Molecular Biology of the Cell Sign up for new MBC in Press e-TOCs!

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E03-09-0646 on December 29, 2003

Vol. 15, Issue 3, 1364-1373, March 2004

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E03-09-0646v1
15/3/1364    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Espineda, C. E.
Right arrow Articles by Rajasekaran, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Espineda, C. E.
Right arrow Articles by Rajasekaran, A. K.

Repression of Na,K-ATPase {beta}1-Subunit by the Transcription Factor Snail in Carcinoma

Cromwell E. Espineda *, Jay H. Chang * {dagger}, Jeffery Twiss {dagger}, Sigrid A. Rajasekaran *, and Ayyappan K. Rajasekaran * {ddagger}

* Department of Pathology and Laboratory Medicine, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, California 90095; {dagger} Nemours Biomedical Research, Alfred I. duPont Hospital for Children, Wilmington, Delaware 19803

Submitted September 5, 2003; Revised November 17, 2003; Accepted November 29, 2003
Monitoring Editor: Guido Guidotti


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
The Na,K-ATPase consists of two essential {alpha}- and {beta}-subunits and regulates the intracellular Na+ and K+ homeostasis. Although the {alpha}-subunit contains the catalytic activity, it is not active without functional {beta}-subunit. Here, we report that poorly differentiated carcinoma cell lines derived from colon, breast, kidney, and pancreas show reduced expression of the Na,K-ATPase {beta}1-subunit. Decreased expression of {beta}1-subunit in poorly differentiated carcinoma cell lines correlated with increased expression of the transcription factor Snail known to down-regulate E-cadherin. Ectopic expression of Snail in well-differentiated epithelial cell lines reduced the protein levels of E-cadherin and {beta}1-subunit and induced a mesenchymal phenotype. Reduction of Snail expression in a poorly differentiated carcinoma cell line by RNA interference increased the levels of Na,K-ATPase {beta}1-subunit. Furthermore, Snail binds to a noncanonical E-box in the Na,K-ATPase {beta}1-subunit promoter and suppresses its promoter activity. These results suggest that down-regulation of Na,K-ATPase {beta}1-subunit and E-cadherin by Snail are associated with events leading to epithelial to mesenchymal transition.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Epithelia form a barrier between two biological compartments and regulate the molecular composition of and exchange between the compartments they separate. The plasma membrane of epithelial cells is divided into two functionally and biochemically distinct domains, the apical and basolateral (basal and lateral) plasma membranes, by tight junctions (Simons and Fuller, 1985Go; Rodriguez-Boulan and Nelson, 1989Go). This unique structural organization of epithelial cells, referred to as polarized epithelial phenotype or well-differentiated phenotype, is lost in carcinoma (cancer derived from epithelial cells). In general, carcinoma cells show a more fibroblastic or mesenchymal phenotype. Events associated with the phenotypic conversion of epithelial cells to mesenchymal cells in cancer are referred to as epithelial to mesenchymal transition (EMT). Molecular mechanisms involved in EMT are beginning to be understood.

Recent studies indicate that the Snail family members that encode transcription factors of the zinc-finger type play a crucial role during EMT (Batlle et al., 2000Go; Comijn et al., 2001Go; Savagner, 2001Go; Nieto, 2002Go). The consensus binding site for Snail-related proteins contains a core of six bases, CAGGTG, also referred to as the E-box (Mauhin et al., 1993Go; Fuse et al., 1994Go; Inukai et al., 1999Go; Batlle et al., 2000Go; Cano et al., 2000Go; Kataoka et al., 2000Go). On binding to the E-box, Snail family members act as transcriptional suppressors (Batlle et al., 2000Go; Cano et al., 2000Go; LaBonne and Bronner-Fraser, 2000Go; Mayor et al., 2000Go). A direct correlation has been observed between Snail induction and the acquisition of metastatic properties in human tumor cell lines of different epithelial origin, including breast, pancreas, colon, bladder, oral squamous carcinomas, and melanomas (Batlle et al., 2000Go; Cano et al., 2000Go; Yokoyama et al., 2001Go; Jiao et al., 2002Go).

E-cadherin is a calcium-dependent cell adhesion molecule implicated in the maintenance of the polarized phenotype of epithelial cells (Takeichi, 1990Go, 1991Go; Gumbiner, 1996Go). Expression of E-cadherin is highly reduced during EMT (Hay, 1995Go; Hay and Zuk, 1995Go; Sun et al., 1998Go; Lilien et al., 2002Go; Masszi et al., 2003Go). Snail binds to the E-boxes present in the E-cadherin promoter and represses E-cadherin transcription (Batlle et al., 2000Go; Comijn et al., 2001Go; Savagner, 2001Go; Nieto, 2002Go). Thus, Snail seems to be a key regulator involved in the suppression of E-cadherin in carcinoma.

Na,K-ATPase is an abundantly expressed protein in epithelial cells. Localized to the basolateral plasma membrane, the oligomeric Na,K-ATPase catalyzes an ATP-dependent transport of three sodium ions out and two potassium ions into the cell per pump cycle to maintain the membrane potential and sodium and potassium gradients across the plasma membrane. This sodium and potassium homeostasis is necessary to regulate the functions of the various ion and solute transporters in epithelial cells. Na,K-ATPase is composed of two essential polypeptide subunits, the {alpha}-subunit (~112 kDa) (Shull et al., 1985Go) and the {beta}-subunit (~55 kDa) (Shull et al., 1986Go) and an optional regulatory {gamma}-subunit (~6.5 kDa) (Beguin et al., 1997Go). Although the {alpha}-subunit contains the catalytic activity of the enzyme, it is not functional without the {beta}-subunit. However, the precise function of the {beta}-subunit in Na,K-ATPase enzyme activity remains unclear. It is known that the {beta}-subunit is essential for the transport of the {alpha}-subunit to the plasma membrane (Geering, 1990Go; McDonough et al., 1990Go; Chow and Forte, 1995Go). Four {alpha}-isoforms have been described in mammals ({alpha}1, {alpha}2, {alpha}3, and {alpha}4); the {alpha}1 isoform is expressed in most of the tissue types (Shamraj and Lingrel, 1994Go; Blanco et al., 1999Go; Woo et al., 1999Go). Of the three isoforms described ({beta}1, {beta}2, and {beta}3), the {beta}1 isoform is expressed in most of the tissues (Lingrel et al., 1994Go; Mobasheri et al., 2000Go).

We have shown that the Na,K-ATPase function is necessary for the formation (Rajasekaran et al., 2001aGo) and maintenance (Rajasekaran et al., 2003Go) of tight junctions in epithelial cells. Recent studies have shown that in Drosophila both Na,K-ATPase {alpha}- (ATP{alpha}) and {beta}- (Nervana) subunits are localized to septate junctions and are essential for maintaining the permeability of the septate junctions (Genova and Fehon, 2003Go; Paul et al., 2003Go). These studies demonstrate that Na,K-ATPase function plays a crucial role in the maintenance of the polarized phenotype of epithelial cells (Rajasekaran and Rajasekaran, 2003Go).

The importance of Na,K-ATPase in the regulation of the polarized phenotype of epithelial cells is further exemplified by its altered subunit levels and reduced enzyme activity in carcinoma. Na,K-ATPase {beta}-subunit levels and Na,K-ATPase enzyme activity are highly reduced in an invasive and prevalent form of human renal clear cell carcinoma (Rajasekaran et al., 1999Go). Moloney sarcoma virus transformation of Madin-Darby canine kidney cells (MSV-MDCK) resulted in the loss of its polarized epithelial phenotype and was associated with a drastic reduction in the levels of the {beta}-subunit of Na,K-ATPase, indicating that oncogenic transformation of epithelial cells is associated with reduced Na,K-ATPase {beta}1-subunit expression (Rajasekaran et al., 2001bGo). The reduced expression of E-cadherin has been correlated to the loss of polarized phenotype and increased invasiveness of MSVMDCK cells (Behrens et al., 1989Go). However, repletion of E-cadherin alone did not induce tight junction formation and a well-differentiated phenotype in MSV-MDCK cells (Rajasekaran et al., 1996Go). Repletion of both E-cadherin and Na,K-ATPase {beta}1-subunit induced epithelial polarization, including the formation of tight junctions, and reduced invasiveness and cell motility in MSV-MDCK cells (Rajasekaran et al., 2001bGo). Based on these results, we proposed that a functional synergism between E-cadherin and Na,K-ATPase {beta}-subunit is involved in the regulation of the well-differentiated phenotype of epithelial cells (Rajasekaran et al., 2001bGo).

Consistent with the idea of functional synergism between E-cadherin and Na,K-ATPase, the {beta}-subunit promoter also revealed five potential E-boxes (Derfoul et al., 1998Go). Because Snail is known to bind to E-boxes and suppress E-cadherin expression, we hypothesized that Snail might be involved in the suppression of Na,K-ATPase {beta}1-subunit in carcinoma. In this study, we validate this hypothesis by demonstrating an inverse correlation between the levels of Na,K-ATPase {beta}1-subunit and Snail in carcinoma cell lines derived from breast, colon, pancreas, and kidney. We also show that Snail binds to the Na,K-ATPase {beta}1-subunit promoter and is involved in the down-regulation of the {beta}1-subunit in carcinoma cells. These studies strongly indicate that the normal levels of Na,K-ATPase {beta}1-subunit and E-cadherin expressed in epithelial cells are important for the maintenance of the well-differentiated phenotype of epithelial cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Cell Lines
MDCK (Clone II, Philadelphia) was provided by Dr. Enrique Rodriguez-Boulan (Cornell University, Ithaca, NY). MCF7, MDA435, Caco2, SW480, HPAF-II, MiaPaCa-2, and MSV-MDCK cells were obtained from American Type Culture Collection (Manassas, VA). MCF7, MDA435, Caco2, SW480, MiaPaCa-2, MDCK, and MSV-MDCK cells were grown in DMEM with 10% fetal bovine serum, nonessential amino acids, 1% penicillin-streptomycin, and glutamine at 37°C in a humidified atmosphere containing 5% CO2. HPAF-II cells were grown in RPMI with 10% fetal bovine serum, nonessential amino acids, penicillin-streptomycin, and glutamine.

Plasmid Constructs
Construction of the plasmids containing the human Na, K-ATPase {beta}1-subunit promoter (H{beta}1-1141-Luc) or a truncated piece of the 5' flanking region (H{beta}1-456-Luc) fused to the luciferase reporter gene has been described previously (Feng et al., 1993Go). For transfection efficiency control, Renilla plasmid was purchased from Promega (Madison, WI).

A 795-base pair cDNA containing the coding region of human Snail (SnaH) was generated by reverse transcription-polymerase chain reaction (RT-PCR) via the Titan RT-PCR kit (Roche Diagnostics, Indianapolis, IN) by using a set of primers containing XbaI and BamHI restriction sites. We used total RNA from MiaPaCa-2 cells, which have been shown to overexpress Snail (Batlle et al., 2000Go). The cDNA was subcloned into the expression vector pCDNA3 containing the cytomegalovirus promoter (Invitrogen, Carlsbad, CA). The construct, designated pCDNA3-Snail, was confirmed by sequencing (Laragen, Los Angeles, CA).

pPGS-Snail was constructed as described previously (Hajra et al., 2002Go). Full-length Snail cDNA was amplified by RT-PCR. Constructs were then subcloned into the pPGS-CMV-CITE-neo retroviral expression vector. Amphotropic retroviral packaging vector was a gift from J. Colicelli (University of California, Los Angeles, Los Angeles, CA).

Antibodies
Mouse monoclonal antibodies raised against Na,K-TPase {alpha}1-(M7-PB-E9) and {beta}1-subunit (M17-P5-F11) recognize epitopes that are common in human, sheep, and dog and have been characterized and described previously (Abbott and Ball, 1993Go; Sun and Ball, 1994Go). Mouse monoclonal antibody against canine E-cadherin (DECMA) was from Sigma-Aldrich (St. Louis, MO) and monoclonal anti-human E-cadherin antibody was from Zymed Laboratories (South San Francisco, CA). Anti-SNAI-1 antibody, a goat polyclonal antibody, was from Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase-linked anti-mouse antibody was purchased from BD Transduction Laboratories (Lexington, KY). Horseradish peroxidase-linked anti-rabbit antibody was from Cell Signaling (Beverly, MA).

Immunoblot Analysis
Monolayers were lysed in a lysis buffer (95 mM NaCl, 25 mM Tris, pH 7.4, 0.5 mM EDTA, 2% SDS, 1 mM phenylmethylsulfonyl fluoride, and 5 µg/ml each of antipain, leupeptin, and pepstatin). The lysates were briefly sonicated and centrifuged at 14,000 rpm in a microcentrifuge for 10 min. The supernatants were used for further analysis. Protein concentrations of the cell lysates were determined with the use of Bio-Rad DC reagent (Bio-Rad, Hercules, CA) according to manufacturer's instructions. Equal amounts of protein (200 µg) were separated by SDS-PAGE and transferred to nitrocellulose membrane (Schleicher & Schuell, Keene, NH). The blots were blocked with 10% nonfat dry milk in phosphate-buffered saline (PBS) and then incubated for 2 h at room temperature with primary antibody diluted in 10% milk/PBS. After incubation, the blots were washed three times with PBS/0.3% Tween 20 and then incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibody (1:4000 in 10% milk). Bound antibody was detected by peroxidase-catalyzed enhanced chemiluminescence (PerkinElmer Life Sciences, Boston, MA).

Rubidium Transport Assay
Ouabain-sensitive ion transport was determined via 86Rb+ uptake as described previously (Lambrecht et al., 1998Go; Rajasekaran et al., 2001bGo). Cells were washed once with ice-cold wash buffer (144 mM NaCl, 10 mM HEPES, pH 7.4, 0.5 mM CaCl2), incubated for 10 min at 37°C with uptake buffer (144 mM NaCl, 10 mM HEPES, pH 7.4, 0.5 mM MgCl2, 0.5 mM CaCl2, 1 mM RbCl, 1 mg/ml glucose, 1 µCi 86Rb+, PerkinElmer Life Sciences), and then washed three times with wash buffer. To determine the ouabain-sensitive 86Rb+ transport, the cells were treated with 50 µM ouabain (Sigma-Aldrich) for 30 min at 37°C before the first wash. Cells were lysed with 500 µl of 0.5 N NaOH for 1 h at room temperature and 86Rb+ by using a scintillation counter. Counts were normalized to protein content, and the ouabain-sensitive 86Rb+ flux was determined. The data are presented as mean ± SE.

Northern Blot Analysis
Total RNA was prepared using TRIzol reagent according to the manufacturer's instructions (Ambion, Austin, TX), transferred to nitrocellulose membranes (Schleicher & Schuell), and probed for Na,K-ATPase {alpha}1- and {beta}1-subunits, E-cadherin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by using the PrimeIt labeling kit (Stratagene, San Diego, CA).

RT-PCR Analysis
RT-PCR was performed using the Titan RT-PCR system (Roche Diagnostics). Two micrograms of total RNA were used for each reaction. The sequences for the primers (Invitrogen) are the following: human Snail (60°C annealing): forward, 5' AATCGGAAGCCTAACTACAG 3'; reverse, 5' GGAAGAGGCTGAAGTAGAG 3'; canine Snail (60°C annealing): forward, 5' CCCAAGCCCAGCCGATGAG 3'; reverse, 5' CTTGGCCACGGAGAGCCC 3'; GAPDH (60°C annealing): forward, 5' GTGAAGGTCGGAGTCAACGG 3'; reverse, 5' TGATGACAAGCTTCCCGTTCTC 3'; human E-cadherin (60°C annealing): forward, 5' TTCCTCCCAATACATCTCCCTTCACAGCAG 3'; reverse, 5' CGAAGAAACAGCAAGAGCAGCAGAATCAGA 3'; human Na,K-ATPase {beta}1-subunit (60°C annealing): forward, 5' ACTGAAATTTCCTTTCGTCCTAA 3'; reverse, 5' ATCACTGGGTAAGTCTCCA 3'; human Na,K-ATPase {alpha}1-subunit (57°C annealing): forward, 5' GACGTGATAAGTATGAGCCTG 3'; reverse, 5' AATCCCCGGCTCAAGTCTGT 3'. RT-PCR products were analyzed by electrophoresis in 1.0% agarose.

Retroviral Transduction
Snail-expressing retroviruses were generated by transfecting plasmids (15 µg of pPGS-Snail or pPGS) and 15 µg of amphotropic retroviral packaging vector into human embryonic kidney 293T packaging cells by using the calcium phosphate method. After overnight transfection (14 h) into the packaging line, the medium was changed and virus containing supernatant was harvested 24, 36, 43, and 48 h later. The supernatant was filtered and then supplemented with 8 µg/ml Polybrene (Sigma-Aldrich) and used to infect MDCK and MCF7 cells. After infection (48 h), selection was initiated in 0.5 mg/ml G418 (Invitrogen). The G418-resistant clones were pooled and used for experiments.

Small Interfering RNA (siRNA)-mediated RNA Interference
The Snail siRNA duplex was obtained from Dharmacon (Lafayette, CO). The target sequences used are the following: Snail (5'-GCGAGCUGCAGGACUCUAA-3') and green fluorescent protein (GFP) (5'-GGCTACGTCCAGGAGCGCACC-3'). Snail siRNA was transfected into poorly differentiated SW480 cells by using Oligofectamine following manufacturer's instructions (Invitrogen). Cell density at 60% confluence was used at the time of transfection. At 96 h posttransfection, total RNA was prepared using TRIzol reagent according to the manufacturer's instructions (Ambion).

Reporter Gene Assays
Transient transfections were performed in six-well plates by using LipofectAMINE (Invitrogen) according to the manufacturer's instructions. The following constructs were used: 10 µg of luciferase reporter plasmid and 0.1 µg of Renilla control reporter plasmid. Transfections were performed in triplicate. Lysates were made 72 h posttransfection by using 1x Passive Lysis buffer (Promega) according to manufacturer's instructions. Lysates were then used for luciferase assays. A luminometer was utilized to measure both {beta}1-subunit promoter-luciferase reporter units and Renilla luciferase units. Luciferase values were normalized to Renilla reporter activity. Statistical significance was determined by Student's t test or one-way analysis of variance (Prism; GraphPad Software, San Diego, CA).

Electrophoretic Mobility Shift Assay (EMSA)
Preparation of nuclear extracts and EMSA experiments were performed as described previously (Batlle et al., 2000Go) with minor modifications. Cells were lysed in 0.5% NP-40 and centrifuged to pellet the nuclei. Nuclear proteins were then extracted in 20 mM HEPES, pH 7.6, 25% glycerol, 840 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, and a standard protease inhibitor cocktail. The double-stranded oligonucleotide used as a probe for EMSA experiments corresponds to the following sequence in the Na,K-ATPase {beta}1-subunit promoter: E-box1wt (position -81 to -52), 5' GGCGATTGGC-CACCGG-GCCGCTAGAGGGCG 3'. 5' CACCGG 3' nucleotides were changed in the mutated version (5' AAATTT 3') used in the competition experiments. Probes were labeled with [{gamma}-32P]ATP and polynucleotide kinase and then purified using a spin column (Bio-Rad). Reactions with equal amounts of nuclear extracts (10 µg/reaction) were performed in a 20-µl final volume containing binding buffer (20 mM HEPES, pH 7.6, 150 mM KCl, 3 mM MgCl2, 10% glycerol, 0.2 mM ZnSO4, 0.3 mg/ml bovine serum albumin), 50,000 cpm probe, and 1 µg of poly(dI:dC) for 30 min at 4°C. For competition assays, 200-fold unlabeled oligonucleotides or 8 µg of anti-SNAI-1 antibody (Santa Cruz Biotechnology), respectively, was preincubated with cell extracts at 4°C for 30 min before addition of probe. Complexes were resolved on 4% nondenaturing polyacrylamide gels in Tris borate-EDTA buffer.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Decreased Na,K-ATPase {beta}1-Subunit Levels in Poorly Differentiated Carcinoma Cell Lines
We have shown previously that the protein levels of the Na,K-ATPase {beta}1-subunit were highly reduced in an invasive form of renal carcinoma (Rajasekaran et al., 1999Go). Subsequently, we showed that the {beta}1-subunit protein levels were also reduced in MSV-MDCK cells (Rajasekaran et al., 2001bGo). To test whether reduced {beta}1-subunit expression is also observed in other carcinomas, we determined the levels of Na,K-ATPase {beta}1-subunit in various well-differentiated and poorly differentiated cell lines derived from tissues such as breast (MCF7 and MDA435), colon (Caco2 and SW480), pancreas (HPAF-II and MiaPaCa-2), and kidney (MDCK and MSV-MDCK). Well-differentiated cell lines maintain an epithelial morphology and in most cases have tight junctions and show a polarized phenotype. Poorly differentiated cell lines show a fibroblastic phenotype, lack tight junctions and epithelial polarity, and in general are more motile than the well-differentiated cell lines. We compared the protein levels of E-cadherin, Na,K-ATPase {beta}1- and {alpha}1-subunits in well-differentiated cell lines (MCF7, Caco2, HPAF-II, and MDCK) and poorly differentiated cell lines (MDA435, SW480, MiaPaCa-2, and MSV-MDCK) (Figure 1A). Poorly differentiated carcinoma cell lines showed reduced expression of E-cadherin compared with well-differentiated cell lines. Like E-cadherin, the Na-K-ATPase {beta}1-subunit protein levels were drastically reduced in all poorly differentiated cell lines compared with well-differentiated cell lines. The reduced {beta}1-subunit levels detected in the immunoblot is not due to the failure of the antibody to detect differentially glycosylated {beta}1-subunit expressed in these cell lines because cell lysates subjected to N-glycosidase treatment also revealed a reduction in {beta}1-subunit levels (our unpublished data). The Na,K-ATPase {alpha}1-subunit levels were similar in poorly differentiated breast and colon carcinoma cell lines and showed some decrease in poorly differentiated pancreatic and kidney carcinoma cell lines. We then tested using 86Rb+ flux whether reduced {beta}-subunit levels in poorly differentiated cell lines was accompanied by reduced Na,K-ATPase activity. The ouabain sensitive 86Rb+ flux was 70.6 ± 5.3, 67.2 ± 1.2, 89.4 ± 10, and 60.7 ± 4.7% for MDA435, SW480, MiaPaCa-2, and MSV-MDCK cells, respectively, compared with their well-differentiated counterparts (Figure 1B). Interestingly, the MiaPaCa-2 cell line, which showed reduced levels of {alpha}1-subunit, did not show a significant decrease in the Na,K-ATPase activity. Whether this cell line express another isoform of {alpha}-subunit is currently not known. These results indicate that a drastic reduction in {beta}1-subunit levels is not accompanied by a substantial decrease in the activity of the enzyme.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. Correlation between E-cadherin, Na,K-ATPase {alpha}1-subunit, {beta}1-subunit protein levels, and Na,K-ATPase enzyme activity. (A) E-cadherin, Na,K-ATPase {beta}1-subunit, and {alpha}1-subunit protein levels were analyzed by an immunoblot in a panel of epithelial cell lines: breast, MCF7, and MDA435; colon, Caco2, and SW480; pancreas, HPAF-II and MiaPaCa-2; and canine kidney, MDCK, and MSV-transformed MDCK. Actin immunoblot analysis confirmed equal loading of whole cell lysates. MCF7, Caco2, HPAF-II, and MDCK are well-differentiated whereas MDA435, SW480, MiaPaCa-2, and MSV-MDCK are poorly differentiated cell lines. (B) Ouabain-sensitive 86Rb+ flux in well- and poorly differentiated cell lines. The 86Rb+ uptake assay was performed as described in MATERIALS AND METHODS. Bars show SE of two independent determinations performed in triplicates.

 

We then determined whether the decreased protein levels of the Na,K-ATPase {beta}1-subunit are associated with decreased mRNA levels by a Northern blot analysis (Figure 2A). {beta}1-subunit mRNA levels were drastically reduced in poorly differentiated carcinoma cell lines compared with well-differentiated cell lines, suggesting that the expression of the Na,K-ATPase {beta}1-subunit is reduced at the transcriptional level in poorly differentiated carcinoma cell lines. The {alpha}1-subunit mRNA levels were similar in breast and colon carcinoma cell lines, whereas the levels were reduced in poorly differentiated pancreas and kidney carcinoma cell lines. Reduced E-cadherin expression in poorly differentiated carcinoma cell lines was previously found to be inversely correlated to the level of expression of the transcription factor Snail (Batlle et al., 2000Go; Poser et al., 2001Go; Yokoyama et al., 2001Go; Jiao et al., 2002Go). We therefore determined the levels of Snail mRNA in well-differentiated and poorly differentiated carcinoma cell lines by RT-PCR analysis. Snail expression was elevated in all poorly differentiated carcinoma cell lines compared with the well-differentiated cell lines (Figure 2B). These results demonstrate that Na,K-ATPase {beta}1-subunit expression is inversely correlated to the expression of Snail, suggesting that Snail might be involved in the down-regulation of Na,K-ATPase {beta}1-subunit in carcinoma cell lines.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 2. Reduced Na,K-ATPase {beta}1-subunit mRNA levels in poorly differentiated cell lines. (A) Northern blot analysis of E-cadherin, Na,K-ATPase {beta}1-subunit, and {alpha}1-subunit mRNA levels in well- and poorly differentiated cell lines. GAPDH Northern blot analysis confirmed equal loading of total RNA. (B) Levels of Snail mRNA expression in well- and poorly differentiated cell lines were analyzed by RT-PCR. The expression of GAPDH was analyzed in the samples as a control for the amount of cDNA present in each sample.

 

Snail Expression Modulates Na,K-ATPase {beta}1-Subunit Levels
To test whether increased Snail expression leads to reduced Na,K-ATPase {beta}1-subunit levels, we exogenously overexpressed Snail in two well-differentiated cell lines, MCF7 and MDCK. Both cell lines were transduced with an amphotrophic retrovirus harboring human Snail cDNA and neomycin-resistant clones were pooled and used for the experiments. RT-PCR analysis confirmed that human Snail is overexpressed in MCF7-Snail and MDCK-Snail cell lines compared with vector-transduced cell lines (Figure 3D). Vector-transduced MCF7 and MDCK cells showed a typical cobblestone-like appearance (Figure 3A). In contrast, Snail-transduced cells were less adherent to each other and were more elongated and displayed a mesenchymal phenotype (Figure 3A). Immunoblot analysis revealed highly reduced levels of E-cadherin and Na,K-ATPase {beta}1-subunit in both Snail-overexpressing MCF7 and MDCK cells. Although some E-cadherin was observed in MCF7-Snail cells, Na,K-ATPase {beta}1-subunit expression was barely detected (Figure 3B). Snail overexpression did not affect the {alpha}1-subunit levels in either cell lines (Figure 3B). Consistent with the {alpha}1-subunit levels, the 86Rb+ flux in Snail-overexpressing cells did not show a significant difference compared with control cells (Figure 3C). These results strongly suggest that Snail is involved in the down-regulation of Na,K-ATPase {beta}1-subunit but not the {alpha}1-subunit of the enzyme.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 3. Snail expression modulates Na,K-ATPase {beta}1-subunit levels. (A) Phase contrast image of MCF7 and MDCK cells constitutively expressing pPGS empty vector or pPGS-Snail. (B) Immunoblot analysis measured E-cadherin, Na,K-ATPase {beta}1- and {alpha}1-subunit protein levels in MCF7 and MDCK cells constitutively expressing pPGS empty vector or pPGS-Snail. Actin immunoblot shows equal loading of whole cell lysates. (C) Ouabain-sensitive 86Rb+ flux in MCF7 and MDCK cells expressing pPGS vector or pPGS-Snail. The 86Rb+ uptake assay was performed as described in MATERIALS AND METHODS. Bars show SE of two independent determinations performed in triplicate. (D) RT-PCR analysis results show that with the exception of Na,K-ATPase {alpha}1-subunit, E-cadherin and Na,K-ATPase {beta}1-subunit protein levels inversely correlated with Snail expression. GAPDH RT-PCR analysis was performed as a control for the amount of cDNA present in each sample. (E) RNA interference-mediated reduction of Snail increases Na,K-ATPase {beta}1-subunit mRNA levels in SW480 cells. RNAi was performed in SW480 cells by using siRNAs for GFP (control) and Snail (refer to MATERIALS AND METHODS). After transfection, total RNA was extracted, and RT-PCR was performed using primer pairs specific for either Snail, {beta}1-subunit, {alpha}1-subunit, E-cadherin, or GAPDH. RT-PCR products were analyzed on a 1% agarose gel.

 

RNA interference is a mechanism of gene silencing that is mediated by short strands of duplex RNA (called siRNA) that target the corresponding mRNA for degradation (Zamore, 2001Go). To further confirm that Snail is involved in the suppression of Na,K-ATPase {beta}1-subunit, we used RNA interference (RNAi) to reduce Snail expression in a poorly differentiated cell line (SW480), which expresses high levels of endogenous Snail. Transfection with Snail siRNA resulted in a 32.7% reduction of Snail mRNA levels compared with SW480 cells transfected with GFP siRNA control (Figure 3E). Concomitantly, Snail down-regulation also lead to 30.0 and 28.2% increases in the levels of {beta}1-subunit and E-cadherin mRNAs, respectively (Figure 3E). The levels of {alpha}1-subunit mRNA, however, were similar between GFP siRNA-transfected and Snail siRNA-transfected SW480 cells. These results demonstrate that Snail is involved in the modulation of Na,K-ATPase {beta}1-subunit levels but not the {alpha}1-subunit levels in epithelial cell lines.

Reduced {beta}1-Subunit Promoter Activity in Cell Lines with Increased Snail Expression
To test whether Snail transcriptionally suppresses Na,K-ATPase {beta}1-subunit expression, we transiently transfected well-differentiated (MCF7, Caco2, and MDCK) and poorly differentiated (MDA435, SW480, and MSV-MDCK) carcinoma cell lines with a luciferase reporter construct under the control of the human {beta}1-subunit promoter (H{beta}1-1141-Luc). This fragment consists of half-sites of three potential mineralcorticoid/glucocorticoid responsive elements (MRE/GREs) (Derfoul et al., 1998Go), four E-boxes, a nuclear factor-1 binding site (Derfoul et al., 1998Go), and a noncanonical E-box (5' CACCGG 3') (Figure 4A). The {beta}1-subunit promoter activity in MDA435 was reduced to 67.4% compared with MCF7. {beta}1-subunit promoter activities for SW480 and MSVMDCK were 43.5 and 38.5% compared with Caco2 and MDCK cells, respectively (Figure 4B). We then tested H{beta}1-456-Luc, which contains one MRE/GRE and the noncanonical E-box element (Figure 4C). This fragment revealed similar results as the H{beta}1-1141-Luc. The MDA435 cell line showed a reduction to 58.3% {beta}1-subunit promoter activity compared with MCF7 cells. The promoter activities were 24.7 and 37.2% in SW480 and MSV-MDCK cells compared with Caco2 and MDCK cells, respectively (Figure 4D). Because the H{beta}1-456-Luc construct yielded similar results as that of the H{beta}1-1141-Luc construct, we used the H{beta}1-456-Luc construct for further analysis.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Reduced Na,K-ATPase {beta}1-subunit promoter activity in poorly differentiated cells. (A) Schematic representation of Na,K-ATPase {beta}1-subunit proximal promoter elements. Luciferase reporter used is under the control of the human {beta}1-subunit promoter (H{beta}1-1141-Luc). This fragment consists of half-sites of three potential MRE/GREs, four E-boxes, a nuclear factor-1 (NF-1) binding site, and a noncanonical E-box (5' CACCGG 3'). +1 indicates the transcription start site. (B) Comparison of the {beta}1-subunit promoter activity in well-differentiated and poorly differentiated cell lines by using the H{beta}1-1141-Luc construct. MCF7, MDA435, Caco2, SW480, MDCK, and MSV-MDCK cells were transiently transfected with 10 µg of H{beta}1-1141-Luc (full-length) reporter plasmid. Promoter activity was determined by luciferase reporter assays. Luciferase values were normalized to Renilla reporter activity. The results shown correspond to the average of three independent experiments. (C) Schematic representation of H{beta}1-456-Luc (truncated) containing one MRE/GRE and the noncanonical E-box. (D) Comparison of the {beta}1-subunit promoter activity in well-differentiated and poorly differentiated cell lines by using the H{beta}1-456-Luc construct. MCF7, MDA435, Caco2, SW480, MDCK, and MSV-MDCK cells were transiently transfected with 10 µg of H{beta}1-456-Luc reporter plasmid. Promoter activity was determined by luciferase reporter assays, and luciferase values were normalized to Renilla reporter activity. Results shown correspond to the average of three independent experiments.

 

Snail Represses the Activity of the {beta}1-Subunit Promoter
To directly test whether Snail represses the activity of the {beta}1-subunit promoter, we transiently cotransfected pCDNA3-Snail or pCDNA3 vector with the H{beta}1-456-Luc promoter construct in MCF7, Caco2, and MDCK cells. Cotransfection with the vector did not affect the promoter activity, whereas pCDNA3-Snail showed a dose-dependent repression of the {beta}1-subunit promoter activity (Figure 5A). In MCF7 cells, cotransfection with 1 µg of pCDNA3-Snail reduced the promoter activity to 83.0%, whereas in Caco2 and MDCK cells, the {beta}1-subunit promoter activities were reduced to 34.1 and 21.9%, respectively. Transfection with 2 µg of pCDNA3-Snail revealed a reduction to 30.2, 15.9, and 4.8% {beta}1-subunit promoter activity in MCF7, Caco2, and MDCK cells, respectively. Finally, transfection of varying concentrations of pCDNA3-Snail in COS cells revealed a dose-dependent repression of {beta}1-subunit promoter activity (Figure 5B). These data demonstrate that Snail has an inhibitory effect on the Na,K-ATPase {beta}1-subunit promoter in vitro and that transcription of the {beta}1-subunit is directly controlled by Snail regulating the activity of its promoter.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. Increasing Snail expression reduces Na,K-ATPase {beta}1-subunit promoter activity in well-differentiated cell lines (MCF7, Caco2, and MDCK) and COS cells. (A) MCF7, Caco2, and MDCK cell lines were transfected with pCDNA3 vector containing human Snail cDNA or with empty pCDNA3. One or two micrograms of pCDNA3-Snail were used in the transient transfection. The H{beta}1-456-luc reporter plasmid was used in the luciferase reporter assays. Luciferase values were normalized to Renilla reporter activity. The results shown correspond to the average of three independent experiments. (B) Increasing Snail expression reduces Na,K-ATPase {beta}1-subunit promoter activity in COS cells in a dose-dependent manner. COS cells were transfected with pCDNA3-Snail or with empty pCDNA3 plasmid. Increasing amounts of pCDNA3-Snail were used in the transient transfection. The H{beta}1-456-luc plasmid was used in the luciferase reporter assays. Luciferase values were normalized to Renilla reporter activity. The results shown correspond to the average of three independent experiments.

 

Snail Binds to an E-box in the Na,K-ATPase {beta}1-Subunit Proximal Promoter
We then examined whether Snail binds to the Na,K-ATPase {beta}1-subunit promoter by using EMSA. Nuclear lysates from Snail-overexpressing well-differentiated cell lines (MDCK-Snail and MCF7-Snail) and two poorly differentiated cell lines (MiaPaCa-2 and MDA435) were used to test Snail binding to the {beta}1-subunit promoter. Because Snail is known to bind E-boxes (Mauhin et al., 1993Go; Nakayama et al., 1998Go) and because a putative noncanonical E-box was present at position -71 to -66 of the {beta}1-subunit promoter, we generated an oligonucleotide probe (E-box1wt), encompassing the putative noncanonical E-box (position -81 to -52) for the EMSA (Figure 6A). As control, we also generated a probe in which the E-box is mutated into "AAATTT" (E-box1mut) (Figure 6A). Inclusion of nuclear lysates clearly showed a band (arrow, lanes 2, 6, 11, and 15) (Figure 6B) having retarded electophoretic mobility compared with the labeled oligonucleotide without nuclear lysates (probe alone, lane 1). Furthermore, the shifted band seen when E-box probe was incubated with nuclear lysates was specifically competed out with excess unlabeled probe (lanes 3, 7, 12, and 16). However, a mutant probe where the E-box was altered showed no competition (lanes 4, 8, 13, and 17). The only difference between the cold wild-type and mutant probes is in the E-box element. Finally, inclusion of an antibody against Snail in the EMSA reaction abolished the detection of the shifted band (lanes 5, 9, 14, and 18), whereas the control antibody did not show any effect (lane 10), indicating that the shifted band contains Snail bound to the {beta}1-subunit promoter. Together, these results demonstrate that the transcription factor Snail binds to the noncanonical E-box element of the {beta}1-subunit promoter and is involved in the down-regulation of the Na,K-ATPase {beta}1-subunit.



View larger version (105K):
[in this window]
[in a new window]
 
Figure 6. Endogenous Snail from multiple cell lines binds to the noncanonical E-box element of the Na,K-ATPase {beta}1-subunit promoter. (A) Noncanonical E-box is present at position -71 to -66 of the {beta}1-subunit promoter. An oligonucleotide probe, called E-box1wt, was generated, which encompasses the noncanonical E-box (position -81 to -52) for the EMSA. As a control, we also generated a probe in which E-box1 is mutated into "AAATTT" (E-box1 mut). (B) Nuclear extracts from MDCK-Snail, MCF7-Snail, MiaPaCa-2, and MDA435 cells were incubated with double stranded 32P-labeled oligonucleotides containing the 5' CACCGG 3' sequence corresponding to E-box1 of the Na,K-ATPase {beta}1-subunit promoter. For competition assays, a 200-fold molar excess of unlabeled E-box1 wt (wt; lanes 3, 7, 12, and 16), E-box1 mut (mut; lanes 4, 8, 13, and 17) oligonucleotides, 8 µg of anti-SNAI-1 antibody (Snail; lanes 5, 9, 14, and 18) or a nonspecific antibody (Cont; lane 10) was added before addition of probe to the binding reactions. Snail-containing complexes were detected in all cell lines (arrow). Addition of anti-SNAI-1 antibody or cold wild-type probe competed Snail binding to E-box1.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
In this study, we demonstrated that Na,K-ATPase {beta}1-subunit levels are reduced in a variety of cell lines derived from carcinoma and that the transcription factor Snail is involved in the repression of Na,K-ATPase {beta}1-subunit in carcinoma cells. Loss of the well-differentiated phenotype with concomitantly reduced {beta}1-subunit and E-cadherin levels in Snail-overexpressing MDCK and MCF7 cells demonstrate that normal levels of E-cadherin and Na,K-ATPase {beta}1-subunit are necessary to maintain the well-differentiated phenotype of epithelial cells. Consistent with this observation, we have shown previously that repletion of Na,K-ATPase {beta}1-subunit and E-cadherin was sufficient to induce a well-differentiated phenotype in MSV-MDCK cells (Rajasekaran et al., 2001bGo). These results demonstrate that a functional synergism between E-cadherin and Na,K-ATPase is involved in the maintenance of the well-differentiated phenotype of epithelial cells.

Although the Na,K-ATPase {alpha}1- and {beta}1-subunits are expressed together at the cell surface, our results suggest that the genes encoding these proteins are differentially regulated in carcinoma. Highly reduced {beta}1-subunit but not {alpha}1-subunit levels in Snail-overexpressing MDCK and MCF7 cells and up-regulation of {beta}1-subunit levels in SW480 cells transfected with Snail siRNA demonstrate that Snail specifically down-regulates the Na,K-ATPase {beta}1-subunit. In addition, interaction of Snail to the 30 nucleotide promoter fragment containing the noncanonical E-box element and competition of Snail binding by the cold wild-type probe but not the cold mutant probe demonstrate that Snail binds to the noncanonical E-box element "CACCGG" located at position -71 to -66 of the {beta}1-subunit promoter. Noncanonical E-boxes have been discovered in a number of genes. The basic helix-loop-helix protein sisterlessB in Drosophila binds to the noncanonical E-box CA(G/C)CCG (Yang et al., 2001Go), whereas the upstream stimulatory factor-1 interacts with CACGGG in the insulin-like growth factor binding protein-1 promoter (Matsukawa et al., 2001Go). The sequence in the {beta}1-subunit promoter has similarity to the CANNGG sequence found in insulin-like growth factor binding protein-1 promoter; both contain a "G" at position 5 instead of a "T." Our results strongly suggest that Snail binding to the noncanonical E-box element is sufficient to reduce activity of the {beta}1-subunit promoter. Whether the upstream E-box elements in the {beta}1-subunit are also involved in Snail binding and down-regulation of the {beta}1-subunit in carcinoma remains to be elucidated.

Although the {beta}1-subunit levels were drastically reduced in poorly differentiated and Snail-overexpressing cell lines, we did not observe a substantial decrease in the activity of the Na,K-ATPase, indicating that high levels of {beta}1-subunit are not critical for pump activity. Several studies have shown that the {beta}1-subunit plays a role in the stability and the transport of {alpha}1-subunit of Na,K-ATPase to the plasma membrane (Geering, 1990Go; McDonough et al., 1990Go; Noguchi et al., 1990aGo,bGo; Chow and Forte, 1995Go). Our results, showing normal {alpha}1-subunit levels but highly reduced {beta}1-subunit levels in Snail-overexpressing carcinoma cell lines, imply that carcinoma cells have either adapted alternative mechanism/s to stabilize and transport {alpha}1-subunit to the plasma membrane or a small amount of {beta}1-subunit might be sufficient to stabilize and to transport the {alpha}-subunit to the plasma membrane. It is tempting to speculate that the {beta}1-subunit might have functions that are independent from its role in the regulation of Na,K-ATPase enzyme activity in epithelial cells.

How does Snail act to repress Na,K-ATPase {beta}1-subunit expression? Na,K-ATPase {beta}1-subunit expression is up-regulated by glucocorticoids (Taormino and Fambrough, 1990Go; Liu and Gick, 1992Go; Derfoul et al., 1998Go; Devarajan and Benz, 2000Go). Functional GRE and MRE responsive elements in the {beta}1-subunit promoter have been characterized (Derfoul et al., 1998Go). Although glucocorticoids can up-regulate expression of the {beta}1-subunit in a tissue-specific manner (Derfoul et al., 1998Go), whether these factors are necessary to maintain the expression of {beta}1-subunit in epithelial cells is not known. However, reduced {beta}1-subunit levels and reduced promoter activity in various Snail-overexpressing carcinoma cell lines suggest that Snail is involved in the down-regulation of {beta}1-subunit in a variety of carcinoma. Quenching is a form of gene regulation in which repressors and activators cooccupy flanking regions in the promoter with the repressor either preventing the activator from interacting with the transcription factor complex or masking the latter's activation surfaces (Hemavathy et al., 2000Go). It is possible that Snail could prevent factors necessary for the transcription of {beta}1-subunit such as the mineralcorticoid and glucocorticoid receptors and their coactivators from binding to the promoter and hindering transactivation of the {beta}1-subunit. Moreover, Snail may reduce Na,K-ATPase {beta}1-subunit promoter activity by inhibiting activators that interact with the GC-rich proximal region of the CCAAT box. Future studies are necessary to understand the mechanism of {beta}1-subunit transcriptional regulation in normal epithelial cells and its repression in carcinoma. Although our studies demonstrate that the {beta}1-subunit expression is suppressed by Snail, whether Snail is also involved in the regulation of the {beta}2 and {beta}3 isoforms remains to be investigated.

Reduced Na,K-ATPase {beta}1-subunit expression in poorly differentiated carcinoma cell lines and its down-regulation by Snail is consistent with a role for the Na,K-ATPase in the conversion of the epithelial cells to mesenchymal cells that occur during epithelial to mesenchymal transition (EMT). EMT is a physiological process that occurs during embryonic development, and this process has been found to be involved in cancer development as well (Savagner, 2001Go). During both of these processes, epithelial cells dissociate and migrate to reach different locations due to their increased cell motility. Down-regulation of E-cadherin by Snail facilitates increased motility of cells undergoing EMT. We have shown that {beta}1-subunit expression alone in MSVMDCK cells significantly reduced their motility and when coexpressed with E-cadherin, the motility was even further reduced. Moreover, Na,K-ATPase {beta}1-subunit suppresses cell motility in a Rac1-dependent manner in MSV-MDCK cells (Barwe, Anilkumar, Moon, Zheng, Rajasekaran and Rajasekaran, unpublished data). These results demonstrated that the {beta}1-subunit of Na,K-ATPase is also involved in the suppression of cell motility in epithelial cells (Rajasekaran et al., 2001bGo). Coordinate down-regulation of Na,K-ATPase {beta}1-subunit and E-cadherin by Snail in carcinoma cells is consistent with the hypothesis that the reduced expression of both these proteins might be involved in increased motility of cells undergoing EMT. Experiments are in progress in our laboratory to further understand the role of Na,K-ATPase in EMT.


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We gratefully acknowledge Drs. Jerry Lingrel and Gerald Litwack for providing the {beta}1-subunit promoter constructs. We thank Dr. William James Ball Jr. for providing antibodies against Na,K-ATPase {alpha}- and {beta}-subunit. We are grateful to Dr. Eric Fearon for pPGS-Snail and pPGS vectors. We thank Connie Chang for technical assistance, Kan Lu for advice on RT-PCR, Minh Thai for help with retroviral transduction, and members of the Rajasekaran laboratory for helpful advice. This work was supported by DK56216 (A.K.R.), NCI1F31CA 93084-01 (C.E.E.), and National Research Service Award T32CA09056 (S.A.R.). A.K.R. is a member of the Jonsson Comprehensive Cancer Center and Molecular Biology Institute at UCLA.


    Footnotes
 
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E03-09-0646. Article and publication date are available at www.molbiolcell.org/cgi/doi/10.1091/mbc.E03-09-0646.

Abbreviations used: EMSA, electrophoretic mobility shift assay; EMT, epithelial to mesenchymal transition; MDCK, Madin-Darby Canine kidney; MSV-MDCK, Moloney Sarcoma Virus-transformed MDCK; MRE/GREs, mineralcorticoid/glucocorticoid responsive elements; RNAi, RNA interference; RT-PCR, reverse transcription-polymerase chain reaction.

{ddagger} Corresponding author. E-mail address: arajasekaran{at}mednet.ucla.edu.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Abbott, A., and Ball, W.J., Jr. (1993). The epitope for the inhibitory antibody M7-PB-E9 contains Ser-646 and Asp-652 of the sheep Na+, K(+)-ATPase alpha-subunit. Biochemistry 32, 3511-3518.[CrossRef][Medline]

Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J., and Garcia De Herreros, A. (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat. Cell Biol. 2, 84-89.[CrossRef][Medline]

Beguin, P., Wang, X., Firsov, D., Puoti, A., Claeys, D., Horisberger, J.D., and Geering, K. (1997). The gamma subunit is a specific component of the Na, K-ATPase and modulates its transport function. EMBO J. 16, 4250-4260.[CrossRef][Medline]

Behrens, J., Mareel, M.M., Van Roy, F.M., and Birchmeier, W. (1989). Dissecting tumor cell invasion: epithelial cells acquire invasive properties after the loss of uvomorulin-mediated cell-cell adhesion. J. Cell Biol. 108, 2435-2447.[Abstract/Free Full Text]

Blanco, G., Melton, R.J., Sanchez, G., and Mercer, R.W. (1999). Functional characterization of a testes-specific alpha-subunit isoform of the sodium/potassium adenosinetriphosphatase. Biochemistry 38, 13661-13669.[CrossRef][Medline]

Cano, A., Perez-Moreno, M.A., Rodrigo, I., Locascio, A., Blanco, M.J., del Barrio, M.G., Portillo, F., and Nieto, M.A. (2000). The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol. 2, 76-83.[CrossRef][Medline]

Chow, D.C., and Forte, J.G. (1995). Functional significance of the beta-subunit for heterodimeric P-type ATPases. J. Exp. Biol. 198, 1-17.[Abstract]

Comijn, J., Berx, G., Vermassen, P., Verschueren, K., van Grunsven, L., Bruyneel, E., Mareel, M., Huylebroeck, D., and van Roy, F. (2001). The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol. Cell 7, 1267-1278.[CrossRef][Medline]

Derfoul, A., Robertson, N.M., Lingrel, J.B., Hall, D.J., and Litwack, G. (1998). Regulation of the human Na/K-ATPase beta1 gene promoter by mineralocorticoid and glucocorticoid receptors. J. Biol. Chem. 273, 20702-20711.[Abstract/Free Full Text]

Devarajan, P., and Benz, E.J., Jr. (2000). Translational regulation of Na-KATPase subunit mRNAs by glucocorticoids. Am. J. Physiol. 279, F1132-F1138.

Feng, J., Orlowski, J., and Lingrel, J.B. (1993). Identification of a functional thyroid hormone response element in the upstream flanking region of the human Na, K-ATPase beta 1 gene. Nucleic Acids Res. 21, 2619-2626.[Abstract/Free Full Text]

Fuse, N., Hirose, S., and Hayashi, S. (1994). Diploidy of Drosophila imaginal cells is maintained by a transcriptional repressor encoded by escargot. Genes Dev. 8, 2270-2281.[Abstract/Free Full Text]

Geering, K. (1990). Subunit assembly and functional maturation of Na, KATPase. J. Membr. Biol. 115, 109-121.[CrossRef][Medline]

Genova, J.L., and Fehon, R.G. (2003). Neuroglian, gliotactin, and the Na+/K+ ATPase are essential for septate junction function in Drosophila. J. Cell Biol. 161, 979-989.[Abstract/Free Full Text]

Gumbiner, B.M. (1996). Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84, 345-357.[CrossRef][Medline]

Hajra, K.M., Chen, D.Y., and Fearon, E.R. (2002). The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 62, 1613-1618.[Abstract/Free Full Text]

Hay, E.D. (1995). An overview of epithelio-mesenchymal transformation. Acta Anat. 154, 8-20.[Medline]

Hay, E.D., and Zuk, A. (1995). Transformations between epithelium and mesenchyme: normal, pathological, and experimentally induced. Am. J. Kidney Dis. 26, 678-690.[Medline]

Hemavathy, K., Ashraf, S.I., and Ip, Y.T. (2000). Snail/slug family of repressors: slowly going into the fast lane of development and cancer. Gene 257, 1-12.[CrossRef][Medline]

Inukai, T., Inoue, A., Kurosawa, H., Goi, K., Shinjyo, T., Ozawa, K., Mao, M., Inaba, T., and Look, A.T. (1999). SLUG, a ces-1-related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Mol. Cell 4, 343-352.[CrossRef][Medline]

Jiao, W., Miyazaki, K., and Kitajima, Y. (2002). Inverse correlation between E-cadherin and Snail expression in hepatocellular carcinoma cell lines in vitro and in vivo. Br. J. Cancer 86, 98-101.[CrossRef][Medline]

Kataoka, H., Murayama, T., Yokode, M., Mori, S., Sano, H., Ozaki, H., Yokota, Y., Nishikawa, S., and Kita, T. (2000). A novel snail-related transcription factor Smuc regulates basic helix-loop-helix transcription factor activities via specific E-box motifs. Nucleic Acids Res. 28, 626-633.[Abstract/Free Full Text]

LaBonne, C., and Bronner-Fraser, M. (2000). Snail-related transcriptional repressors are required in Xenopus for both the induction of the neural crest and its subsequent migration. Dev. Biol. 221, 195-205.[CrossRef][Medline]

Lambrecht, N., Corbett, Z., Bayle, D., Karlish, S.J., and Sachs, G. (1998). Identification of the site of inhibition by omeprazole of a alpha-beta fusion protein of the H,K-ATPase using site-directed mutagenesis. J. Biol. Chem. 273, 13719-13728.[Abstract/Free Full Text]

Lilien, J., Balsamo, J., Arregui, C., and Xu, G. (2002). Turn-off, drop-out: functional state switching of cadherins. Dev. Dyn. 224, 18-29.[CrossRef][Medline]

Lingrel, J.B., Van Huysse, J., O'Brien, W., Jewell-Motz, E., Askew, R., and Schultheis, P. (1994). Structure-function studies of the Na, K-ATPase. Kidney Int. Suppl. 44, S32-S39.[Medline]

Liu, B., and Gick, G. (1992). Characterization of the 5' flanking region of the rat Na+/K(+)-ATPase beta 1 subunit gene. Biochim. Biophys. Acta 1130, 336-338.[Medline]

Masszi, A., Di Ciano, C., Sirokmany, G., Arthur, W.T., Rotstein, O.D., Wang, J., McCulloch, C.A., Rosivall, L., Mucsi, I., and Kapus, A. (2003). Central role for Rho in TGF-beta1-induced alpha-smooth muscle actin expression during epithelial-mesenchymal transition. Am. J. Physiol. 284, F911-F924.

Matsukawa, T., Inoue, Y., Oishi, Y., Kato, H., and Noguchi, T. (2001). Up-regulation of upstream stimulatory factors by protein malnutrition and its possible role in regulation of the IGF-binding protein-1 gene. Endocrinology 142, 4643-4651.[Abstract/Free Full Text]

Mauhin, V., Lutz, Y., Dennefeld, C., and Alberga, A. (1993). Definition of the DNA-binding site repertoire for the Drosophila transcription factor SNAIL. Nucleic Acids Res. 21, 3951-3957.[Abstract/Free Full Text]

Mayor, R., Guerrero, N., Young, R.M., Gomez-Skarmeta, J.L., and Cuellar, C. (2000). A novel function for the Xslug gene: control of dorsal mesendoderm development by repressing BMP-4. Mech. Dev. 97, 47-56.[CrossRef][Medline]

McDonough, A.A., Geering, K., and Farley, R.A. (1990). The sodium pump needs its beta subunit. FASEB J. 4, 1598-1605.[Abstract]

Mobasheri, A., Avila, J., Cozar-Castellano, I., Brownleader, M.D., Trevan, M., Francis, M.J., Lamb, J.F., and Martin-Vasallo, P. (2000). Na+, K+-ATPase isozyme diversity; comparative biochemistry and physiological implications of novel functional interactions. Biosci. Rep. 20, 51-91.[CrossRef][Medline]

Nakayama, H., Scott, I.C., and Cross, J.C. (1998). The transition to endoreduplication in trophoblast giant cells is regulated by the mSNA zinc finger transcription factor. Dev. Biol. 199, 150-163.[CrossRef][Medline]

Nieto, M.A. (2002). The snail superfamily of zinc-finger transcription factors. Nat. Rev. Mol. Cell Biol. 3, 155-166.[CrossRef][Medline]

Noguchi, S., Higashi, K., and Kawamura, M. (1990a). Assembly of the alpha-subunit of Torpedo californica Na+/K(+)-ATPase with its pre-existing beta-subunit in Xenopus oocytes. Biochim. Biophys. Acta 1023, 247-253.[Medline]

Noguchi, S., Higashi, K., and Kawamura, M. (1990b). [A possible role of the beta subunit of (Na, K)ATPase on the biogenesis of the enzyme]. J. Uoeh. 12, 67-75.[Medline]

Paul, S.M., Ternet, M., Salvaterra, P.M., and Beitel, G.J. (2003). The Na+/K+ ATPase is required for septate junction function and epithelial tube-size control in the Drosophila tracheal system. Development 130, 4963-4974.[Abstract/Free Full Text]

Poser, I., Dominguez, D., de Herreros, A.G., Varnai, A., Buettner, R., and Bosserhoff, A.K. (2001). Loss of E-cadherin expression in melanoma cells involves up-regulation of the transcriptional repressor Snail. J. Biol. Chem. 276, 24661-24666.[Abstract/Free Full Text]

Rajasekaran, A.K., Hojo, M., Huima, T., and Rodriguez-Boulan, E. (1996). Catenins and zonula occludens-1 form a complex during early stages in the assembly of tight junctions. J. Cell Biol. 132, 451-463.[Abstract/Free Full Text]

Rajasekaran, A.K., and Rajasekaran, S.A. (2003). Role of Na-K-ATPase in the assembly of tight junctions. Am. J. Physiol. 285, F388-F396.

Rajasekaran, S.A., Ball, W.J., Jr., Bander, N.H., Liu, H., Pardee, J.D., and Rajasekaran, A.K. (1999). Reduced expression of beta-subunit of Na, K-ATPase in human clear-cell renal cell carcinoma. J. Urol. 162, 574-580.[CrossRef][Medline]

Rajasekaran, S.A., Hu, J., Gopal, J., Gallemore, R., Ryazantsev, S., Bok, D., and Rajasekaran, A.K. (2003). Na, K-ATPase inhibition alters tight junction structure and permeability in human retinal pigment epithelial cells. Am. J. Physiol. 284, C1497-C1507.

Rajasekaran, S.A., Palmer, L.G., Moon, S.Y., Peralta Soler, A., Apodaca, G.L., Harper, J.F., Zheng, Y., and Rajasekaran, A.K. (2001a). Na, K-ATPase activity is required for formation of tight junctions, desmosomes, and induction of polarity in epithelial cells. Mol. Biol. Cell 12, 3717-3732.[Abstract/Free Full Text]

Rajasekaran, S.A., Palmer, L.G., Quan, K., Harper, J.F., Ball, W.J., Jr., Bander, N.H., Peralta Soler, A., and Rajasekaran, A.K. (2001b). Na, K-ATPase beta-subunit is required for epithelial polarization, suppression of invasion, and cell motility. Mol. Biol. Cell 12, 279-295.[Abstract/Free Full Text]

Rodriguez-Boulan, E., and Nelson, W.J. (1989). Morphogenesis of the polarized epithelial cell phenotype. Science 245, 718-725.[Abstract/Free Full Text]

Savagner, P. (2001). Leaving the neighborhood: molecular mechanisms involved during epithelial-mesenchymal transition. Bioessays 23, 912-923.[CrossRef][Medline]

Shamraj, O.I., and Lingrel, J.B. (1994). A putative fourth Na+, K(+)-ATPase alpha-subunit gene is expressed in test