Molecular Biology of the Cell click for ASCB 2009 Annual Meeting page

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Originally published as MBC in Press, 10.1091/mbc.E03-02-0114 on January 12, 2004

Vol. 15, Issue 3, 1436-1444, March 2004

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E03-02-0114v1
15/3/1436    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wadskog, I.
Right arrow Articles by Adler, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wadskog, I.
Right arrow Articles by Adler, L.

Yeast Lacking the SRO7/SOP1-encoded Tumor Suppressor Homologue Show Increased Susceptibility to Apoptosis-like Cell Death on Exposure to NaCl Stress

Ingrid Wadskog *, Corinna Maldener {dagger}, Astrid Proksch {dagger}, Frank Madeo {dagger}, and Lennart Adler * {ddagger}

* Department of Cell and Molecular Biology/Microbiology, Göteborg University, SE-40530 Göteborg, Sweden; {dagger} Institute of Physiological Chemistry, University of Tübingen, 720 76 Tübingen, Germany

Submitted February 26, 2003; Revised November 13, 2003; Accepted November 13, 2003
Monitoring Editor: Thomas Fox


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Yeast cells deleted for the SRO7/SOP1 encoded tumor suppressor homologue show increased sensitivity to NaCl stress. On exposure to growth-inhibiting NaCl concentrations, sro7{Delta} mutants display a rapid loss in viability that is associated with markers of apoptosis: accumulation of reactive oxygen species, DNA breakage, and nuclear fragmentation. Additional deletion of the yeast metacaspase gene YCA1 prevents the primary fast drop in viability and diminishes nuclear fragmentation and DNA breakage. We also observed that NaCl induced loss in viability of wild-type cells is Yca1p dependent. However, a yeast strain deleted for both SRO7 and its homologue SRO77 exhibits NaCl-induced cell death that is independent on YCA1. Likewise, sro77{Delta} single mutants do not survive better after additional deletion of the YCA1 gene, and both sro77{Delta} and sro77{Delta}yca1{Delta} mutants display apoptotic characteristics when exposed to growth-inhibiting salinity, suggesting that yeast possesses Yca1p-independent pathway(s) for apoptosis-like cell death. The activity of Yca1p increases with increasing NaCl stress and sro7{Delta} mutants achieve levels that are higher than in wild-type cells. However, mutants lacking SRO77 do not enhance caspase activity when subject to NaCl stress, suggesting that Sro7p and Sro77p exert opposing effects on the cellular activity of Yca1p.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
The physiological cell death process of apoptosis is a morphologically distinct form of cellular suicide (Kerr, 2002Go), designed to remove potentially threatening or undesired cells (Vaux and Korsmeyer, 1999Go; Beers and McDowell, 2001Go). In animal cells, apoptosis occurs in an ordered series of event and is associated with activation of the programmed cell death machinery (Wyllie et al., 1980Go; Joza et al., 2002Go). Inappropriate regulation of apoptosis is linked to the pathogenesis of many human diseases, such as AIDS, cancer, autoimmune, and neurodegenerative disorders (Uren and Vaux, 1996Go). The process of programmed cell death can be triggered by a vast array of stimuli, and a complex network of regulators and effectors coordinates the process (Beers and McDowell, 2001Go; Joza et al., 2002Go). At the end of almost all apoptotic scenarios, a constellation of morphological characteristics emerge, including chromatin condensation, DNA fragmentation, flipping of phosphatidylserine to the outer leaflet of the plasma membrane, and breakage of the cells to small membrane-enclosed vesicles, so called apoptotic bodies (Wyllie et al., 1980Go). These structural features constitute the cytological hallmarks of apoptosis.

The finding that cellular suicide occurs in most, if not all, multicellular organisms raises the question on how the mechanisms of apoptosis have evolved. Do these mechanisms have a common origin and have these processes first evolved in single-celled organisms? For unicellular organisms exposed to harsh conditions, cellular suicide may serve to propagate the genome to future generations if some of the members of a population are sacrificed to promote survival of others (Engelberg-Kulka and Glaser, 1999Go; Matsuyama et al., 1999Go; Fröhlich and Madeo, 2000Go). In Saccharomyces cerevisiae, apoptosis-like cell death was first described for a temperature-sensitive cdc48 mutant (Madeo et al., 1997Go). Cdc48p is involved in vesicle fusion associated with secretion and cell division (Latterich et al., 1995Go). At nonpermissive temperature, the cdc48 mutant exhibited typical apoptotic markers, i.e., exposition of phosphatidylserine, DNA fragmentation, and chromatin condensation (Madeo et al., 1997Go). It has also become increasingly clear that there is a connection between ageing and apoptosis-like cell death in yeast, as evidenced by the presence of apoptotic markers in old yeast cells (Fröhlich and Madeo, 2001Go; Laun et al., 2001Go). Still, there are arguments against a mechanistic and functional conservation between yeast and mammals, because the yeast genome does not encode obvious homologues to any of the core apoptotic machinery proteins, e.g., the Bcl-2/Bax family of proteins or the caspase family. However, recently, a metacaspase called yeast caspase-1 (Yca1p) was identified in S. cerevisiae, and this protein was required for H2O2 or aging-induced apoptosis in yeast (Madeo et al., 2002Go). The yeast metacaspase has also been shown to be involved in a telomer-initiated apoptotic pathway that exhibits conserved features with that reported for mammalian cells (Qi et al., 2003Go). In another recent article, Severin and Hyman (2002Go) presented evidence that apoptosis in yeast can be induced by a factor that is produced by the yeast cells themselves: the {alpha}-factor mating pheromone. The data presented indicate that this mechanism might have evolved to remove cells that fail to mate, suggesting a highly sophisticated death machinery in yeast.

Recently, evidence has also been presented that exposure of yeast to high salinity induces apoptosis (Huh et al., 2002Go). Several observations suggested that the death was induced by intracellular ion disequilibria rather than by osmotic imbalance. For example, ectopic expression of the antiapoptotic protein Bcl-2 enhanced NaCl tolerance of wild-type cells and a calcineurin-defective cnb1{Delta} mutant that is defective for ion homeostasis (Huh et al., 2002Go). However, overexpression of Bcl-2 did not suppress the salt-sensitive phenotype of a yeast hog1{Delta} mutant, which has decreased capacity to osmoregulate, but seems to maintain ion homeostasis. We have observed that deletion of the SOP1/SRO7 gene (hereafter referred to as SRO7) brings about increased sensitivity to NaCl stress and a defective intracellular ion homeostasis (Larsson et al., 1998Go). SRO7 is a yeast homologue of the Drosophila l(2)gl tumor suppressor gene. This gene is required for development of epithelial cell polarity (Bilder et al., 2000Go), and mutations in l(2)gl leads to formation of epithelial derived tumors in fly larvae (Gateff, 1978Go). The l(2)gl gene is also required for the development of cell polarity associated with asymmetric cell division of neuroblasts (Ohshiro et al., 2000Go; Peng et al., 2000Go), and the defective polarity acquisition in l(2)gl mutants may give rise to the neoplastic transformation of optic neuroblasts observed in mutant larvae (Gateff, 1978Go). The salt-sensitive phenotype of the yeast sro7{Delta} mutant results from defective targeting of the ENA1 encoded sodium extruding ATPase to the plasma membrane (Wadskog, 2003Go). Instead, Ena1p is delivered to the vacuole where it is degraded. Deletion of SRO7 together with its iso-gene SRO77 results in hypersensitivity to NaCl stress (Larsson et al., 1998Go), and a cold-sensitive phenotype (Lehman et al., 1999Go). At nonpermissive temperature, the sro7{Delta}sro77{Delta} mutant shows defective secretion and accumulation of post-Golgi vesicles (Lehman et al., 1999Go). In agreement with these phenotypes, the Sro proteins have been shown to interact physically with Sec9p, a target-soluble N-ethylmaleimide-sensitive factor attachment receptor (t-SNARE) protein for vesicle fusion at the plasma membrane (Lehman et al., 1999Go). SRO7 also shows genetic interaction with temperature-sensitive alleles of genes for the exocyst complex (Lehman et al., 1999Go; Wadskog, 2003Go). Together, these results suggest that the l(2)gl family of proteins assists in the targeting of vesicles to the correct polar destinations in the plasma membrane.

Here, we report the involvement of SRO7 and SRO77 in apoptosis-like cell death in yeast. The studies were initiated for several reasons. First, the two phenotypes associated with sro mutants, salt sensitivity and secretion defects, have both been previously linked to apoptosis in yeast (Madeo et al., 1997Go; Huh et al., 2002Go). Second, most of the known tumor suppressor genes are involved in signaling that lead either to cell cycle arrest or apoptosis (Wyllie et al., 1999Go). Finally, two-hybrid screens have indicated physical interactions between Sro77p and the yeast metacaspase Yca1p (Uetz et al., 2000Go).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Yeast Strains and Growth Media
Yeast strains used in this study are listed in Table 1. Rich YPD medium (2% glucose) was used for growth and survival assays, whereas minimal YNB media (2% glucose) plus essential amino acids were used for selective growth. For salt stress conditions, YPD containing 2 M NaCl was added to yeast cultures to obtain final NaCl concentrations.


View this table:
[in this window]
[in a new window]
 
Table 1. Yeast strains used in the present study

 

The yca1{Delta}sro7{Delta} mutant was constructed using the sro7::LEU2 deletion cassette in pBluescriptKS+ (Larsson et al., 1998Go). The plasmid was cut with restriction enzymes HindIII and Notl (Roche Diagnostics, Mannheim, Germany) and the ycal{Delta} mutant transformed with the sro7::LEU2 fragment of 3.5-kb subsequent to gel purification (QIAquick gel extraction kit; QIAGEN, Hilden, Germany). Transformants were selected on YNB medium lacking leucine and subsequently verified by polymerase chain reaction (PCR), by using PCR primers upstream and downstream of the LEU2 insert. The yca1{Delta}sro77{Delta} mutant was constructed as follows: PCR was used to amplify the sro77{Delta}::HIS3 fragment of strain WKL-3A (Larsson et al., 1998Go) by using SRO77 forward primer TTCCGCTTCATAGGAGGAGA (300 base pairs upstream of START codon) and SRO77 backward primer ACGGTTCATCATTCGGAAAA (350 base pairs downstream of STOP codon). PCR products were purified (QIAquick PCR purification kit; QIAGEN) and used to transform the yca1{Delta} mutant. Transformants were selected on YNB plates lacking histidine and verified by PCR by using primers that bind upstream and downstream of the primers used to amplify the sro77{Delta}::HIS3 fragment. The yca1{Delta}sro7{Delta}sro77{Delta} strain was constructed by transforming the yca1{Delta}sro7{Delta}strain with the sro77::HIS3 fragment described previously. Transformants were selected and verified correspondingly. To construct the BY sro7{Delta} sro77{Delta} strain BY sro7{Delta} Mat a was crossed with BY sro77{Delta} Mat {alpha}. Tetrads were analyzed and potential double mutants checked by PCR. PCR was performed using SRO7 and SRO77 verification primers described above plus additional primers binding within the kanamycin gene.

Growth and Survival Tests
Growth was monitored by plate assays. Yeast strains were grown overnight in YPD medium, adjusted to identical OD610 and diluted 100, 10-1, 10-2, 10-3, and 10-4. Each dilution was spotted in aliquots of 5 µl onto YPD plates with or without NaCl supplementation. For cell survival experiments, yeast cells were grown until they reached exponential phase. NaCl was added to the desired concentration, and samples containing a defined number of cells were plated onto YPD plates after various periods of salt exposure. The number of cells was determined (~20 cells/µl, 1:1000 dilution) for each culture by using a Helber counting chamber and a total of 600 cells, divided into three aliquots, were spread onto YPD plates. The number of surviving colonies was determined after 2 d of incubation at 30°C.

Cytological Analysis
For determination of reactive oxygen species (ROS) accumulation, cells were grown into exponential phase (OD610 ~0.5) and exposed to NaCl for l h. Dihydrorhodamine 123 (Sigma-Aldrich, St. Louis, MO) was added (5 µg/ml cell culture) and cultivation continued for another 2 h. Stained cells were viewed using a Leica DMRXA fluorescence microscope equipped with a rhodamine optical filter. To determine the frequency of stained cells, at least 500 cells of three independent experiments were evaluated.

Analysis of nuclear fragmentation (4,6-diamidino-2-phenylindole [DAPI] staining) and DNA strand breaks (terminal deoxynucleotidyl transferase dUTP nick-end labeling [TUNEL] analysis) was performed on fixed cells. Exponentially growing cells were fixed by the addition of 1:10 volumes of formaldehyde (leading to a final concentration of 3.7%) followed by incubation for 1 h in 30°C. The cells were washed twice in apoptosis buffer 1 (35 mM potassium phosphate and 0.5 mM MgC12, pH 6.8), resuspended in apoptosis buffer 2 (apoptosis buffer 1 + 1.2 M sorbitol), and treated with lyticase (50 U/ml) for 30 min at 30°C. After careful washing in apoptosis buffer 2 sphaeroplasts were bound on poly-lysine-coated slides. For DAPI staining, cells were incubated with diaminophenylindole (1 µg/ml; Sigma-Aldrich) for 2 min, washed twice with apoptosis buffer 2, and examined under a Leica DMRXA fluorescence microscope. TUNEL analysis was performed as described previously (Madeo et al., 1997Go, 1999Go).

Caspase Activity Measurements
Caspase activity was measured by using fluorescein isothiocyanate (FITC)VAD-fmk (CaspACE; Promega, Madison, WI), which binds at the catalytic center of active caspases. NaCl was added to stationary overnight cultures of wild-type and yca1{Delta} cells at various concentration, and the cultures were incubated for 1 or 4 h at 28°C. After incubation, cells were harvested (5 x 106 cells, washed in 1 ml phosphate-buffered saline, and stained for 20 min in 200 µl FITC-VAD-fmk diluted 1:1000 in the same buffer. For flow cytometric analysis, stained cells were counted using FACSCalibur (BD Biosciences, San Jose, CA) and CellQuest analysis software with excitation and emission settings of 488 nm and 525-550 nm (filter FL1), respectively.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
NaCl Stress Reduces Survival of sro7{Delta} and sro7{Delta}sro77{Delta} Mutants and Induces Intracellular Accumulation of Reactive Oxygen Species
Survival tests demonstrated that sro7{Delta} and sro7{Delta}sro77{Delta} mutants are highly sensitive to NaCl stress. Already, a 10-min exposure to 0.7 M NaCl killed ~30% of either population (Figure 1A), and <5% remained viable after 6 h. Equivalent treatment of wild-type cells resulted in <5% loss in viability. These results demonstrate that sro7{Delta} and sro7{Delta}sro77{Delta} mutants not only exhibit reduced ability to grow at moderate salt stress, as has been reported previously (Larsson et al., 1998Go) but also that the cells are actually killed by the stress. The observations prompted us to analyze the cells for the presence of ROS, which are considered a key stimulus for celldeathbyapoptosis(Madeoet al.,1999Go).Usingdihydrorhodamine 123 as ROS indicator, accumulation of ROS was observed in ~60% of sro7{Delta} or sro7{Delta}sro77{Delta} mutants exposed to 0.8 M NaCl (Figure 1, C and D). Control wild-type cells showed little dihydrorhodamine staining, even when exposed to 1 M NaCl (Figure 1D). At lower salinities (0.4 and 0.6 M NaCl), the proportion of stained sro7{Delta} cells decreased to become about one-half of that of the sro7{Delta}sro77{Delta} mutants. In agreement with this pattern the double mutant is more efficiently killed by moderate salt stress than the sro7{Delta} single mutant (Figure 1B). We also examined ROS mediated staining of two other yeast mutants, gpd1{Delta} and ckb1{Delta}, that exhibit a salt-sensitive growth phenotype similar to that of sro7{Delta}. Interestingly, the accumulation of ROS in the gpd1{Delta} and the ckb1{Delta} mutants remained similar to that of wild-type cells, even at 1 M NaCl (Figure 1D).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Cells lacking SRO7 accumulate ROS and exhibit reduced survival in saline environments. (A) Survival of wild-type, sro7{Delta}, and sro7{Delta}sro77{Delta} mutants on exposure to 0.7 M NaCl for various periods. Data represent the mean of four different experiments. Wild-type ({diamondsuit}), sro7{Delta} ({blacksquare}), and sro7{Delta}sro77{Delta} ({blacktriangleup}). Open symbols represent 0 M NaCl. (B) Survival of wild-type, sro7{Delta}, and sro7{Delta}sro77{Delta} mutants on exposure to 0.4 M NaCl for various periods. Data represent the mean of four different experiments. Wild-type ({diamondsuit}), sro7{Delta} ({blacksquare}), and sro7{Delta}sro77{Delta} ({blacktriangleup}). (C) Bright field (bottom row) and fluorescence (top row) photomicrographs of dihydrorhodamine 123 stained wild-type (Wt) and sro7{Delta} cells exposed to 0.8 M NaCl. (D) Diagram showing the percentage of dihydrorhodamine-stained cells of sro7{Delta}, sro7{Delta}sro77{Delta}, Wt, ckb1{Delta}, and gpd1{Delta} strains after exposure to various concentrations of NaCl. Each data bar is based on the evaluation of 500 cells in several independent experiments. For further details, see MATERIAL AND METHODS.

 

sro7{Delta} and sro7{Delta}sro77{Delta} Mutants Display Chromatin Condensation and DNA Fragmentation
Having established increased ROS occurrence in salt-stressed sro mutants, we wanted to examine the cells for nuclear fragmentation, a well-established cytological hallmark of apoptosis. For the sro7{Delta} mutant, cells with irregularly shaped and fragmented nuclei were evident 30 min after exposure to 0.7 M NaCl (Figure 2A). In contrast, virtually no cells of the similarly treated wild-type strain showed abnormal nuclei. After 1 h at 0.7 M NaCl, about one-half of the sro7{Delta} and sro7{Delta}sro77{Delta} mutants displayed fragmented nuclei (Figure 2B). At lower salinities, the proportion of aberrant nuclei decreased, and this tendency was, as expected, more pronounced for sro7{Delta} mutants than for sro7{Delta}sro77{Delta} mutants (our unpublished data). The salt-sensitive gpd1{Delta} and ckb1{Delta}, mutants showed little chromatin condensation and fragmentation on exposure to NaCl stress similar to wild-type cells (Figure 2B). These mutants show that sensitivity to NaCl is not generally associated with apoptotic features such as ROS accumulation (Figure 1D) and nuclear fragmentation.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. sro7{Delta} and sro7{Delta}sro77{Delta} mutants display fragmented nuclei and DNA strand breaks after NaCl treatment. (A) Photomicrograph of DAPI-stained wild-type (Wt), sro7{Delta}, and sro7{Delta}sro77{Delta} cells exposed to YPD containing 0.7 M NaCl for 1 h. (B) Percentage of wild-type (Wt), sro7{Delta}, sro7{Delta}sro77{Delta}, ckb1{Delta}, and gpd1{Delta} cells containing fragmented nuclei after 0 and 1 h in YPD containing 0.7 M NaCl. (C) TUNEL staining of wild-type, sro7{Delta}, and sro7{Delta}sro77{Delta} cells after 30 min of incubation in YPD containing 0.7 M NaCl. (D) Quantification of TUNEL-positive staining of wild-type (Wt), sro7{Delta}, and sro7{Delta}sro77{Delta} after 1-h exposure to 0.7 M NaCl.

 

Another familiar apoptotic feature is fragmentation of DNA in the nucleus. DNA strand breaks can be visualized by TUNEL tests, in which fluorescent nucleotides are added to the 3'-OH end of the DNA fragment, making the phenomenon visible by fluorescent microscopy. Both sro7{Delta} and sro7{Delta}sro77{Delta} mutants display TUNEL-positive nuclei after 30 min of exposure to 0.7 M NaCl (Figure 2C), whereas the nuclei of control wild-type cells remained unstained or only slightly stained. After 1 h at 0.7 M NaCl, about one-half of the sro7{Delta} and sro7{Delta}sro77{Delta} population showed a clear TUNEL-positive staining, whereas ~10% of the wild-type cells exhibited this characteristic (Figure 2D). We conclude that NaCl stress that does not markedly affect viability of wild-type cells, induces cell death in sro7{Delta} and sro7{Delta} sro77{Delta} mutants that bears the structural attributes of apoptosis with respect to ROS accumulation, nuclear fragmentation, and DNA strand breakage.

Yca1p Is Involved in the NaCl-induced Lethality of sro7{Delta} Mutants
To investigate whether the yeast metacaspase Yca1p has a role in NaCl-mediated cell death, we first examined whether salt stressed cells show increased caspase activity. To this end, cells were incubated with the FITC-labeled pan-caspase inhibitor VAD-fmk that binds to the active site of the caspase, allowing for flow cytometric determination of cells with active enzyme (Madeo et al., 2002Go). This assay revealed a significant increase in the proportion of cells with active caspase after exposure to NaCl stress for 4 h (Figure 3). Compared with nonstressed conditions, wild-type cells exposed to 1.0 M NaCl increase their caspase activity more than sevenfold. Cells lacking YCA1 exhibit basal level caspase activity both at 0 and 0.5 M NaCl, whereas a modest increase was apparent at 1 M NaCl. We next examined the involvement of Yca1p in the NaCl induced lethality by deleting the YCA1 gene in the sro7{Delta} background. If the salt sensitivity of the sro7{Delta} strain is caused by Yca1p-mediated cell death, the sro7{Delta}yca1{Delta} double mutant would display higher salt tolerance than the sro7{Delta} single mutant. This simple prediction was, however, not supported by testing serial dilutions for growth on YPD plates (Figure 4A), which showed that the sensitivity of sro7{Delta} mutants to 0.7 M NaCl is very similar to that of sro7{Delta}yca1{Delta} mutants. In fact, the two strains grew equally well at all NaCl concentrations tested, showing inhibited growth by salt concentrations of >=0.5 M NaCl (our unpublished data). Similar result was obtained with the sro7{Delta}sro77{Delta} double mutant. This mutant experience growth inhibition at >=0.2 M NaCl, and additional deletion of YCA1 did not improve NaCl tolerance as revealed by growth tests on YPD plates containing various salt concentrations (our unpublished data). However, similar growth inhibition in the presence of NaCl does not necessarily mean that the strains survive equally well on exposure to salt stress. Actually, there was a significant difference between the survival traits of sro7{Delta} and sro7{Delta}yca1{Delta} mutants (Figure 4B). The sro7{Delta} mutants exhibit an immediate decrease in viability after exposure to 0.7 M NaCl, leading to a rapid elimination of ~30% of the population. Similar stress exposure of the sro7{Delta}yca1{Delta} mutants resulted only in a slight decrease in cell viability (~5%). However, after the rapid phase of cell demise, the death rate for the sro7{Delta} population changed to a pace that was similar to that shown by the sro7{Delta} yca1{Delta} mutants (Figure 4B). These results suggest that Yca1p is required for the primary, fast drop in viability of the sro7{Delta} mutants. The better survival of the sro7{Delta} yca1{Delta} strain is consistent with markedly decreased DNA breakage (Figure 4, C and D). A similar tendency was apparent for the control yca1{Delta} and wild-type strains, although the salt concentration is too low to produce strong effects in these strains.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Salt-stressed cells exhibit increased caspase activity. (A) Caspase activity measurement by flow cytometric analysis of wild-type and yca1{Delta} mutant cells exposed to NaCl (0, 0.5, or 1.0 M) for 4 h. (B) Percentage of FITC-VAD-fmk-positive cells in fluorescence-activated cell sorting measurements of wild-type (Wt) and yca1{Delta} mutant strains exposed to different NaCl concentrations.

 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Rate of killing of sro7{Delta} cells after exposure to salt stress is YCA1 dependent, and the level of salt induced double stranded DNA breaks is reduced in the sro7{Delta}yca1{Delta} mutant. (A) Growth of sro7{Delta}, yca1{Delta}, and sro7{Delta}yca1{Delta} mutants at high salinity monitored by drop assays. Serial 10-fold dilutions of cell suspensions were spotted onto YPD medium with and without 0.7 M NaCl. (B) Survival curves for wild-type ({diamondsuit}), sro7{Delta} ({blacksquare}), yca1{Delta} ({blacktriangleup}), and sro7{Delta}yca1{Delta} (X) mutants after incubation with 0.7 M NaCl. Samples were taken after incubation with 0.7 M NaCl for various periods of time and plated onto YPD medium. Each data point is based the plating of 200 cells in three independent experiments. (C) Photographs of TUNEL staining showing DNA breakage in the sro7{Delta} mutant after 1 h of incubation in YPD medium containing 0.7 M NaCl. (D) Quantification of TUNEL-positive cells subsequent to 1 h 0.7 M NaCl exposure. To determine the frequency of TUNEL-positive cells, at least 1000 cells were evaluated for each strain and each condition.

 

Deletion of YCA1 Improves Survival of Wild-Type Cells but Has Little Effect on Survival of sro77{Delta} Mutants
Yca1p has previously been shown to mediate apoptosis-like cell death in aged yeast cells and in yeasts treated with H2O2 or acetic acid (Madeo et al., 2002Go). For example, cells lacking YCA1 survive high levels of H2O2 much longer than wild-type cells. Yca1p obviously also has a role in mediating demise of wild-type cells exposed to high salinity. About 50% of wild-type yeast survives exposure to 1.2 M NaCl for 4 h, whereas ~85% of the cells survives the same treatment if deleted for the YCA1 gene (Figure 5B). This observation agrees with the decreased DNA cleavage seen for the yca1{Delta} mutant (Figure 5, C and D). Hence, survival assays and caspase activity measurements demonstrate that the apoptotic-like response seen for wild-type cells during salt stress is strongly dependent on Yca1p activity.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 5. Survival at high salinity is YCA1dependent for wild-type cells but not for sro77{Delta} mutants. (A) Survival kinetics of sro7{Delta}sro77{Delta} and sro7{Delta}sro77{Delta}yca1{Delta} cells in YPD containing 0.4 M NaCl. (B) Survival of wild-type, yca1{Delta}, sro77{Delta}, and sro77{Delta}yca1{Delta} after incubation for 4 h in YPD containing 1.2 M NaCl. (C) Percentage of TUNEL-positive cells after 1-h exposure to 1.2 M NaCl. For quantification, at least 1000 cells were evaluated for each strain and each condition. (D) Photographs showing examples of TUNEL staining of wild-type (Wt), yca1{Delta}, sro77{Delta}, and sro77{Delta}yca1{Delta} cells before and after 1-h exposure to1.2 M NaCl. (E) Caspase activity, shown as percentage of FITC-VAD-positive cells by fluorescence-activated cell sorting analysis of wild-type, yca1{Delta}, sro7{Delta}, and sro77{Delta} strains, grown overnight, and exposed to NaCl stress for 1 h.

 

The sro77{Delta} mutants show a similar tolerance to 1.2 M NaCl as wild-type cells. Interestingly, however, deletion of YCA1 in sro77{Delta} background does not significantly improve the viability at high salinity, as it does for wild-type cells (Figure 5B). In accordance with these results, the sro7{Delta}sro77{Delta} and the sro7{Delta}sro77{Delta}yca1{Delta} mutants also display similar survival curves after exposure to 0.4 M NaCl (Figure 5A). The observation that NaCl induced lethality is independent of Yca1p in strains lacking SRO77, is in agreement with the finding that DNA breakage (Figure 5, C and D) and nuclear fragmentation (our unpublished data) is very similar for sro77{Delta} and sro77{Delta}yca1{Delta} cells. Similarly, nuclear fragmentation and the proportion of TUNEL-positive cells are very similar for NaCl exposed sro7{Delta}sro77{Delta} and the sro7{Delta}sro77{Delta}yca1{Delta} mutants (our unpublished data). These results imply a genetic interaction between SRO77 and YCA1, which encode proteins that have been previously shown to interact in two-hybrid screens (Uetz et al., 2000Go; Drees et al., 2001Go). To further study the effect of Sro7p and Sro77p on Yca1p, we examined the proportion of cells with active caspase in wild-type, yca1{Delta}, sro7{Delta}, and sro77{Delta} cultures exposed to NaCl stress for 1 h (Figure 5E). The observed caspase activity remained unaffected by salt stress in sro77{Delta} mutants, similar to what was noted for yca1{Delta} cells, whereas mutants lacking SRO7 exhibited a generally increased casapase activity, which consistently was kept higher than that of wild-type cells. These results indicate that Sro7p and Sro77p have opposing effects on Yca1p; Sro77p being required for the salt induced activation of Yca1p, whereas Sro7p seems to moderate the activity of the caspase. Furthermore, the observation that sro77{Delta}yca1{Delta} mutants show NaCl induced nuclear fragmentation and strong DNA strand breakage (Figure 5, C and D) suggests the existence of an Yca1p independent apoptotic pathway in yeast.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Exposed to Salt Stress, the sro7{Delta} Mutant Exhibits Hallmarks of Apoptosis
Cells committing active suicide by apoptosis are subject to a series of stereotyped morphological changes that differentiate apoptotic cells from healthy or necrotic cells (Webb et al., 1997Go; Kerr, 2002Go). The most typical structural changes occur within the nucleus, where chromatin condenses and aggregates along the margins of the nuclear membrane and DNA is degraded, first into large fragments and later into short oligomers of ~180-200 base pairs. Coincident with these changes are alterations of the nuclear structural framework leading to fragmentation of the nucleus. Here, we demonstrate NaCl-induced cell death associated with the typical nuclear features of apoptosis for yeast cells deleted for the tumor suppressor homologue SRO7. NaCl stress is one of the environmental factors that has been demonstrated previously to induce apoptosis-like cell death in yeast and plants (Katsuhara, 1997Go; Huh et al., 2002Go). Wild-type cells of S. cerevisiae were shown to exhibit apoptotic features after treatment with 1.2 M NaCl (Katsuhara, 1997Go; Huh et al., 2002Go). The sro7{Delta} mutant displays a similar response at NaCl concentrations beginning at 0.5 M NaCl. Because the inducing salinity correlates with the NaCl concentration for strong growth inhibition of each strain, a simple interpretation would be that severely growth-inhibiting concentrations suffice to initiate apoptosis-like cell death. In other words, the lack of SRO7 may simply lower the salt concentration needed for apoptotic induction. However, two other yeast mutants that display NaCl sensitivity similar to that of sro7{Delta}, namely, ckb1{Delta} (de Nadal et al., 1999Go) and gpd1{Delta} (Larsson et al., 1993Go; Albertyn et al., 1994Go), do not show nuclear fragmentation (Figure 2B) and do not seem to accumulate reactive oxygen species (Figure 1D) on exposure to growth preventing NaCl concentrations. The salt sensitivity of the gpd1{Delta} mutant is due to a defective production and intracellular accumulation of glycerol, the primary yeast osmoregulator (Larsson et al., 1993Go). The reason for the salt-sensitive phenotype of the ckb1{Delta} mutant, which lacks a functional casein kinase II, is less clear, although the mutant seems to maintain intracellular ion homeostasis under salt stress (de Nadal et al., 1999Go). Hence, the different display of apoptotic features in response to growth inhibiting NaCl concentrations by sro7{Delta} mutants, on the one hand, and gpd1{Delta} and ckb1{Delta} mutants on the other, reinforces the observations by Huh et al. (2002Go) that disruption of inorganic ion homeostasis seems to be the primary reason for salt-induced cell death of yeast cells. Due to the defective targeting and subsequent degradation of the Ena1p sodium transporter in sro7{Delta} mutants, these cells experience increased intracellular Na+/K+ ratios when exposed to NaCl stress (Larsson et al., 1998Go; Wadskog, 2003Go). The ENA1 gene encodes a P-type ATPase that uses ATP to drive sodium ions out of the cell, and this pump has a primary role in maintaining cation homeostasis in NaCl-stressed yeast (Haro et al., 1991Go; Wieland et al., 1995Go). Interestingly, expression of the ENA1 gene is subject to a highly complex regulation, being controlled by a number of distinct regulatory pathways (Serrano et al., 1999Go; Wadskog and Adler, 2003Go). It is tempting to speculate that this elaborate control of ENA1 expression reflects a strict need to fine-tune ion homeostasis to prevent creating an intracellular environment that favors the activation of a cell death program. An additional indication for a role of ENA1 in this context stems from the observation that the human antiapoptotic protein Bcl-2 promoted transcriptional activation of ENA1 when expressed in a salt-sensitive cnb1{Delta} mutant (Huh et al., 2002Go).

The Yca1p Metacaspase Promotes Salt-induced Cell Death
The YCA1 gene in S. cerevisiae encodes a metacaspase that is activated by H2O2 and aging and is required for apoptotic demise of yeast (Madeo et al., 2002Go). Yca1p undergoes proteolytic processing similar to mammalian caspases and cleaves petidyl-caspase substrates, giving direct support for the existence of a specific effector of apoptosis in yeast. To investigate whether the apoptotic traits of NaCl-exposed cells were dependent on Yca1p, we compared wild-type and sro7{Delta} mutants with the corresponding strains lacking YCA1. For wild-type cells, deletion of YCA1 significantly improved survival rate at high salinity (Figure 4B), which suggests a general role for Yca1p in salt-induced apoptosis. The marked increase in caspase activity of cells exposed to harsh NaCl stress (Figure 3) gives further support to this view. Two additional observations provide evidence that Yca1p serves as an effector of the salt-induced cell death in yeast. Yca1p was more strongly activated in the salt sensitive sro7{Delta} mutants than in the more tolerant wild-type cells (Figure 5E), and deletion of YCA1 markedly affected both survival rate and DNA cleavage of the NaCl stressed strains (Figures 4, B-D, and 5, B-D). These results suggest that Yca1p mediates an apoptosis-like cell death, which is rapid and efficient. However, only a fraction of the cells seems to be susceptible to the Yca1p-mediated cell death. The first dramatic decrease of cell viability of sro7{Delta} cells was followed by a more moderate rate of killing that seemed independent of Yca1p. This decrease in viability may result from a more general effect of Na+ toxicity on the sro7{Delta} mutant and explain why the sro7{Delta}yca1{Delta} mutant displays a salt-sensitive phenotype on plate assays.

Role of SRO7 and SRO77 in Apoptosis-like Cell Death
Because interactions between Sro77p and Yca1p are suggested by two-hybrid screens (Uetz et al., 2000Go; Drees et al., 2001Go), we wanted to investigate the role of SRO77 in salt-induced apoptosis-like cell death. Interestingly, deletion of YCA1 in sro7{Delta}sro77{Delta} or sro77{Delta} backgrounds did not improve viability on NaCl treatment (Figure 5, A and B), indicating that the function of Yca1p is dependent on SRO77. Indeed, our measurement of salt-induced Yca1p activation shows that the caspase activity does not increase in mutants lacking SRO77, but remains similar to that of cells having a deleted YCA1 gene. The SRO-encoded proteins have been implicated in a late step in exocytosis by their ability to physically interact with Sec9p, a t-soluble N-ethylmaleimide-sensitive factor attachment (t-SNARE) protein receptor involved in the fusion of post-Golgi vesicles with the plasma membrane (Lehman et al., 1999Go). Given the proposed role in vesicle targeting, the opposing consequences of loss of function of SRO7 and SRO77 on the susceptibility of yeast to NaCl-induced cell death, suggest that the exocytosis machinery might sensitively attune the responsiveness of the cells to the exogenous apoptotic stimuli. The observed hyperactivation of the caspase in sro7{Delta} strain (Figure 5E) and the fact that these mutants show signs of DNA strand breakage (Figure 2C), even before exposure to NaCl stress, indicates that loss of SRO7 promotes a generally increased disposition for apoptosis-like cell death. The precise mechanistic relationship between Yca1p and the Sro proteins remains, however, to be determined. Because both sro77{Delta}yca1{Delta} (Figure 5, C and D) and sro7{Delta}sro77{Delta}yca1{Delta} (our unpublished data) cells exhibit diagnostic markers of apoptosis when exposed to sufficiently high NaCl concentration, our findings also indicate the existence of a Yca1p-independent pathway(s) for cellular suicide in S. cerevisiae. This pathway(s) may be under negative control that is dependent on Sro77p.

Are There Links to the Function of the Authentic Tumor Suppressor?
Whether the observed sensitivity of sro7{Delta} and sro7{Delta}sro77{Delta} mutants to NaCl-induced cell death bears any relevance to tumor development in Drosophila larvae lacking the authentic tumor suppressor l(2)gl is as yet speculative. Homozygous l(2)gl mutants show phenotypes involving loss of epithelial cell polarity and neoplastic overgrowth of tissues (Wodarz, 2000Go). Recent studies have indicated that loss of epithelial cell polarity may confer increased susceptibility to apoptosis (Weaver et al., 2002Go). This sensitivity has been suggested to counterbalance the proliferative advantage that is associated with nonpolarized cells, thereby reducing the possibility for malignant transformation (Humbert et al., 2003Go). Interestingly, De Lorenzo et al. (1999Go) have reported that a mutant form of l(2)gl induces apoptosis of the germ line during oogenesis, indicating that a defective tumor suppressor may promote apoptosis. In most epithelial cells the Na+, K+ ATPase is selectively sorted to the basolateral membrane (Dunbar and Caplan, 2001Go). Whether l(2)gl mutants exhibit defective epithelial distribution of this sodium transporter and suffer from a consequent disruption of inorganic ion homeostasis remain to be determined. Additional studies of the relationship between ion homeostasis and epithelial tumor development/apoptosis may further our understanding of the signals controlling growth, survival, and death of cells.


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank Thomas Nyström for helpful discussions. This work was supported by grants from the Swedish Research Council and Magn. Bergvalls Stiftelse.


    Footnotes
 
Article published online ahead of print. Mol. Biol. Cell 10.1091/mbc.E03-02-0114. Article and publication date are available at www.molbiolcell.org/cgi/doi/10.1091/mbc.E03-02-0114.

{ddagger} Corresponding author. E-mail address: lennart.adler{at}gmm.gu.se.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Albertyn, J., Hohmann, S., Thevelein, J.M., and Prior, B.A. (1994). GPD1, which encodes glycerol-3-phosphate dehydrogenase is essential for growth under osmotic stress in Saccharomyces cerevisiae and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14, 4135-4144.[Abstract/Free Full Text]

Ansell, R., Granath, K., Hohmann, S., Thevelein, J., and Adler, L. (1997). The two isoenzymes for yeast NAD-dependent glycerol 3-phosphate dehydrogenase encoded by GPD1 and GPD2, have distinct roles in osmoadaption and redox regulation. EMBO J. 16, 2179-2187.[CrossRef][Medline]

Beers, E.P., and McDowell, J.M. (2001). Regulation and execution of programmed cell death in response to pathogens, stress and developmental cues. Curr. Opin. Plant Biol. 4, 561-567.[CrossRef][Medline]

Bilder, D., Li, M., and Perrimon, N. (2000). Cooperative regulation of cell polarity and growth by Drosophila tumor suppressors. Science 289, 113-116.[Abstract/Free Full Text]

De Lorenzo, C., Strand, D., and Mechler, B.M. (1999). Requirement of Drosophila I(2)gl function for survival of the germline cells and organization of the follicle cells in a columnar epithelium during oogenesis. Int. J. Dev. Biol. 43, 207-217.[Medline]

de Nadal, E., Calero, F., Ramos, J., and Arino, J. (1999). Biochemical and genetic analyses of the role of yeast casein kinase 2 in salt tolerance. J. Bacteriol. 181, 6456-6462.[Abstract/Free Full Text]

Drees, B.L., et al. (2001). A. protein interaction map for cell polarity development. J. Cell Biol. 154, 549-571.[Abstract/Free Full Text]

Dunbar, L.A., and Caplan, M.J. (2001). Ion pumps in polarized cells: sorting and regulation of the Na+, K+- and H+, K+-ATPases. J. Biol. Chem. 276, 29617-19620.[Abstract/Free Full Text]

Engelberg-Kulka, H., and Glaser, G. (1999). Addiction modules and programmed cell death and antideath in bacterial cultures. Annu. Rev. Microbiol. 53, 43-70.[CrossRef][Medline]

Fröhlich, K.U., and Madeo, F. (2000). Apoptosis in yeast - a monocellular organism exhibits altruistic behaviour. FEBS Lett. 473, 6-9.[CrossRef][Medline]

Fröhlich, K.U., and Madeo, F. (2001). Apoptosis in yeast: a new model for aging research. Exp. Gerontol. 37, 27-31.[CrossRef][Medline]

Gateff, E. (1978). Malignant neoplasms of genetic origin in Drosophila melanogaster. Science 200, 1448-1459.[Abstract/Free Full Text]

Haro, R., Garciadeblas, B., and Rodriguéz-Navarro, A. (1991). A novel P-type ATPase from yeast involved in sodium transport. FEBS Lett. 291, 189-191.[CrossRef][Medline]

Huh, G.H., Damsz, B., Matsumoto, T.K., Reddy, M.P., Rus, A.M., Ibeas, J.I., Narasimhan, M.L., Bressan, R.A., and Hasegawa, P.M. (2002). Salt causes ion disequilibrium-induced programmed cell death in yeast and plants. Plant J. 29, 649-659.[CrossRef][Medline]

Humbert, P., Russell, S., and Richardson, H. (2003). Dlg, Scribble and Lgl in cell polarity, cell proliferation and cancer. Bioessays 25, 542-553.[CrossRef][Medline]

Joza, N., Kroemer, G., and Penninger, J.M. (2002). Genetic analysis of the mammalian cell death machinery. Trends Genet. 18, 142-149.[CrossRef][Medline]

Katsuhara, M. (1997). Apoptosis like cell death in barley roots under salt stress. Plant Cell Physiol. 38, 1091-1093.[Abstract/Free Full Text]

Kerr, J.F. (2002). History of the events leading to the formulation of the apoptosis concept. Toxicology 181-182, 471-474.[CrossRef][Medline]

Larsson, K., Böhl, F., Sjöström, I., Akhtar, N., Strand, D., Mechler, B., Grabowski, R., and Adler, L. (1998). The Saccharomyces cerevisiae SOP1 and SOP2 genes, which act in cation homeostasis, can be functionally substituted by the Drosophila lethal(2)giant larvae tumor suppressor gene. J. Biol. Chem. 273, 33610-33618.[Abstract/Free Full Text]

Larsson, K., Eriksson, P., Ansell, R., and Adler, L. (1993). A gene encoding sn-glycerol 3-phosphate dehydrogenase (NAD+) complements an osmosensitive mutant of Saccharomyces cerevisiae. Mol. Microbiol. 10, 1101-1111.[CrossRef][Medline]

Latterich, M., Fröhlich, K.U., and Schekman, R. (1995). Membrane fusion and the cell cycle: Cdc48p participates in the fusion of ER membranes. Cell 82, 885-893.[CrossRef][Medline]

Laun, P., Pichova, A., Madeo, F., Fuchs, J., Ellinger, A., Kohlwein, S., Dawes, I., Fröhlich, K.U., and Breitenbach, M. (2001). Aged mother cells of Saccharomyces cerevisiae show markers of oxidative stress and apoptosis. Mol. Microbiol. 39, 1166-1173.[CrossRef][Medline]

Lehman, K., Rossi, G., Adamo, J.E., and Brennwald, P. (1999). Yeast homologues of tomosyn and lethal giant larvae function in exocytosis and are associated with the plasma membrane SNARE, Sec9. J. Cell Biol. 146, 125-140.[Abstract/Free Full Text]

Madeo, F., Fröhlich, E., and Fröhlich, K.U. (1997). A yeast mutant showing diagnostic markers of early and late apoptosis. J. Cell Biol. 139, 729-734.[Abstract/Free Full Text]

Madeo, F., Fröhlich, E., Ligr, M., Grey, M., Sigrist, S.J., Wolf, D.H., and Fröhlich, K.U. (1999). Oxygen stress: a regulator of apoptosis in yeast. J. Cell Biol. 145, 757-767.[Abstract/Free Full Text]

Madeo, F., et al. (2002). A caspase-related protease regulates apoptosis in yeast. Mol. Cell 9, 911-917.[CrossRef][Medline]

Matsuyama, S., Nouraini, S., and Reed, J.C. (1999). Yeast as a tool for apoptosis research. Curr. Opin. Microbiol. 2, 618-623.[CrossRef][Medline]

Ohshiro, T., Yagami, T., Zhang, C., and Matsuzaki, F. (2000). Role of cortical tumour-suppressor proteins in asymmetric division of Drosophila neuroblast. Nature 408, 593-596.[CrossRef][Medline]

Peng, C.Y., Manning, L., Albertson, R., and Doe, C.Q. (2000). The tumour-suppressor genes lgl and dlg regulate basal protein targeting in Drosophila neuroblasts. Nature 408, 596-600.[CrossRef][Medline]

Qi, H., Li, T.-K., Kuo, D., Nur-El-Kamal, A., and Li, L.F. (2003). Inactivation of Cdc13p triggers MEC1-dependent apoptotic signals in yeast. J. Biol. Chem. 278, 15136-15141.[Abstract/Free Full Text]

Serrano, R., et al. (1999). A glimpse of the mechanisms of ion homeostasis during salt stress. J. Exp. Bot. 50, 1023-1036.[Abstract]

Severin, F.F., and Hyman, A.A. (2002). Pheromone induces programmed cell death in S. cerevisiae. Curr. Biol. 12, R233-R235.[CrossRef][Medline]

Uetz, P., et al. (2000). A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 403, 623-627.[CrossRef][Medline]

Uren, A.G., and Vaux, D.L. (1996). Molecular and clinical aspects of apoptosis. Pharmacol. Ther. 72, 37-50.[CrossRef][Medline]

Wadskog, I., and Adler, L. (2003). Ion homeostasis in Saccharomyces cerevisiae under NaCl stress. In: S. Hohmann and P. Mager, eds. Topics in current genetics: yeast stress responses (vol. 1). Berlin, Springer-Verlag, 201-239.

Wadskog, I. (2003). Functional studies of the Sro yeast homologues of the Drosophila lethal(2) giant larvae tumor suppressor. [Ph.D. thesis]. Göteborg, Sweden: Götenborg University.

Vaux, D.L., and Korsmeyer, S.J. (1999). Cell death in development. Cell 96, 245-254.[CrossRef][Medline]

Weaver, V.M., Lelievre, S., Lakins, J.N., Chrenek, M.A., Jones, J.C., Giancotti, F., Werb, Z., and Bissell, M.J. (2002). beta4 Integrin-dependent formation of polarized three-dimensional architecture confers resistance to apoptosis in normal and malignant mammary epithelium. Cancer Cell 2, 205-216.[CrossRef][Medline]

Webb, S., Harrison, D.J., and Wyllie, A.H. (1997). Apoptosis: an overview of the process and its relevance in disease. Adv. Pharmacol. 41, 1-34.

Wieland, J., Nietsche, A.M., Strayle, J., Steiner, H., and Rudolph, H.K. (1995). The PMR2 gene cluster encodes functionally distinct isoforms of a putative Na+ pump in the yeast plasma membrane. EMBO J. 14, 3870-3882.[Medline]

Wodarz, A. (2000). Tumor suppressors: linking cell polarity and growth control. Curr. Biol. 10, R624-R626.[CrossRef][Medline]

Wyllie, A.H., et al. (1999). Apoptosis and carcinogenesis. Br. J. Cancer 80, 34-37.

Wyllie, A.H., Kerr, J.F., and Currie, A.R. (1980). Cell death: the significance of apoptosis. Int. Rev. Cytol. 68, 251-306.[Medline]




This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
R. Guerin, G. Arseneault, S. Dumont, and L. A. Rokeach
Calnexin Is Involved in Apoptosis Induced by Endoplasmic Reticulum Stress in the Fission Yeast
Mol. Biol. Cell, October 1, 2008; 19(10): 4404 - 4420.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Hauptmann and L. Lehle
Kex1 Protease Is Involved in Yeast Cell Death Induced by Defective N-Glycosylation, Acetic Acid, and Chronological Aging
J. Biol. Chem., July 4, 2008; 283(27): 19151 - 19163.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Q. Liang and B. Zhou
Copper and Manganese Induce Yeast Apoptosis via Different Pathways
Mol. Biol. Cell, December 1, 2007; 18(12): 4741 - 4749.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
Y. J. Lee, K. L. Hoe, and P. J. Maeng
Yeast Cells Lacking the CIT1-encoded Mitochondrial Citrate Synthase Are Hypersusceptible to Heat- or Aging-induced Apoptosis
Mol. Biol. Cell, September 1, 2007; 18(9): 3556 - 3567.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
I. Wadskog, A. Forsmark, G. Rossi, C. Konopka, M. Oyen, M. Goksor, H. Ronne, P. Brennwald, and L. Adler
The Yeast Tumor Suppressor Homologue Sro7p Is Required for Targeting of the Sodium Pumping ATPase to the Cell Surface
Mol. Biol. Cell, December 1, 2006; 17(12): 4988 - 5003.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
T. Ye, R. Garcia-Salcedo, J. Ramos, and S. Hohmann
Gis4, a New Component of the Ion Homeostasis System in the Yeast Saccharomyces cerevisiae.
Eukaryot. Cell, October 1, 2006; 5(10): 1611 - 1621.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G. F. Ribeiro, M. Corte-Real, and B. Johansson
Characterization of DNA Damage in Yeast Apoptosis Induced by Hydrogen Peroxide, Acetic Acid, and Hyperosmotic Shock
Mol. Biol. Cell, October 1, 2006; 17(10): 4584 - 4591.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
W. Li, L. Sun, Q. Liang, J. Wang, W. Mo, and B. Zhou
Yeast AMID Homologue Ndi1p Displays Respiration-restricted Apoptotic Activity and Is Involved in Chronological Aging
Mol. Biol. Cell, April 1, 2006; 17(4): 1802 - 1811.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. J. Helms, A. Ambit, P. Appleton, L. Tetley, G. H. Coombs, and J. C. Mottram
Bloodstream form Trypanosoma brucei depend upon multiple metacaspases associated with RAB11-positive endosomes
J. Cell Sci., March 15, 2006; 119(6): 1105 - 1117.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Weinberger, L. Ramachandran, L. Feng, K. Sharma, X. Sun, M. Marchetti, J. A. Huberman, and W. C. Burhans
Apoptosis in budding yeast caused by defects in initiation of DNA replication
J. Cell Sci., August 1, 2005; 118(15): 3543 - 3553.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Watanabe and E. Lam
Two Arabidopsis Metacaspases AtMCP1b and AtMCP2b Are Arginine/Lysine-specific Cysteine Proteases and Activate Apoptosis-like Cell Death in Yeast
J. Biol. Chem., April 15, 2005; 280(15): 14691 - 14699.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Qiu, J.-H. Yoon, and B. Shen
Search for Apoptotic Nucleases in Yeast: ROLE OF Tat-D NUCLEASE IN APOPTOTIC DNA DEGRADATION
J. Biol. Chem., April 15, 2005; 280(15): 15370 - 15379.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. V. Pobbati, A. Razeto, M. Boddener, S. Becker, and D. Fasshauer
Structural Basis for the Inhibitory Role of Tomosyn in Exocytosis
J. Biol. Chem., November 5, 2004; 279(45): 47192 - 47200.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
R. Wysocki and S. J. Kron
Yeast cell death during DNA damage arrest is independent of caspase or reactive oxygen species
J. Cell Biol., August 2, 2004; 166(3): 311 - 316.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
E03-02-0114v1
15/3/1436    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wadskog, I.
Right arrow Articles by Adler, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wadskog, I.
Right arrow Articles by Adler, L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Copyright © 2004 by The American Society for Cell Biology. Terms of copyright protection, warranties, and disclaimers.