUCTION |
|---|
|
|
|---|
The adverse effects of estrogens has inspired an intense pursuit to develop selective estrogen receptor modulators (SERMs) for HRT (McDonnell, 2000
), which can be taken for many years without eliciting serious side effects. Estrogens and SERMs produce their effects by binding to two estrogen receptors, ER
and ER
(Green et al., 1986
; Kuiper and Gustafsson, 1997
). These drugs are classified based on their effects on target tissues. An estrogen acts as an agonist in all tissues, even though it can produce opposite effects. For example, estrogens promote breast cancer but prevent colon cancer (Writing Group for Women's Health Initiative, 2002
). SERMs, such as tamoxifen and raloxifene, exhibit both estrogenic and antiestrogenic properties, depending on the tissue type. The antiestrogenic action of tamoxifen on breast cells has been exploited for decades to prevent recurrences of ER-positive breast tumors (Fisher et al., 1996
). Tamoxifen is also effective at preventing breast cancer in high-risk women (Fisher et al., 1998
), and it elicits beneficial estrogenic activity in the bone to prevent osteoporosis (Love et al., 1992
). In contrast, the estrogenic activity of tamoxifen in the uterus can lead to endometrial cancer (Bernstein et al., 1999
). Like tamoxifen, raloxifene prevents osteoporosis by acting as an agonist in bone (Delmas et al., 1997
; Ettinger et al., 1999
) and prevents breast cancer by acting as an antagonist (Cummings et al., 1999
). However, raloxifene is not associated with an increased risk of endometrial cancer (Baker et al., 1998
). Unlike estrogens, these SERMs do not relieve hot flushes (Cohen and Lu, 2000
).
These clinical observations clearly illustrate that SERMs exert common and distinct tissue-specific effects compared with estrogens and that even different SERMs exhibit tissue selectivity. Elucidating the mechanism whereby estrogens and SERMs produce tissue-specific effects is important for designing better drugs to treat conditions associated with estrogen deficiency, such as menopausal symptoms and osteoporosis or excessive estrogen action, such as breast cancer. New paradigms have recently emerged regarding the molecular mechanism of action of estrogens and SERMs based on the discovery of coregulatory proteins (McKenna et al., 1999
; McDonnell and Norris, 2002
) that interact with ERs and structural studies of the ER ligand binding domain (LBD) (Brzozowski et al., 1997
; Shiau et al., 1998
; Pike et al., 1999
). Estrogen initiates transcriptional activation by inducing a conformational change of the ER LBD (Brzozowski et al., 1997
; Shiau et al., 1998
). The repositioning of helix 12 by estrogens creates an activation function (AF)-2 surface that permits the binding of coactivators (Feng et al., 1998
), which facilitate the recruitment of factors that activate transcription or cause the remodeling of chromatin structure. In contrast, when SERMs bind to ER
the LXXML sequence in helix 12 interacts with the AF-2 surface and occludes the coactivator LXXLL recognition site (Shiau et al., 1998
). Thus, unlike estrogens, SERMs do not form a functional AF-2 surface (Brzozowski et al., 1997
; Shiau et al., 1998
), which prevents the binding of coactivators required for gene activation. The important role of coregulatory proteins in producing tissue-specific effects was demonstrated by the findings that tamoxifen recruits the corepressor N-CoR in breast cells (Shang et al., 2000
), where it acts as an antagonist, but recruits the coactivator SRC-1 in endometrial cells, where it acts as an agonist (Shang and Brown, 2002
). These observations demonstrate that a major mechanism whereby estrogens and SERMs produce tissue-specific effects is by recruiting different coregulatory proteins to ERs.
Evidence derived from transient transfection experiments indicates that estrogens and SERMs also produce tissue-specific effects by differentially regulating response elements in target genes with ER
and ER
. In response to estradiol (E2), ER
is more effective than ER
at activating a classical estrogen response element (ERE) (An et al., 1999
). In contrast, ER
is more effective at activating an AP-1 element with SERMs compared with ER
(Paech et al., 1997
). In fact, E2 is an antagonist of SERM-mediated activation of AP-1 elements (Paech et al., 1997
). Compared with simple response elements used in reporter plasmids, it is not known whether E2 and SERMs also exert distinct regulatory effects on native target genes of ER
and ER
. Identifying target genes regulated by estrogens and SERMs is a critical first step required for subsequent characterization of the types of response elements present in ER
and ER
target genes and elucidation of the mechanisms whereby ER
and ER
regulate distinct genes in response to different ligands. In this study, we used microarray technology to compare the effects of E2 and SERMs on global patterns of gene expression in a bone cell line stably transfected with ER
or ER
. Our study indicates that estrogens and SERMs can produce tissue-specific effects by regulating different targets genes with ER
and ER
.
| MATERIALS AND METHODS |
|---|
|
|
|---|
and ER
cDNAs were obtained from P. Chambon, and J.-A. Gustafsson, respectively. Monoclonal ER
(ID5) antibody was obtained from DAKO (Carpinteria, CA), and monoclonal ER
antibodies (6A12, 14C8, and 7B10.7) were from GeneTex (San Antonio, TX). The Elite ABC kit was purchased from Vector Laboratories (Burlingame, CA). Enhanced chemiluminescence kits were obtained from Amersham Biosciences (Piscataway, NJ). RNeasy columns were manufactured by QIAGEN (Valencia, CA). The pGEM T-easy kit was obtained from Promega (Madison, WI). Human U95Av2 GeneChips, Test3 Arrays, BioArray High-Yield RNA Transcript Labeling kit, and the Microarray Suite version 5.0 software were obtained from Affymetrix (Santa Clara, CA). Oligonucleotides were synthesized by IDT Technologies (Coralville, IA). All other reagents were purchased from Sigma-Aldrich (St. Louis, MO) or as described previously (An et al., 1999
Cell Culture and Preparation of U2OS-ER
and ER
Stable Cell Lines
The MCF-7 breast cancer cell line was cultured in phenol-free DMEM/F-12 media containing 5% fetal bovine serum, 2 mM glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin. The U2OS cells were maintained in phenol-free DMEM/F-12 containing 5% stripped fetal bovine serum, 2 mM glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, 50 µg/ml hygromycin B, and 500 µg/ml zeocin. The U2OS cells stably expressing the tet repressor were transfected with pcDNA 6/V5-His vector containing ER
or ER
cDNA.
Immunohistochemistry for ER
and ER
The U2OS-ER
and ER
cell lines were plated on chamber slides and treated with 1 µg/ml doxycycline for 18 h to induce ER expression. The slides were fixed in neutral-buffered formalin and incubated in a microwave oven at full power for 20 min in 10 mM citrate buffer, pH 6, for antigen retrieval. After cooling, the slides were treated for 20 min with hydrogen peroxide/methanol to quench endogenous peroxidase activity. The slides were washed in phosphate-buffered saline (PBS) for 5 min, followed by a 30-min incubation at room temperature with 3% horse serum/PBS/0.3% Triton X-100. The slides were incubated overnight at 4°C with either anti-ER
(1:200), two mouse monoclonal ER
s (14C8 and 7B10.7, 1:600 each), or without antibody to serve as a negative control. After washing in buffer, cells were stained with the avidin-biotin-peroxidase method (Elite ABC kit; Vector Laboratories), with diaminobenzidine as the Chromagen, followed by counterstaining with hematoxylin to visualize the nuclei.
Western Blot Analysis
Ten micrograms of total proteins from the U2OS-ER
and ER
cells were used for Western blot. The membranes were probed with anti-ER
(DAKO antibody, diluted 1:1500 in blocking buffer) or three monoclonal ER
antibodies (GeneTex) in 1:3000 in blocking buffer overnight at 4°C. Proteins were visualized using the enhanced chemiluminescence detection system.
Estrogen Receptor Binding Assay
U2OS-ER
stable cells grown in six-well dishes were treated for 18 h with 1 µg/ml doxycycline. After the treatment, cells were incubated [37°C, 2 h] with 0.1-20 nM [3H]E2 [specific activity 87.6 Ci/mmol; PerkinElmer Life Science, Boston, MA] in the absence and presence of 100-fold excess of the unlabeled E2). After washing with 0.1% bovine serum albumin in PBS, SDS lysis buffer (0.5% SDS, 0.05 M Tris-HCl, pH 8.0, 1 mM dithiothreitol) was added and cells were shaken overnight. Specific binding of [3H]E2 was calculated as the difference between total and nonspecific binding.
Microarrays and Data Analysis
The expression of ERs in the U2OS-ER
and ER
cells were induced with doxycycline in the absence or presence of 10 nM E2, 1 µM raloxifene, or 1 µM tamoxifen for 18 h. The U2OS-ER
or ER
cells were washed with PBS and then 1 ml of TRIzol was added to the cells. Total RNA was prepared according to the manufacturer's protocol. DNase-I treated RNAs were purified further using the RNeasy columns. Total RNA was used to synthesize double-stranded cDNA by using Superscript Choice System incorporating a T7 RNA polymerase promoter. Biotin-labeled antisense cRNA was prepared using the BioArray High-Yield RNA Transcript Labeling kit transcription kit using 6 µg of total RNAs and the oligo-dT primer 5' GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(dT)24. cRNAs were purified with the RNeasy columns and then 20 µg of cRNAs was fragmented at 94°C for 30 min in 40 µl of 40 mM Tris-acetate, pH 8.1, 100 mM KOAc, 30 mM MgOAc. The fragmented samples (n = 4 from untreated, n = 4E2,n = 3 raloxifene, and n = 3 tamoxifen) were hybridized with the Affymetrix Test3 Arrays and the human U95Av2 GeneChips and scanned at the Molecular Biology and Genomics Laboratory at San Francisco General Hospital. The data of untreated versus treated samples were analyzed using the Microarray Suite Version 5.0 with the default parameters. The comparative data generated for each treated group were analyzed further in Microsoft Excel. Genes displaying no signal change relative to controls in at least three experiments were considered insignificant and excluded from further analysis. Genes displaying either increase or decrease signal were selected for further analysis only if they had a ±0.8 or ±1.2 signal log ratio mean value (±1.74- and ± 2.3-fold change, respectively) and were statistically significant (p < 0.05) in at least three separate experiments.
Semiquantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and Real-Time RT-PCR
The U2OS cells were treated for 18 h with E2, raloxifene, or tamoxifen. Reverse transcription was performed in a 10-µl reaction with 1 µg of total RNA, 50 mM Tris-HCl, pH 8, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 500 µM each dNTPs, 50 ng of random hexamers, and SuperScript II at 42°C 1 h. The cDNA was diluted 10-fold and then 1 µl of the dilution was used in a 12.5-µl PCR reaction containing 66 mM Tris-HCl, pH 9, 16 mM (NH4)2SO4, 140 µg/ml bovine serum albumin, 0.4 µM each primer, 200 µM each dNTP, 2 mM MgCl2, 4% glycerol, 4% dimethyl sulfoxide, and 1 U of Platinum TaqDNA polymerase. PCR was done for 94°C at 30 s, followed by cycles at 94°C for 10 s, 55-72°C 20 s, and then 72°C 30 s. Twenty-four to 36 PCR cycles were used, depending on the genes amplified. The following primers were used for PCR:
-anti-trypsin (
-AT), 5' TGCCACCGCCATCTTCTTCC and 5' ACATGGCCCCAGCAGCTTCAGTCC; WISP-2, 5' AGCCCTGCGACCAACTCCAC and 5' GGCCGCACACCCACTCAGG; Mda-7, 5' TATTGTGCCCCATGCTTCTTTACC and 5' CCCCACCCCAATGCTCTGTC; NKG2C, 5' TCCCCGAATACAAGAACGCAGAA and 5' TTGGGAGAAAGAGGGTAGAATGAT; cDNA clone image 996282, 5' GCTCTCCTGGGCAGCGTTGTG and 5' CTCCGAGTTTATTGGGTGTTTGTT; transforming growth factor
3 (TGF
3), 5' GGTGGTCCTGGCCCTGCTGAA and 5' GCTCCCGGGTGCTGTTGTAAAG; G0S2, 5' GCTCGCGCTGCCTCCTGCTC and 5' TTGCGCTTCTGGGCCATCATCTC; thrombin receptor, 5' GATCCCCGGTCATTTCTTCTC and 5' ACCACCGCCGGCTTCTTGACCTTCA; and NKG2E, 5' TCCCCGAATACAAGAACGCAGAA and 5' TTAATTGGGAGAAAGAGGGTAGAA. Glyceraldehyde-3-phosphate dehydrogenase primers 5' ACCACAGTCCATGCCATCAC and 5' TCCACCACCCTGTTGCTGTA were used for internal control. PCR products were loaded onto 2% agarose Tris borate-EDTA gels, and visualized by ethidium bromide staining.
Real-time RT-PCR was performed with the iQ SYBR green supermix on the Bio-Rad iCycler Thermal Cycler system. The typical temperature profile was an initial denaturation at 94°C, 3 min, followed by 40 cycles at 94°C for 10 s, 60-64°C for 20 s, and then 72°C for 30 s. The data were collected and analyzed using the comparative threshold cycle method.
Northern Blotting
Twenty micrograms of total RNAs from untreated and 10 nM E2-treated doxycycline-induced U2OS-ER
and ER
cells were used for Northern blot. Keratin 19 (K19) cDNA (nt 170-311, accession no. Y00503
[GenBank]
) was amplified by RT-PCR with primers 5' CGTGTCCTCCGCCCGCTTTGTGTC and 5' GGAGGCCAGGCGGTCGTTGAGGTT, ligated into the pGEM vector, and verified by DNA sequencing on both strands. The cDNA insert was labeled with [32P]dCTP by random priming, and 2 x 106 cpm/ml probe was hybridized with the blot overnight at 64°C in 0.5 M Na2HPO4, 7% SDS, 1 mM EDTA, and 100 µg/ml salmon sperm DNA. The blot was washed twice in 0.1x SSC/0.1% SDS at 64°C for 20 min and subjected to autoradiography.
Chromatin immunoprecipitation (ChIP)
After an overnight treatment with 10 nM E2, the U2OS-ER
and ER
cells were fixed in 1% formaldehyde solution and washed with PBS, collected, and lysed on ice in the presence of protease inhibitors. The nuclear pellet was sonicated, and chromatin was collected by centrifugation. Extracts were pre-cleared with protein G-Sepharose. Before adding anti-ER
or anti-ER
, an aliquot of each sample was removed to use as an input for PCR. Immunoprecipitation was performed on a rocking platform at 4°C overnight, and immunocomplexes were captured by protein G-Sepharose beads and washed several times. Isolated chromatin was phenol-extracted and precipitated with ethanol. PCR was done with K19 primers 5' TCCAGCCTGGGTGACAGAGC and 5' TCCAAGTTCACCCCAACCTGA, which span the consensus ERE and half ERE in the K19 enhancer region (Choi et al., 2000
).
| RESULTS |
|---|
|
|
|---|
and U2OS-ER
Cell Lines Synthesize Exclusively ER
and ER
, Respectively
or ER
. In the absence of doxycycline, the Tet repressor is bound to the Tet response elements in the cytomegalovirus promoter, preventing the transcription of the ER cDNA. Doxycycline binds to the Tet repressor, causing it to be released from the promoter, thereby allowing the cytomegalovirus promoter to drive the expression of ER
and ER
.
The inducible expression of ER in the U2OS cell lines was characterized by performing Western blots, immunoprecipitation, immunohistochemistry, and receptor binding assays. The addition of doxycycline produced a time-dependent accumulation of ER
or ER
protein (Figure 1A). There seemed to be very little, if any, "leaky" expression of ER
and ER
in the absence of doxycycline. Furthermore, no ER
(U2OS-ER
, lane 7) was detected in ER
cells, nor was ER
detected in ER
cells (U2OS-ER
, lane 14). Immunohistochemistry (Figure 1B) and immunoprecipitation (Figure 1C) studies confirmed that U2OSER
cells synthesized only ER
and that U2OS-ER
cells expressed exclusively ER
. After an 18-h treatment with doxycycline, the U2OS-ER
and U2OS-ER
cell lines contained 69,000 and 54,000 receptors per cell by [3H]E2 binding studies (our unpublished data), respectively. Our results demonstrate that these cell lines can be used to identify target genes that are regulated exclusively by ER
or ER
in response to E2 and SERMs.
|
Genes Regulated by ER
Are Distinct from Those Regulated by ER
in Response to E2 and SERMs
To identify genes regulated by ER
and/or ER
, the U2OSER
and U2OS-ER
cell lines were treated with doxycycline for 18 h to induce ER expression in the absence or presence of 10 nM E2, 1 µM raloxifene, or 1 µM tamoxifen. Total RNA was used to prepare cRNA for hybridization with human U95Av2 microarrays (Affymetrix), which contain 12,600 known genes. Six sets of comparative expression data of untreated versus each treated group were used to determine the genes regulated in ER
and ER
cells. In both U2OS-ER
and U2OS-ER
cells, a total of 228, 190, and 236 genes were activated or repressed by E2, raloxifene, and tamoxifen, respectively (Table 1). Table 2 shows a partial list of the statistically significant (p < 0.05) regulated genes that had a mean ± 0.8 signal log ratio value (±1.74-fold change). E2 activated 67 genes in the U2OS-ER
cells and 121 in the U2OS-ER
cells (Table 1). Only 34 genes were activated by E2 in both cell lines. E2 repressed 36 genes in U2OS-ER
cells and 42 genes in U2OS-ER
cells, whereas only four genes were repressed by E2 in both cell lines. These findings demonstrate that only 38 of the 228 (17%) genes are regulated by both ER
and ER
with E2.
|
|
Raloxifene and tamoxifen activated and repressed a number of genes in the U2OS-ER
and U2OS-ER
cell lines. Similar to E2, the genes regulated by raloxifene or tamoxifen in U2OS-ER
cells were distinct from those regulated in U2OS-ER
cells. However, two distinguishing features occurred with SERMs compared with E2. First, many more genes were activated or repressed by SERMs in U2OS-ER
cells compared with the ER
cells. For example, 52 and 26 genes were induced by raloxifene and tamoxifen, respectively, in ER
cells, but only 10 and 21 genes were induced in ER
cells (Table 1). Although 101 and 129 genes were repressed by SERMs in ER
cells, only 10 and 38 genes were inhibited in ER
cells. Second, the majority of genes regulated by SERMs in both ER
and ER
cells displayed opposing expression patterns. Raloxifene regulated 17 genes in opposite directions, whereas tamoxifen regulated 12 genes in opposite directions. For example, raloxifene activated NGK2C in the U2OS-ER
cells and inhibited NGK2C in the U2OS-ER
cells (Table 1).
The regulation of
-AT, K19, WISP-2, Mda-7, NKG2C, and NKG2E by E2, raloxifene, or tamoxifen in the U2OS-ER
and ER
cell lines was verified by real-time PCR (Table 1). Furthermore, the regulation of some genes by E2 (WISP-2 and
-AT), raloxifene (NKG2C and 996282), and tamoxifen (NKG2E and G0S2) was dose dependent (Figure 2). Overall, only 17-18% of the genes regulated by E2 were also regulated by raloxifene or tamoxifen, and 37% of the genes regulated by raloxifene were also regulated by tamoxifen in both U2OS-ER
and ER
cell lines (Table 3A). The name of all genes regulated by E2, tamoxifen, and raloxifene are presented as a supplementary material. We also found little overlap of genes regulated by ER
and ER
when the cutoff for regulation by E2 and SERMs was increased to 2.3-fold (Table 3B). These results clearly demonstrate that the majority of genes regulated by ER
are different from those regulated by ER
in response to E2 or SERMs.
|
|
Bone-Related Genes Regulated by ER
Are Distinct from Those Regulated by ER
in Response to E2 and SERMs
Because bone cells were used for these studies, we decided to further analyze the subset of regulated genes known to be involved in bone homeostasis or metabolism. We identified 30 genes that were differentially regulated in the ER
and ER
cells treated with E2 or SERMs (Table 4). E2 activated four bone-related genes in the ER
cells. Only one of these genes was also induced by raloxifene, whereas another gene was activated by tamoxifen. Two genes were activated only by E2, and one gene was specifically activated by raloxifene. In the ER
cells, a total of 16 genes were activated by all three drugs, but only one was induced by both raloxifene and tamoxifen, whereas the remaining eight, six, and one genes were uniquely activated by E2, raloxifene, and tamoxifen, respectively.
|
Seven bone genes were repressed in the ER
cells in response to E2 and SERMs, but only one was inhibited by both E2 and tamoxifen, whereas two, one, and three genes were inhibited specifically by E2, raloxifene, and tamoxifen, respectively. In the ER
cells, the three drugs repressed 11 genes, and three of these genes were commonly regulated by both SERMs. Three, two, and three genes were inhibited specifically by E2, raloxifene, and tamoxifen, respectively. Overall, 6 and 13 unique genes were regulated in the ER
and ER
cells, respectively, when treated with E2 and SERMs. Thus, the U2OS-ER
and ER
cell lines displayed differential expression patterns of bone-related genes in response to E2, tamoxifen, and raloxifene.
The Effect of ER
Protein Level on Gene Expression Patterns in the U2OS-ER
Cell Line
To evaluate whether gene regulation patterns also occur at lower ER levels, we treated the U2OS-ER
cells for 18 h with 10 nM E2 and increasing amounts of doxycycline. Immunoblotting shows that the level of ER
expression increased with the dose of doxycycline (Figure 3A). As determined by semiquantitative RT-PCR, no induction of WISP-2 mRNA was observed in cells not treated with doxycycline. In contrast, even at the lowest dose of doxycycline (0.1 µg/ml), we detected an E2-dependent induction of WISP-2 in the U2OSER
cells (Figure 3B, lane 7).
|
We also examined the expression patterns of raloxifene- and tamoxifen-specific genes, after only a 3-h exposure to doxycycline, when the expression of ER
was comparatively low (Figure 1A, lane 3). We found that raloxifene activated TGF
3 (Figure 4A, lane 3), and tamoxifen activated G0S2 (lane 10) and repressed thrombin receptor (lane 15) at 3-h drug treatment by semiquantitative RT-PCR. Whereas some of the E2 and SERM targets identified by the microarrays could be secondary, regulated by gene products induced earlier by liganded ERs, the findings that these genes are also regulated by 3 h suggest that some of the genes represent direct ER targets. Consistent with the microarray data, similar results were obtained with TGF
3, G0S2 and thrombin receptor by real-time RT-PCR after 18-h exposure to raloxifene or tamoxifen (Figure 4B).
|
E2 Increases K19 mRNA Expression and Recruits ER
and ER
to the K19 Gene
To establish that ERs interact directly with a regulated gene identified in the inducible cell lines, we examined the effects of E2 on transcriptional regulation of the keratin 19 gene. This gene was chosen because the identification of a near-consensus ERE and half ERE (Choi et al., 2000
) permitted us to design PCR primers spanning this region for the ChIP assays. As shown by Northern blot analysis in Figure 5A, the expression of K19 was induced in U2OS-ER
and U2OS-ER
cells treated with 10 nM E2. To determine whether ER
and ER
are recruited to the endogenous K19 ERE enhancer, we performed ChIP assays with E2-treated U2OS-ER
and U2OS-ER
cells. As shown in Figure 5B, E2 recruited ER
and ER
to the region of the endogenous K19 gene that contains the ERE enhancer. These results demonstrate that ERs can be detected at the native ERE of an estrogen-inducible gene known to be a physiological ER target.
|
E2 and SERMs Increase the Expression of the Same Genes in MCF-7 Breast Cancer Cell Line
To investigate whether genes identified by microarrays are also regulated in cells not transfected with ERs, we examined the effect of the three drugs on several genes in MCF-7 breast cancer cells, which express endogenous ER
protein. Similar to the U2OS-ER
cells, E2 also increased the expression of K19, WISP-2, and
-AT in MCF-7 cells (Figure 6A). Raloxifene also increased the expression of NKG2C and clone 996282, whereas tamoxifen increased NKG2E and G0S2 in MCF-7 cells (Figure 6, B and C). Thus, several target genes identified by microarrays in U2OS-ER
cells are regulated similarly in MCF-7 cells that express endogenous ER
.
|
| DISCUSSION |
|---|
|
|
|---|
cells were distinct from those genes regulated in ER
cells. Because these results were obtained with a single time point and one concentration of each drug, it is possible that other patterns of gene regulation may occur with other treatment regimens. In both U2OS-ER
and U2OS-ER
cell lines, we found that E2, raloxifene, and tamoxifen activated and repressed a total of 228, 190, and 236 genes, respectively, of the 12,600 genes on the GeneChip. Among the genes activated by E2 were keratin 19 and WISP-2, which are known estrogen-inducible genes (Choi et al., 2000
3, which is a known gene regulated by raloxifene in bone (Yang et al., 1996
and ER
are recruited to the ERE enhancer in the keratin 19 gene by ChIP assays. Thus, ERs interacted with a known target gene for estrogens in the stable cell lines. In addition, some regulated genes identified in the U2OS ER
cells were also regulated in MCF-7 cells that express endogenous ER
. Collectively, these observations indicate that the regulated genes in U2OS cells identified by the arrays are authentic target genes.
The complex pattern of gene regulation by E2 and SERMs is surprising. Only 38 of 288 (17%) genes were commonly regulated by E2 in U2OS-ER
and ER
cells. In comparison, Richer et al. (2002
) demonstrated that 25 of 94 (27%) genes were commonly regulated by progesterone in cell lines stably transfected with progesterone receptor A or B. Furthermore, most genes regulated by SERMs differed from each other and from those genes regulated by E2. Only 27% of the genes regulated by raloxifene were also regulated by tamoxifen. Although raloxifene and tamoxifen are classified as SERMs, our results demonstrate that their pathways of actions diverge at the level of gene expression. The finding that tamoxifen and raloxifene regulate different sets of genes could explain why only tamoxifen increases endometrial cancer. Differences in gene expression in response to SERMs were also observed in the ER-negative breast cancer cell line (MDA-MB-231) stably transfected with ER
(Levenson et al., 2002
). Our most striking observation was that SERMs regulated some genes in opposite directions with ER
and ER
. For example, NKG2C was increased by raloxifene in ER
cells, but repressed by raloxifene in ER
cells. The mechanism and functional significance whereby SERMs regulate some genes in opposite directions requires a better characterization of the promoter elements in those genes. It is unlikely that the differences in gene profiles resulted from different levels of the ER
and ER
, because receptor binding assays demonstrated that the ER
and ER
cell lines contained comparable numbers of receptors.
Our observation that ER
and ER
regulate different genes in response to E2 and SERMs underscores the complexity of steroid receptor-mediated gene transcription. The complexity likely arises from presence of different types of response elements in target promoters and the differential utilization of cofactors and their regulatory surfaces by ER
or ER
. Three classes of response elements have been described in gene promoters: simple, composite, and tethering. Steroid receptors bind directly and independently to simple elements such as the classic ERE, whereas they bind to DNA in conjunction with other transcription factors at composite elements. Tethering elements include AP-1, Sp1, and nuclear factor-
B (Kushner et al., 2000
; Abdelrahim, 2002
; Tzagarakis-Foster et al., 2002
), which recruit ERs to promoters indirectly through protein-protein interactions. Multiple coregulators interact with ERs to mediate transcriptional regulation, including the p160 proteins (SRC1, GRIP1, and AIB1) (Onate et al., 1995
; Hong et al., 1996
; Anzick et al., 1997
), CBP/p300 (Kamei et al., 1996
), and TRAP/DRIP (Fondell et al., 1996
; Rachez and Freedman, 2001
) complexes. Using a factor pair analysis approach, Rogatsky et al. (2002
) showed not only distinct coregulatory proteins but also different active surfaces of the same factors are being selectively engaged by the glucocorticoid receptor in different response elements contexts. The ligand also determines coregulator binding specificity. E2 recruits coactivators, such as GRIP1 (Hong et al., 1996
; McKenna et al., 1999
), whereas raloxifene and tamoxifen recruit corepressors, such as N-CoR to ERs (Shang et al., 2000
; Shang and Brown, 2002
). Thus, the interaction of ER
and ER
with different ligands and response elements, and their recruitment of distinct factors and cofactor surfaces may be largely responsible for the differences in gene expression profiles observed by the microarrays with estrogens and SERMs.
Clinical studies have shown that estrogens or SERMs induce distinct effects in different tissues. For example, estrogens increase the risk of breast cancer, whereas the SERMs prevent ER-positive breast tumors. Identifying the mechanisms whereby estrogens or SERMs produce tissue-specific effects is critical for developing safer drugs for preventing and treating breast cancer and conditions associated with estrogen deficiency. Our results suggest that, in addition to ligand-specific recruitment of coregulators, the relative expression of ER
and ER
in different cell types may also account for tissue-specific responses to estrogens or SERMs. Our findings indicate that estrogens and SERMs will produce a distinct phenotype in cells that express predominantly ER
compared with those expressing ER
by regulating different set of genes. Furthermore, any change in the ratio ER
to ER
in tissues that occurs with aging or disease states may alter the tissue response to estrogens or SERMs. In future studies, it will be of interest to determine whether other patterns of gene regulation occur in response to estrogens and SERMs in cells that express different ratios of ER
to ER
.
Our microarray analysis has identified multiple ER
and ER
target genes regulated by E2 and SERMs. These genes provide the groundwork necessary to characterize the different types of response elements that are present in their promoters and to determine the underlying mechanism whereby these genes are differentially regulated by ER
and ER
. Understanding the mechanisms whereby ER
and ER
regulate different genes in response to estrogens and SERMs is critical for the development of more tissue-selective and safer drugs for menopausal symptoms and breast cancer.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Abbreviations used: ChIP, chromatin immunoprecipitation; E2, 17
-estradiol; ER, estrogen receptor(s); ERE, estrogen response element; K19, keratin 19; PBS, phosphate-buffered saline; RT, reverse transcription; SERM, selective estrogen receptor modulator(s); WISP-2, WNT1-inducible signaling pathway protein-2.
Online version of this article contains supplementary material. Online version is available at www.molbiolcell.org. ![]()
Corresponding author. E-mail address: leitmand{at}obgyn.ucsf.edu.
| REFERENCES |
|---|
|
|
|---|
An, J., Ribeiro, R.C., Webb, P., Gustafsson, J.A., Kushner, P.J., Baxter, J.D., and Leitman, D.C. (1999). Estradiol repression of tumor necrosis factor-alpha transcription requires estrogen receptor activation function-2 and is enhanced by coactivators. Proc. Natl. Acad. Sci. USA 96, 15161-15166.
An, J., Tzagarakis-Foster, C., Scharschmidt, T.C., Lomri, N., and Leitman, D.C. (2001). Estrogen receptor beta-selective transcriptional activity and recruitment of coregulators by phytoestrogens. J. Biol. Chem. 276, 17808-17814.
Anzick, S.L., Kononen, J., Walker, R.L., Azorsa, D.O., Tanner, M.M., Guan, X.Y., Sauter, G., Kallioniemi, O.P., Trent, J.M., and Meltzer, P.S. (1997). AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277, 965-968.
Baker, V., Draper, M., Paul, S., Allerheiligen, S., Glant, M., Shirfren, J., and Jaffe, R. (1998). Reproductive endocrine and endometrial effects of raloxifene hydrochloride, a selective estrogen receptor modulator, in women with regular menstrual cycles. J. Clin. Endocrinol. Metab. 83, 6-13.
Bernstein, L., Deapen, D., Cerhan, J., Schwartz, S., Liff, J., McGann-Maloney, E., Perkman, J., and Ford, L. (1999). Tamoxifen therapy for breast cancer and endometrial cancer risk. J. Natl. Cancer Inst. 91, 1654-1662.
Brzozowski, A.M., Pike, A.C., Dauter, Z., Hubbard, R.E., Bonn, T., Engstrom, O., Ohman, L., Greene, G.L., Gustafsson, J.A., and Carlquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389, 753-758.[CrossRef][Medline]
Choi, I., Gudas, L.J., and Katzenellenbogen, B.S. (2000). Regulation of keratin 19 gene expression by estrogen in human breast cancer cells and identification of the estrogen responsive gene region. Mol. Cell Endocrinol. 164, 225-237.[CrossRef][Medline]
Cohen, F.J., and Lu, Y. (2000). Characterization of hot flashes reported by healthy postmenopausal women receiving raloxifene or placebo during osteoporosis prevention trials. Maturitas 34, 65-73.[CrossRef][Medline]
Cummings, S., et al. (1999). The effect of raloxifene on risk of breast cancer in postmenopausal women. J. Am. Med. Assoc. 281, 2189-2197.
Delmas, P., Bjarnason, N., Mitlak, B., Ravoux, A.-C., Shah, A., Huster, W., Draper, M., and Christiansen, C. (1997). Effects of raloxifene on bone mineral density, serum cholesterol concentrations, and uterine endometrium in post-menopausal women. N. Engl. J. Med. 337, 1641-1647.
Ettinger, B., Black, D., Mitlak, B., Knickerbocker, R., Nickelsen, T., Genant, H., Christiansen, C., and Delmas, P. (1999). Reduction of vertebral fracture risk in postmenopausal women with osteoprosis treated with raloxifene. Results from a 3-year randomized clinical trial. J. Am. Med. Assoc. 282, 637-644.
Feng, W., Ribeiro, R.C., Wagner, R.L., Nguyen, H., Apriletti, J.W., Fletterick, R.J., Baxter, J.D., Kushner, P.J., and West, B.L. (1998). Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280, 1747-1749.
Fisher, B., et al. (1998). Tamoxifen for the prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel Project P-1 study. J. Natl. Cancer. Inst. 90, 1371-1388.
Fisher, B., et al. (1996). Five versus more than five years of tamoxifen therapy for breast cancer patients with negative lymph nodes and estrogen receptor-positive tumors. J. Natl. Cancer Inst. 88, 1529-1542.
Fondell, J.D., Ge, H., and Roeder, R.G. (1996). Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex. Proc. Natl. Acad. Sci. USA 93, 8329-8333.
Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J.M., Argos, P., and Chambon, P. (1986). Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320, 134-139.[CrossRef][Medline]
Hong, H., Kohli, K., Trivedi, A., Johnson, D.L., and Stallcup, M.R. (1996). GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. USA 93, 4948-4952.
Inadera, H., Hashimoto, S., Dong, H.Y., Suzuki, T., Nagai, S., Yamashita, T., Toyoda, N., and Matsushima, K. (2000). WISP-2 as a novel estrogen-responsive gene in human breast cancer cells. Biochem. Biophys. Res. Commun. 275, 108-114.[CrossRef][Medline]
Johnson, S.R. (1998). Menopause and hormone replacement therapy. Med. Clin. North Am. 82, 297-320.[CrossRef][Medline]
Kamei, Y., et al. (1996). A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85, 403-414.[CrossRef][Medline]
Kuiper, G., and Gustafsson, J. (1997). The novel estrogen receptor-beta sub-type: potential role in the cell- and promoter-specific actions of estrogens and anti-estrogens. Fed. Eur. Biochem. Soc. Lett. 410, 87-90.
Kushner, P.J., Agard, D.A., Greene, G.L., Scanlan, T.S., Shiau, A.K., Uht, R.M., and Webb, P. (2000). Estrogen receptor pathways to AP-1. J. Steroid Biochem. Mol. Biol. 72, 311-317.
Levenson, A.S., Svoboda, K.M., Pease, K.M., Kaiser, S.A., Chen, B., Simons, L.A., Jovanovic, B.D., Dyck, P.A., and Jordan, V.C. (2002). Gene expression profiles with activation of the estrogen receptor alpha-selective estrogen receptor modulator complex in breast cancer cells expressing wild-type estrogen receptor. Cancer Res. 62, 4419-4426.
Love, R., Mazess, R., Barden, H., Epstein, S., Newcomb, P., Jordan, V., Carbone, P., and DeMets, D. (1992). Effects of tamoxifen on bone mineral density in postmenopausal women with breast cancer. N. Engl. J. Med. 326, 852-856.[Abstract]
McDonnell, D.P. (2000). Selective estrogen receptor modulators (SERMs): a first step in the development of perfect hormone replacement therapy regimen. J. Soc. Gynecol. Investig. 7, S10-S15.[CrossRef][Medline]
McDonnell, D.P., and Norris, J.D. (2002). Connections and regulation of the human estrogen receptor. Science 296, 1642-1644.
McKenna, N.J., Lanz, R.B., and O'Malley, B.W. (1999). Nuclear receptor coregulators: cellular and molecular biology. Endocr. Rev. 20, 321-344.
Onate, S.A., Tsai, S.Y., Tsai, M.J., and O'Malley, B.W. (1995). Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354-1357.
Paech, K., Webb, P., Kuiper, G., Nilsson, S., Gustafsson, J.-A., Kushner, P., and Scanlan, T. (1997). Differential ligand activation of estrogen receptors ERa and ERb at API sites. Science 277, 1508-1510.
Pike, A.C., Brzozowski, A.M., Hubbard, R.E., Bonn, T., Thorsell, A.G., Engstrom, O., Ljunggren, J., Gustafsson, J.A., and Carlquist, M. (1999). Structure of the ligand-binding domain of oestrogen receptor beta in the presence of a partial agonist and a full antagonist. EMBO J. 18, 4608-4618.[CrossRef][Medline]
Rachez, C., and Freedman, L.P. (2001). Mediator complexes and transcription. Curr. Opin. Cell Biol. 13, 274-280.[CrossRef][Medline]
Richer, J.K., Jacobsen, B.M., Manning, N.G., Abel, M.G., Wolf, D.M., and Horwitz, K.B. (2002). Differential gene regulation by the two progesterone receptor isoforms in human breast cancer cells. J. Biol. Chem. 277, 5209-5218.
Rogatsky, I., Luecke, H.F., Leitman, D.C., and Yamamoto, K.R. (2002). Alternate surfaces of transcriptional coregulator GRIP1 function in different glucocorticoid receptor activation and repression contexts. Proc. Natl. Acad. Sci. USA 99, 16701-16706.
Shang, Y., and Brown, M. (2002). Molecular determinants for the tissue specificity of SERMs. Science 295, 2465-2468.
Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A., and Brown, M. (2000). Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843-852.[CrossRef][Medline]
Shiau, A.K., Barstad, D., Loria, P.M., Cheng, L., Kushner, P.J., Agard, D.A., and Greene, G.L. (1998). The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95, 927-937.[CrossRef][Medline]
The Writing Group for the PEPI Trial. (1996). Effects of hormone therapy on bone mineral density: results from the postmenopausal estrogen/progestin interventions (PEPI) trial. J. Am. Med. Assoc. 276, 1389-1396.
The Writing Group for the Women's Health Initiative. (2002). Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results From the Women's Health Initiative randomized controlled trial. J. Am. Med. Assoc. 288, 321-333.
Torgerson, D.J. (2000). HRT and its impact on the menopause, osteoporosis and breast cancer. Expert Opin. Pharmacother. 1, 1163-1169.[Medline]
Tzagarakis-Foster, C., Geleziunas, R., Lomri, A., An, J., and Leitman, D.C. (2002). Estradiol represses human T-cell leukemia virus type 1 Tax activation of tumor necrosis factor-alpha gene transcription. J. Biol. Chem. 277, 44772-44777.
Yang, N., Venugopalan, M., Hardikar, S., and Glasebrook, A. (1996). Identification of an estrogen response element activated by metabolites of 17b-estradiol and raloxifene. Science 273, 1222-1224.[Abstract]
This article has been cited by other articles:
![]() |
T. H. Charn, E. T.-B. Liu, E. C. Chang, Y. K. Lee, J. A. Katzenellenbogen, and B. S. Katzenellenbogen Genome-Wide Dynamics of Chromatin Binding of Estrogen Receptors {alpha} and {beta}: Mutual Restriction and Competitive Site Selection Mol. Endocrinol., January 1, 2010; 24(1): 47 - 59. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. H. Chan and M. L. Privalsky Isoform-Specific Transcriptional Activity of Overlapping Target Genes that Respond to Thyroid Hormone Receptors {alpha}1 and {beta}1 Mol. Endocrinol., November 1, 2009; 23(11): 1758 - 1775. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Nott, Y. Huang, X. Li, B. R. Fluharty, X. Qiu, W. V. Welshons, S. Yeh, and M. Muyan Genomic Responses from the Estrogen-responsive Element-dependent Signaling Pathway Mediated by Estrogen Receptor {alpha} Are Required to Elicit Cellular Alterations J. Biol. Chem., May 29, 2009; 284(22): 15277 - 15288. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chen, I. Hsu, A. Wolfe, S. Radovick, K. Huang, S. Yu, C. Chang, E. M. Messing, and S. Yeh Defects of Prostate Development and Reproductive System in the Estrogen Receptor-{alpha} Null Male Mice Endocrinology, January 1, 2009; 150(1): 251 - 259. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J Kojetin, T. P Burris, E. V Jensen, and S. A Khan Implications of the binding of tamoxifen to the coactivator recognition site of the estrogen receptor Endocr. Relat. Cancer, December 1, 2008; 15(4): 851 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kharode, P. V. N. Bodine, C. P. Miller, C. R. Lyttle, and B. S. Komm The Pairing of a Selective Estrogen Receptor Modulator, Bazedoxifene, with Conjugated Estrogens as a New Paradigm for the Treatment of Menopausal Symptoms and Osteoporosis Prevention Endocrinology, December 1, 2008; 149(12): 6084 - 6091. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Sundar, C. N. Marconett, V. B. Doan, J. A. Willoughby Sr, and G. L. Firestone Artemisinin selectively decreases functional levels of estrogen receptor-alpha and ablates estrogen-induced proliferation in human breast cancer cells Carcinogenesis, December 1, 2008; 29(12): 2252 - 2258. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Yarrow, C. F. Conover, A. V. Purandare, A. M. Bhakta, N. Zheng, B. Conrad, M. K. Altman, S. E. Franz, T. J. Wronski, and S. E. Borst Supraphysiological testosterone enanthate administration prevents bone loss and augments bone strength in gonadectomized male and female rats Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1213 - E1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Gonzales, M. J. Tetel, and C. K. Wagner Estrogen Receptor (ER) {beta} Modulates ER{alpha} Responses to Estrogens in the Developing Rat Ventromedial Nucleus of the Hypothalamus Endocrinology, September 1, 2008; 149(9): 4615 - 4621. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Hawse, M. Subramaniam, D. G. Monroe, A. H. Hemmingsen, J. N. Ingle, S. Khosla, M. J. Oursler, and T. C. Spelsberg Estrogen Receptor {beta} Isoform-Specific Induction of Transforming Growth Factor {beta}-Inducible Early Gene-1 in Human Osteoblast Cells: An Essential Role for the Activation Function 1 Domain Mol. Endocrinol., July 1, 2008; 22(7): 1579 - 1595. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, S. L Nott, Y. Huang, R. Hilf, R. A Bambara, X. Qiu, A. Yakovlev, S. Welle, and M. Muyan Gene expression profiling reveals that the regulation of estrogen-responsive element-independent genes by 17{beta}-estradiol-estrogen receptor {beta} is uncoupled from the induction of phenotypic changes in cell models J. Mol. Endocrinol., May 1, 2008; 40(5): 211 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Chang, T. H. Charn, S.-H. Park, W. G. Helferich, B. Komm, J. A. Katzenellenbogen, and B. S. Katzenellenbogen Estrogen Receptors {alpha} and {beta} as Determinants of Gene Expression: Influence of Ligand, Dose, and Chromatin Binding Mol. Endocrinol., May 1, 2008; 22(5): 1032 - 1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Denger, T. Bahr-Ivacevic, H. Brand, G. Reid, J. Blake, M. Seifert, C.-Y. Lin, K. May, V. Benes, E. T. Liu, et al. Transcriptome Profiling of Estrogen-Regulated Genes in Human Primary Osteoblasts Reveals an Osteoblast-Specific Regulation of the Insulin-Like Growth Factor Binding Protein 4 Gene Mol. Endocrinol., February 1, 2008; 22(2): 361 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Levy, D. Tatomer, C. B. Herber, X. Zhao, H. Tang, T. Sargeant, L. J. Ball, J. Summers, T. P. Speed, and D. C. Leitman Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene Mol. Endocrinol., February 1, 2008; 22(2): 287 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Hardman, E. Emmerson, L. Campbell, and G. S. Ashcroft Selective Estrogen Receptor Modulators Accelerate Cutaneous Wound Healing in Ovariectomized Female Mice Endocrinology, February 1, 2008; 149(2): 551 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cvoro, D. Tatomer, M.-K. Tee, T. Zogovic, H. A. Harris, and D. C. Leitman Selective Estrogen Receptor- Agonists Repress Transcription of Proinflammatory Genes J. Immunol., January 1, 2008; 180(1): 630 - 636. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bai, S. M. Houten, A. Huber, V. Schreiber, M. Watanabe, B. Kiss, G. de Murcia, J. Auwerx, and J. M.-d. Murcia Peroxisome Proliferator-activated Receptor (PPAR)-2 Controls Adipocyte Differentiation and Adipose Tissue Function through the Regulation of the Activity of the Retinoid X Receptor/PPAR{gamma} Heterodimer J. Biol. Chem., December 28, 2007; 282(52): 37738 - 37746. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Stygar, B. Masironi, H. Eriksson, and L. Sahlin Studies on estrogen receptor (ER) {alpha} and {beta} responses on gene regulation in peripheral blood leukocytes in vivo using selective ER agonists J. Endocrinol., July 1, 2007; 194(1): 101 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Schultz-Norton, K. A. Walt, Y. S. Ziegler, I. X. McLeod, J. R. Yates, L. T. Raetzman, and A. M. Nardulli The Deoxyribonucleic Acid Repair Protein Flap Endonuclease-1 Modulates Estrogen-Responsive Gene Expression Mol. Endocrinol., July 1, 2007; 21(7): 1569 - 1580. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Levy, X. Zhao, H. Tang, R. B. Jaffe, T. P. Speed, and D. C. Leitman Multiple Transcription Factor Elements Collaborate with Estrogen Receptor {alpha} to Activate an Inducible Estrogen Response Element in the NKG2E Gene Endocrinology, July 1, 2007; 148(7): 3449 - 3458. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M Johnson, M. Maleki-Dizaji, J. A Styles, and I. N H White Ishikawa cells exhibit differential gene expression profiles in response to oestradiol or 4-hydroxytamoxifen Endocr. Relat. Cancer, June 1, 2007; 14(2): 337 - 350. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-C. Leung, J. Brce, N. Doyle, H. J. Lee, G. M. Leong, K. Sjogren, and K. K. Y. Ho Regulation of Growth Hormone Signaling by Selective Estrogen Receptor Modulators Occurs through Suppression of Protein Tyrosine Phosphatases Endocrinology, May 1, 2007; 148(5): 2417 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cvoro, S. Paruthiyil, J. O. Jones, C. Tzagarakis-Foster, N. J. Clegg, D. Tatomer, R. T. Medina, M. Tagliaferri, F. Schaufele, T. S. Scanlan, et al. Selective Activation of Estrogen Receptor-{beta} Transcriptional Pathways by an Herbal Extract Endocrinology, February 1, 2007; 148(2): 538 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Li, M. J. Meyer, Curtis. P. Van Tassell, T. S. Sonstegard, E. E. Connor, M. E. Van Amburgh, Y. R. Boisclair, and A. V. Capuco Identification of estrogen-responsive genes in the parenchyma and fat pad of the bovine mammary gland by microarray analysis Physiol Genomics, January 12, 2007; 27(1): 42 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Turgeon, M. C. Carr, P. M. Maki, M. E. Mendelsohn, and P. M. Wise Complex Actions of Sex Steroids in Adipose Tissue, the Cardiovascular System, and Brain: Insights from Basic Science and Clinical Studies Endocr. Rev., October 1, 2006; 27(6): 575 - 605. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Monroe, F. J. Secreto, J. R. Hawse, M. Subramaniam, S. Khosla, and T. C. Spelsberg Estrogen Receptor Isoform-specific Regulation of the Retinoblastoma-binding Protein 1 (RBBP1) Gene: ROLES OF AF1 AND ENHANCER ELEMENTS J. Biol. Chem., September 29, 2006; 281(39): 28596 - 28604. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Frasor, E. C. Chang, B. Komm, C.-Y. Lin, V. B. Vega, E. T. Liu, L. D. Miller, J. Smeds, J. Bergh, and B. S. Katzenellenbogen Gene expression preferentially regulated by tamoxifen in breast cancer cells and correlations with clinical outcome. Cancer Res., July 15, 2006; 66(14): 7334 - 7340. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Hsieh, S. S. Rajan, S. K. Sharma, Y. Guo, E. R. DeSombre, M. Mrksich, and G. L. Greene Identification of Ligands with Bicyclic Scaffolds Provides Insights into Mechanisms of Estrogen Receptor Subtype Selectivity J. Biol. Chem., June 30, 2006; 281(26): 17909 - 17919. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Dubal, S. W. Rau, P. J. Shughrue, H. Zhu, J. Yu, A. B. Cashion, S. Suzuki, L. M. Gerhold, M. B. Bottner, S. B. Dubal, et al. Differential Modulation of Estrogen Receptors (ERs) in Ischemic Brain Injury: A Role for ER{alpha} in Estradiol-Mediated Protection against Delayed Cell Death Endocrinology, June 1, 2006; 147(6): 3076 - 3084. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Wang, N. Shah, C. Pantoja, S. H. Meijsing, J. D. Ho, T. S. Scanlan, and K. R. Yamamoto Novel arylpyrazole compounds selectively modulate glucocorticoid receptor regulatory activity. Genes & Dev., March 15, 2006; 20(6): 689 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
S C J P Gielen, L C M Kuhne, P C Ewing, L J Blok, and C W Burger Tamoxifen treatment for breast cancer enforces a distinct gene-expression profile on the human endometrium: an exploratory study Endocr. Relat. Cancer, December 1, 2005; 12(4): 1037 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
V X Jin, H Sun, T T Pohar, S Liyanarachchi, S K Palaniswamy, T H-M Huang, and R V Davuluri ERTargetDB: an integral information resource of transcription regulation of estrogen receptor target genes J. Mol. Endocrinol., October 1, 2005; 35(2): 225 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C.J.P. Gielen, C. W. Burger, L. C.M. Kuhne, P. Hanifi-Moghaddam, and L. J. Blok Analysis off Estrogen Agonism and Antagonism of Tamoxifen, Raloxifene, and ICI182780 in Endometrial Cancer Cells: A Putative Role for the Epidermal Growth Factor Receptor Ligand Amphiregulin Reproductive Sciences, October 1, 2005; 12(7): e55 - e66. [Abstract] [PDF] |
||||
![]() |
D. G. Monroe, F. J. Secreto, M. Subramaniam, B. J. Getz, S. Khosla, and T. C. Spelsberg Estrogen Receptor {alpha} and {beta} Heterodimers Exert Unique Effects on Estrogen- and Tamoxifen-Dependent Gene Expression in Human U2OS Osteosarcoma Cells Mol. Endocrinol., June 1, 2005; 19(6): 1555 - 1568. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cheung, M. L. Acevedo, P. A. Cole, and W. L. Kraus Altered pharmacology and distinct coactivator usage for estrogen receptor-dependent transcription through activating protein-1 PNAS, January 18, 2005; 102(3): 559 - 564. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||