![]() |
|
|
Vol. 15, Issue 4, 1918-1930, April 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



* Department of Anatomy and Cell Biology, Columbia University, College of Physicians and Surgeons, New York, New York 10032;
Department of Physiology, University of Wisconsin, Madison, Wisconsin 53706
Submitted September 21, 2003;
Revised January 7, 2004;
Accepted January 8, 2004
Monitoring Editor: Keith Mostov
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
To study the effects of Ca2+ at steps that precede vesicle fusion, we have recently established a functional docking assay that measures binding of granules to the plasma membrane (Chieregatti et al., 2002
). By using this assay, we have found that SNAP-25 interacts in a Ca2+-dependent manner with the granule component synaptotagmin 1 (Syt1) to support an initial and reversible interaction between the vesicle and the plasma membrane (Ca2+-dependent docking). This step precedes another ATP-dependent event that makes association of the granule with the plasma membrane irreversible. These results suggest that the Ca2+-dependent SNAP-25-Syt1 interaction is important at a step of functional granule docking to the plasma membrane that precedes ATP-dependent maturation (priming) (Klenchin and Martin, 2000
), formation of the SNARE complex, and fusion. In addition, it has been proposed that direct binding of SNAP-25 and Syt1 is necessary for Ca2+-dependent triggering of membrane fusion and neurotransmitter release (Gerona et al., 2000
; Zhang et al., 2002
; Earles et al., 2001
). In this view, Syt1 operates as the Ca2+ sensor that triggers opening of the fusion pore (Littleton et al., 1999
; Wang et al., 2001
). Moreover, genetic and biochemical evidence supports the concept that Syt1 is involved in endocytosis (reviewed by Chapman, 2002
; Slepnev and De Camilli, 2000
; Sudhof, 2001
). Thus, the emerging view is that synaptotagmins may function at multiple steps during the trafficking of secretory vesicles. Whereas the function of synaptotagmins as Ca2+ sensors in fusion-pore dynamics and vesicle recycling is more established, less is known about their proposed role in vesicle docking to the plasma membrane (Reist et al., 1998
; Chieregatti et al., 2002
).
SNAP-25 is specifically expressed in neurons and in endocrine cells (Oyler et al., 1989
; Sadoul et al., 1995
). Differently, the SNAP-25 homologue SNAP-23 (also referred to as Syndet), is expressed at relatively low levels in endocrine cells and neurons compared with many other types of cells. Like SNAP-25, SNAP-23 is localized at the plasma membrane (Ravichandran et al., 1996
; Wang et al., 1997
). SNAP-23 has been shown to play a role in the translocation to and fusion with the plasmalemma of a specialized type of exocytotic vesicle, the Glut4 vesicle (Rea et al., 1998
). The latter process is regulated by insulin and can occur at resting intracellular calcium concentration ([Ca2+]i) (Whitehead et al., 2001
). Moreover, constitutive docking and fusion of vesicles at the plasma membrane must occur in every cell at resting [Ca2+]i levels to carry newly synthesized lipids and protein to the plasma membrane. Finally, Ca2+-dependent recruitment and release of vesicles seems to occur in many, perhaps in all cell types (Dan and Poo, 1992
; Chavez et al., 1996
; Borgonovo et al., 2002
). These observations are consistent with the idea SNAP-25 functions in vesicle release at elevated Ca2+, whereas SNAP-23 can, at least in some cells, function in exocytosis at resting Ca2+ levels.
In our previous work, we have shown that SNAP-25-dependent granule docking to plasma membranes occurs at high Ca2+ (1 µM) and requires the interaction of SNAP-25 with Syt1. It has been recently proposed that specific synaptotagmins bind to Ca2+ with
10-fold higher apparent affinity than Syt1 (Shin et al., 2002
; Sugita et al., 2002
). On the basis of these considerations, we hypothesized that SNAP-23 supports vesicle docking at resting [Ca2+] levels by interacting with synaptotagmins that bind Ca2+ with high affinity. Here, by using the in vitro docking assay and a cell-based secretion assay, we show that SNAP-25 and SNAP-23 function in granule docking and fusion at elevated and low Ca2+, respectively, by interacting with different members of the synaptotagmin family.
| MATERIALS AND METHODS |
|---|
|
|
|---|
1 subunit of Na+/K+ ATPase was from Upstate Biotechnology (Lake Placid, NY); mouse mAb 41.1 against Synaptotagmin 1 was from Synaptic Systems (Gottingen, Germany), mouse monoclonal antibodies against
-Gal and green fluorescent protein (GFP) were from Roche Diagnostics (Indianapolis, IN); rabbit polyclonal antibody against Calnexin was from Stressgen Biotechnologies (Victoria, BC, Canada); mouse polyclonal antibody against Myc was from Santa Cruz Biotechnology (Santa Cruz, CA); rabbit polyclonal antibody against SNAP-23 has been described previously (Wang et al., 1997
BoNT and Syt Protein Expression and Purification
The cDNA of the recombinant His6-tagged light chain of Botulinum Toxin E (BoNT/E) in the vector pBN17 and recombinant His6-tagged light chain of Botulinum Toxin C (BoNT/C) in the vector pBN27 (Binz et al., 1994
) were transformed into Escherichia coli strain M15/pRep. The His6-tagged protein was purified by chromatography by using Ni-NTA agarose (QIAGEN, Valencia, CA) following the manufacturer's instructions. The pGEX-2T plasmids encoding GST-Syt1-12 C2AB, which corresponds to the entire cytoplasmic domain of Syt1-12, and glutathione S-transferase (GST)-Syt1C2A, which corresponds to the C2A domain of Syt1 have been described previously (Desai et al., 2000
). The GST-coupled Syts were expressed in JM109 bacterial cells, purified, and analyzed as described previously (Desai et al., 2000
). The light chain of Tetanus toxin (TeNT) was a kind gift of Dr. Montecucco (Rossetto et al., 2001
).
Cell Fractionation and In Vitro Assay
AtT-20 cells or N2A cells were washed once in Kglu buffer (20 mM HEPES, pH 7.4, 120 mM potassium glutamate, 20 mM potassium acetate, 5 mM EGTA, 1 mg/ml bovine serum albumin) and scraped from plates in the Kglu buffer. Cells were broken by passing them three times through a 27-gauge 1/2 syringe needle and centrifuged at 100 x g for 5 min. The postnuclear supernatant was centrifuged at 7200 x g for 10 min to obtain a plasma membrane-containing fraction PII. The supernatant of this centrifugation corresponds to the cytoplasm and granule-containing fraction SII (Koticha et al., 2002
). The pellet PII was incubated for 30 min at 30°C to release additional bound granules (Chieregatti et al., 2002
) and recentrifuged at 7200 x g for 10 min. This pellet corresponds to the P fraction used for the in vitro docking assay (see below).
In vitro docking assays were conducted as described previously (Chieregatti et al., 2002
) in 0.12-ml total volume reactions that contained the 7200 x g pellet P derived from either AtT-20 cells or N2A cells resuspended in Kglu buffer with 5 mM EGTA. The granule-containing fraction SII derived from N2A cells transiently expressing the chimera POMC-
-Gal was added to the P fraction and CaCl2 was adjusted to obtain 10 µM free [Ca2+] to induce docking. The sample was incubated for 10 min at 30°C. At the end of the incubation time, samples were centrifuged again at 7200 x g for 10 min to obtain plasma membranes with or without docked granules. Granules docked to the plasma membrane were analyzed by Western Blot probed with antibodies against
-Gal and Na+/K+ ATPase. The intensity of bands corresponding to processed POMC-
-Gal 120/124-kDa peptides stored in granules (Koticha et al., 2002
) was measured by densitometry. Western blots analysis was performed by using enhanced chemiluminescence (Wang et al., 1997
). When indicated, P membranes were pretreated before the docking reaction for 30 h at 30°C with 500 nM recombinant His6-tagged light-chain of Botulinum Toxin E (Binz et al., 1994
), (Chieregatti et al., 2002
). For the inhibition experiments using recombinant Syt proteins, granules and plasma membrane were mixed and preincubated with the Syt proteins (5 µM) for 10 h at 30°C. As Synaptotagmins bind Ca2+, for these experiments, an excess of free 100 µM [Ca2+] was added to induce docking. Where indicated, granules docked to the plasma membrane were released by incubation with addition of 20 mM EGTA (from a 0.5 M EGTA stock solution, pH 7.4) for 10 min at 30°C.
To determine whether AtT-20, and N2A cells express Syt7 and Syt3, cells and mouse brain were homogenized in phosphate-buffered saline containing protease inhibitors (Complete Mini; Roche Diagnostics); postnuclear supernatants were obtained after centrifugation of the homogenates at 100 x g for 5 min.
Immunoprecipitations
For the immunoprecipitation reaction, samples with plasma membrane-containing P fraction were incubated with granule-containing SII fraction in the presence or in the absence of 10 µM free calcium for 10 min at 30°C. After the docking reaction, samples were diluted 1:5 with IP buffer (100 mM Tris, pH 7.4, 50 mM NaCl, 0.5% Triton X-100, and protease inhibitors) with addition of EGTA and CaCl2 to reach a final concentration of 50 µM free Ca2+ in all the samples. The addition of 50 µM free Ca2+ in the IP buffer was done to prevent dissociation of protein complexes that are formed in the docking step (Chieregatti et al., 2002
). Immunoprecipitations were done by adding anti-Synaptotagmin antibody 41.1 (p65), or mouse mAb against GFP, or affinity-purified rabbit antibodies against SNAP-23 as indicated. Samples were rotated for 1 h at 4°C. After addition of protein G beads the samples were further incubated for 1 h at 4°C. After five washes with IP buffer at pH 7.4, the beads were resuspended in sample buffer, boiled for 5 min, and centrifuged. Supernatants were loaded onto the SDS-PAGE gel. Western blots were probed with anti-Synaptotagmin antibody 41.1, or with rabbit polyclonal antibodies against GFP.
Cell Culture and Transfection
The plasmids POMC-
-Gal-pcDNA3, SNAP-25A-Myc-pcB7, and Syndet(SNAP-23)-pcB7 for exogenous protein expression in mammalian cells have been described previously (Koticha et al., 2002
). The plasmids pCMV5-SytI-EYFP, pCMV5-SytVIIl-EYFP, and pCMV5-SytIIl-EYFP have been described previously (Sugita et al., 2001
, 2002
). The cDNAs encoding for the yellow fluorescent protein (YFP)-tagged cytoplasmic domains of Syt1, (Syt1C2AB-EYFP, from amino acid residue 96 of Syt1) and of Syt7 (Syt7C2AB-EYFP, from amino acid residue 93 of Syt7) were amplified by polymerase chain reaction (PCR) from pCMV5-SytI-EYFP and pCMV5-SytVIIl-EYFP by using the forward primers 5'CACCATGGGAGGAAAGAACGCCATTAACA (the underlined sequence corresponds to Syt1 cDNA) and 5'CACCATGGAGTCTGACCGCAGAACGGA (the underlined sequence corresponds to Syt7 cDNA), and the reverse primer 5'TTACTTGTACAGCTCGTCCATGCCGA (the sequence corresponds to EYFP cDNA including the stop codon). The PCR products were subloned into the pcDNA/GW/D-TOPO vector (Invitrogen, Carlsbad, CA) for mammalian cell expression following the manufacturer's instructions to obtain the pcDNA/GW/D-TOPO-Syt1C2AB-EYFP and pcDNA/GW/D-TOPO-Syt7C2AB-EYFP vectors. The plasmid SNAP-25A-Myc-pEGFP.C1 with GFP at the N terminus of SNAP-25 was obtained by subcloning the SNAP-25A-Myc insert, excised by SacI and XbaI from the vector SNAP-25A-Myc-pcB7, into the vector pEGFP.C1 digested with SacI and XbaI. The plasmid SNAP-23-pEGFP.C1 was generated by subcloning SNAP-23 cDNA excised by HindIII and XbaI from the SNAP-23 (Syndet)-pcB7 vector (Koticha et al., 1999
) into the vector pEGFP.C1 digested with SacI and XbaI.
Mouse neuroblastoma N2A and AtT-20 cells were grown in DMEM with 100 U ml-1 penicillin, 100 µg ml-1 streptomycin, and containing 8 and 10% heat-inactivated fetal calf serum, respectively. HEPES at pH 7.4 (20 mM) was added to the medium of N2A cells. For transient expression, cells were transfected with the DNA of interest by using LipofectAMINE (Invitrogen), according to the manufacturer's instructions. The G14 cell line derived from N2A cells stably expressing BoNT/E light chain and AtT-20 cell line stably expressing SNAP-23 have been described previously (Koticha et al., 1999
, 2002
). To prepare AtT-20 cell line 6#5 expressing Myc-tagged SNAP-25A (stable transfection), cells were transfected with the SNAP-25A-Myc-pEGFP.C1 plasmid where the cDNA encoding GFP was excised by digestion with NheI and SacI. The plasmid was religated after refilling the 3' recessed ends with DNA Polymerase I (Klenow) fragment (Promega, Madison WI). Transfection of AtT-20 cells was done using LipofectAMINE and following the manufacturer's instructions. Stably transfected colonies were selected by growth in presence of neomycin (Calbiochem, San Diego, CA) used at a concentration of 0.75 mg/ml. Colonies were tested for expression of exogenous Myc-tagged SNAP-25 by Western blot with SNAP-25 antibody.
Secretion Assay
N2A cells grown in 60-mm dishes were transiently transfected with POMC-
-Gal and the indicated plasmids 72 h before the secretion experiments. For the experiment, cells were washed with secretion medium containing 20 mM HEPES, pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 0.1 mg/ml bovine serum albumin, and incubated at 37°C for 1 h in 1 ml of the same medium with 5 mM glucose with or without 5 µM ionomycin. The medium was collected and centrifuged at 300 x g for 5 min to remove cell debris. The cell-free medium was incubated with 4 ml of acetone overnight at -20°C, centrifuged at 7000 x g for 15 min, loaded onto a SDS-PAGE gel, and analyzed by Western blot by using an antibody against
-Gal and Calnexin. At the end of the secretion experiment, the cells were scraped from plates in Kglu buffer, passed three times through a 27-gauge 1/2 syringe needle, and centrifuged at 100 x g for 5 min. The postnuclear supernatant was centrifuged at 7200 x g for 10 min to obtain P and SII fractions that were analyzed by Western blot with antibodies against
-Gal, Na+/K+ ATPase, SNAP-23, and Myc.
| RESULTS |
|---|
|
|
|---|
-Gal (Figure 1, A-C). POMC-
-Gal, synthesized as a 150-kDa protein, is processed in N2A granules to yield 137- and 120/124-kDa peptides (Koticha et al., 2002
|
Granule docking was abolished when AtT-20 plasma membranes were preincubated with botulinum toxin E (BoNT/E), which cleaves specifically SNAP-25. Thus, SNAP-25 is required for granule docking (Chieregatti et al., 2002
; Washbourne et al., 2002
). When, in contrast, the docking reaction was carried out with plasma membranes from cells expressing exogenous SNAP-23, the process was unaffected by the toxin (Figure 1A). SNAP-23 is less sensitive than SNAP-25 to BoNT/E proteolysis (Washbourne et al., 1997
). In our experimental conditions (500 nM BoNT/E), the toxin did not cleave SNAP-23, whereas most of SNAP-25 was proteolyzed (Figure 1B). Some SNAP-25 (< 20%) may remain uncleaved because a fraction of AtT-20 plasma membranes does not expose the inner surface to the medium (Chieregatti et al., 2002
). These data show that overexpressed SNAP-23 reconstitutes granule docking to AtT-20 plasma membranes in the presence of BoNT/E. The SNAP-23-dependent granule docking, like that supported by SNAP-25 (Chieregatti et al., 2002
), is reversible because addition of 20 mM EGTA to chelate free Ca2+ induced release of the docked vesicles in the supernatant (Figure 1A).
Ca2+-dependent, Reversible, Docking of Granules Is Supported by Formation of a Syt1-SNAP-25 Complex without VAMP-2 and Syntaxin 1
Temperatures below 15°C inhibit fusion of biological membrane in cell-free assays because the process requires membrane fluidity (Latterich et al., 1995
; Brickner et al., 2001
). Because docking requires protein interactions rather than lipid mixing, it is expected that the process can also take place at low temperatures. In the presence of Ca2+, granules were able to cofractionate with N2A plasma membranes (or AtT-20 plasma membranes; our unpublished data) at 4°C as well as at 30°C, indicating that docking, not fusion, has occurred (Figure 1C).
We have proposed that granule docking is supported by the interaction of Syt1 with SNAP-25 and without VAMP-2 (Chieregatti et al., 2002
). To determine whether VAMP-2 and syntaxin 1 are excluded from the complex that supports docking, we did coimmunoprecipitation experiments with plasma membranes derived from N2A cells that express abundant VAMP-2 and syntaxin 1. In the presence of Ca2+, SNAP-25 coimmunoprecipitated with Syt1, whereas syntaxin 1 and VAMP-2 did not (Figure 2A, lane 2). This indicates that syntaxin 1 and VAMP-2 do not bind to the Syt1-SNAP-25 complex in the docking condition.
|
We further explored a possible role of syntaxin 1 in docking by using BoNT/C. BoNT/C blocks neurotransmission by cleaving syntaxin 1 (Blasi et al., 1993
; Schiavo et al., 1995
). It has also been reported that BoNT/C cleaves SNAP-25, but only in intact cells and not in vitro (Foran et al., 1996
; Williamson et al., 1996
). In our assay, pretreatment of N2A plasma membranes with BoNT/C lead to a reduced intensity of membrane-bound syntaxin 1 immunoreactive bands, whereas the SNAP-25 band was unchanged (Figure 2A, lanes 5 and 6). This indicates that most of syntaxin 1, but not SNAP-25 is cleaved in the assay. Syntaxin 1 proteolysis did not inhibit Ca2+-dependent granule docking (Figure 2B, lane 3), indicating that the protein is not involved at this step. TeNT inhibits regulated exocytosis by cleaving VAMP-2 (Schiavo et al., 1992
). Granules treated with 150 nM TeNT (or with 450 nM TeNT; our unpublished data) had 70% less VAMP-2 than the untreated granules. The TeNT-treated granules docked efficiently to the plasma membranes (Figure 3C), indicating that VAMP-2 is not involved in docking. These experiments and the immunoprecipitation experiments described above indicate that Ca2+-dependent granule docking is supported by formation of the SNAP-25-Syt1 complex without syntaxin1 and VAMP-2 (Figure 2).
|
The SNARE complex components SNAP-25, syntaxin 1, and VAMP-2 are required for regulated exocytosis. We reasoned that syntaxin 1 and VAMP-2 may associate to the Syt1-SNAP25 complex at stages that occur later than the reversible granule docking. When ATP was added to the docking assay in addition to Ca2+, VAMP-2 and syntaxin 1 coimmunoprecipitated with Syt1-SNAP-25 (Figure 2A, lane 3). Proteolysis of syntaxin 1 by incubation with BoNT/C abolished coimmunoprecipitation of VAMP-2 with Syt1-SNAP-25 (Figure 2A, lane 4). These experiments indicate that both syntaxin 1 and VAMP-2 interact with the Syt1-SNAP-25 in the presence of Ca2+ and ATP. We have proposed that addition of ATP and Ca2+ (but not ATP by itself) to the assay induces irreversible association of granules with the plasma membrane (Chieregatti et al., 2002
). In agreement with this conclusion, in the presence of Ca2+ and ATP, granules could not be released in the supernatant by subsequent addition of EGTA (Figure 2B, lane 6). However, when samples were pretreated with BoNT/C, granules failed to associate irreversibly with the plasma membranes (Figure 2B, lane 7). These experiments indicate that the Ca2+ and ATP-dependent association of granules with the plasma membrane, unlike granule docking, is supported by the formation of a complex that includes in addition to SNAP-25 and Syt1, also syntaxin 1 and VAMP-2.
SNAP-25 and SNAP-23-dependent Granule Docking Occurs at High and Low [Ca2+], Respectively
The data shown above indicate that SNAP-25-dependent, reversible docking of granules to the plasma membrane induced by Ca2+ is supported by the formation of the Syt1-SNAP-25 complex with the exclusion of other SNARE components. In terms of Ca2+, docking to plasma membranes with exogenous SNAP-23 was already appreciable at 10-7 M [Ca2+] (Figure 3, A, B, and D). Differently, docking to plasma membranes with endogenous (Figure 3, A and B) or overexpressed SNAP-25 (20-50-fold higher protein level than endogenous SNAP-25) (Figure 3, C and D) required [Ca2+] of 10-6 M or above. We conclude that SNAP-23 is able to replace SNAP-25 in granule docking, and it does so at Ca2+ concentrations 1 order of magnitude lower than SNAP-25-dependent docking.
The C2AB Domain of Syt1 Inhibits SNAP-25, but Not SNAP-23-dependent Docking
Synaptotagmins constitute a family of proteins with a single transmembrane domain, a linker, and a large cytoplasmic region composed of two domains that bind to phospholipids in a Ca2+-dependent manner (C2A and C2B) (Sudhof, 2001
; Chapman, 2002
). Syt1 and the highly homologous Syt2 are thought to function as Ca2+ sensors in neurotransmission. The role of other synaptotagmins is less defined. Differently than in previous reports (Ullrich et al., 1994
; Li et al., 1995
), it has been recently proposed that synaptotagmins exhibit distinct Ca2+ affinities because Syt3, Syt7, and Syt5 were found to bind Ca2+ with
10-fold higher apparent affinity than Syt1 (Shin et al., 2002
; Sugita et al., 2002
).
On the basis of these data and of our observation that SNAP-25 and Syt1 function in Ca2+-dependent granule docking, we reasoned that the different Ca2+ dependence of the SNAP-25- and SNAP-23-dependent docking processes could be due to their interaction with specific members of the synaptotagmin family. This possibility was first investigated by carrying out granule-plasmalemma docking assays in the presence of 5 µM of the cytoplasmic domains (C2AB, with two Ca2+-binding motifs) from the various members of the wide Syt family. For these experiments, granule docking was induced by 100 µM free [Ca2+] instead of the 10 µM [Ca2+] routinely used for the assay. This is because specific synaptotagmins that bind to several Ca2+ ions (five, for Syt1) may impair granule docking by lowering the [Ca2+] in the buffer.
By using this assay, it was found that the SNAP-25-dependent docking was completely inhibited by Syt1C2AB (Figure 4A). To test the specificity of the inhibition by Syt1C2AB, we used a shorter Syt1 protein that has only one Ca2+ binding motif (Syt1-C2A). Syt1C2A binds to phospholipids in Ca2+-dependent manner, but unlike Syt1C2AB binds weakly to SNAP-25 (Schiavo et al., 1997
; Gerona et al., 2000
; Earles et al., 2001
). Syt1C2A did not impair granule docking, indicating that Syt1C2AB acts specifically. Of the panel of C2AB fragments derived from the other Syt isoforms, two (Syt3 and Syt7) blocked SNAP-25-dependent docking to an extent similar to Syt1C2AB (Figure 4B); and two (Syt5 and Syt6; Figure 3C) were less effective (
40% inhibition). The other synaptotagmins (Syt4 and Syt11 [Figure 4B], and Syt8, Syt9, Syt10, and Syt12 [Figure 4C]) were inactive. Syt4 and Syt11 do not bind Ca2+ (von Poser et al., 1997
), and Syt8 and Syt12 lack the consensus Ca2+ binding site (Sudhof, 2001
). The inability of these Syts to impair the SNAP-25-dependent granule docking is in agreement with the concept that this process is Ca2+ dependent. Similarly, SNAP-23-dependent docking was completely blocked by Syt3 and Syt7 and partially impaired by Syt5 and Syt6, whereas other synaptotagmins were inactive. Importantly, Syt1 failed to inhibit the SNAP-23-dependent granule docking (Figure 4A). These data indicate that SNAP-25 and SNAP-23 mediate docking by interacting with specific members of the synaptotagmin family. The data also support a model where SNAP-25 and SNAP-23 docking complexes with specific synaptotagmins are triggered at different Ca2+ levels.
|
The Syt1-SNAP-25 Complex Forms in Trans between the Granule and Plasma Membrane
To study the role of Syt1 in granule docking, we first determined whether the Syt1-SNAP-25 complex forms in trans between the granule and plasma membrane. Docking experiments were carried out by mixing fractions from Syt1-YFP-transfected and nontransfected cells. If Syt1 on the granule establishes a complex with SNAP-25 at the plasma membrane, then the complex would form only when the fluorescent protein is delivered to the assay in the granule-containing fraction SII. Indeed, Syt1-YFP in the granule-containing fraction SII from transfected cells formed Ca2+-dependent complexes with SNAP-25 when incubated with the plasma membrane-containing fraction P from untransfected N2A cells (Figure 5A, lanes 5 and 6). Complexes did not form in the absence of added P membranes (Figure 5A, lanes 7 and 8), indicating that Syt1-YFP on the granule interacts only with SNAP-25 at the plasma membrane. Syt1-YFP in the plasma membrane-containing fraction P did not form complexes with SNAP-25 in the absence or in the presence of added granules (Figure 5A, lanes 1-4). These results indicate that the complex is indeed formed between the Syt1 on the granule and SNAP-25 at the plasma membranes.
|
Syt1 Forms Docking Complexes with Both SNAP-25 and Exogenous Syt7 (or Syt3) to Support Granule Docking to the Plasma Membrane
The structure of the SNAP-25-dependent complex could, however, be more complex than considered so far. In fact, inhibition of granule docking to plasma membranes by the C2AB domains of Syt3 and 7 (Figure 4) suggested the possibility that not only Syt1, but also these other Syts interact with SNAP-25 in the docking step. In support of this possibility, the C2AB of Syt3 and Syt7, like that of Syt1, inhibited the formation of the Syt1-SNAP-25 complex in the docking assay (Figure 5B). It has been reported that Syt3 and Syt7 are expressed in peptide-hormone secreting cells and are involved in granule release (Brown et al., 2000
; Gao et al., 2000
; Fukuda et al., 2002
). Because Syt3 and Syt7 were equally potent inhibitors of granule docking, we focused on these isoforms to determine whether they were involved in the SNAP-25-dependent docking complex. To carry out these experiments, we overexpressed YFP-tagged Syt3 and Syt7 in N2A cells. We reasoned that this approach would determine whether these proteins could participate in the formation of the SNAP-25-dependent docking complex. The YFP-tag was used for these experiments because YFP-Syt1, like the endogenous Syt1, was already known to form docking complexes with SNAP-25 (Figure 5A). This observation indicated to us that the tag does not interfere with the docking process.
SNAP-25 coprecipitated with Syt3-YFP (or Syt7-YFP), showing that these proteins indeed interact with SNAP-25 in the docking condition (Figure 5, C and D). Moreover, the C2AB domain of Syt1, Syt3, and Syt7 inhibited formation of the Syt1-SNAP-25, Syt3-SNAP-25, or Syt7-SNAP-25 complexes (Figure 5, B-D), thus establishing a strong correlation between formation of these complexes and the SNAP-25-dependent granule docking (Figure 4). Like the Syt1-SNAP-25 complex (Chieregatti et al., 2002
), Syt3-SNAP-25 (our unpublished data) and Syt7-SNAP-25 complexes (Figure 5D) were dissociated when docked granules were released by lowering [Ca2+] in the assay. These data are consistent with the idea that exogenous Syt3 (or Syt7), like Syt1, interacts with SNAP-25 in a Ca2+-dependent and reversible complex to support granule docking.
The data presented above also suggested that that exogenous Syt7 (or Syt3) might interact together with Syt1 and SNAP-25 in the same docking complex. When Syt1 was immunoprecipitated from samples incubated in the docking conditions, both SNAP-25 and Syt7-YFP were coimmunoprecipitated, indicating that these proteins participate in the same complex (Figure 5E).
It has been proposed that Syt7 and Syt3 are localized on granules (Brown et al., 2000
; Gao et al., 2000
; Fukuda et al., 2002
) and at the plasma membrane (Sugita et al., 2001
, 2002
). Although Syt3-YFP (also Syt7-YFP) was expressed in the granule membrane fraction SII together with Syt1 (Figure 6, A and B, SII), an interaction between them could be established only in the presence of SNAP-25 in the plasma membrane fraction P (Figure 6, A and B, compare lanes 6 and 8). This experiment shows that Ca2+ induces the formation of a complex that includes Syt3 (or Syt7) and Syt1 on the granules and SNAP-25 at the plasma membrane.
|
Syt3-YFP (or Syt7-YFP) was able to interact with SNAP-25 also when located in the plasma membrane-containing fraction P, however, only in the presence of Syt1 in the granule membrane (Figure 6, A and B, compare lanes 4 and 2). We conclude that in the SNAP-25-dependent docking process the role of Syt3 and 7 is different from that of Syt1. In fact, it seems that the docking complex includes Syt1 on the vesicle, SNAP-25 at the plasma membrane and Syt3 or Syt7, no matter of their membrane localization.
SNAP-23 Forms Complexes with Exogenous Syt7 (or Syt3) but Not with Syt1, to Support Granule Docking to the Plasma Membrane
It remained to be established whether, and to what extent, the SNAP-23-dependent docking complex is structured as the SNAP-25-dependent one. This was hard to establish by using N2A cells because of their high endogenous expression of SNAP-25. We therefore used a N2A clone, G14, stably transfected with BoNT/E, in which most endogenous SNAP-25 is cleaved to inactive peptides (Koticha et al., 2002
). P and SII fractions isolated from G14 cells transfected with SNAP-23 together with Syt7, or Syt3 or Syt1, all coupled to YFP, were mixed in the docking assay, solubilized, and immunoprecipitated with antibodies against SNAP-23 (Figure 7A). Both Syt3 and Syt7, but not Syt1 (either the YFP-tagged exogenous or the endogenous protein), were found to coimmunoprecipitate with SNAP-23 in the docking condition. This experiments indicates that SNAP-23-dependent granule docking is supported by formation of a complex between SNAP-23 and Syt7 (or Syt3), with the exclusion of Syt1.
|
When added to the docking assay, the C2AB domain of Syt3 and Syt7 inhibited formation of the SNAP-23-Syt7 (or SNAP-23-Syt3) docking complexes (Figure 7, B and C). This observation is agreement with the concept that the SNAP-23-Syt7 (or SNAP-23-Syt3) complex supports SNAP-23-dependent docking. Syt7C2AB and Syt3C2AB act specifically because Syt1C2AB did not inhibit formation of the complexes. We conclude that the general structure of the SNAP-23-dependent complex may resemble that of its SNAP-25-dependent counterpart, with the important exclusion of Syt1.
Syt7 Is Expressed in AtT-20 and N2A Cells
To determine whether Syt3 and Syt7 are expressed in AtT-20 and N2A cells we used recently developed antibodies raised against the two proteins (Tucker et al., 2003
). We found that Syt7 is expressed both in AtT-20 and N2A cells, whereas Syt3 was not detectable in either of the two cell lines (Figure 8). We conclude that, in these cells, endogenous Syt7, rather then Syt3, is likely to participate in SNAP-25-and SNAP-23-dependent granule docking to the plasma membrane.
|
Expression of SNAP-23 in N2A Cells Leads to a 20-Fold Increase in Granule Exocytosis in the Basal Condition
The data shown in Figure 3 show that SNAP-25 and SNAP-23 function in granule docking at high and low Ca2+, respectively. We reasoned that if vesicle docking is the rate-limiting step of hormone release in the basal state, then overexpression of SNAP-23 could lead to enhanced granule release by resting cells. To investigate this possibility, intact N2A cells were transfected with the secretory chimera POMC-
-Gal and either control plasmid, SNAP-25, or SNAP-23. In cells expressing only endogenous or transfected SNAP-25, the release of the processed, granule-stored 120/124-kDa POMC-
-Gal was almost inappreciable at rest and increased moderately (fourfold) after administration of the Ca2+ ionophore ionomycin. In contrast, when cells were transfected with SNAP-23, release was considerable (20-fold higher) already at rest, and ionomycin induced no major increase (Figure 9, A and B). Consistently, the amount of 137- and 120/124-kDa peptides recovered in the granule-rich fraction SII was lower (21%) in SNAP-23-overexpressing than in mock-transfected cells, whereas the 150-kDa precursor, present in the endoplasmic reticulum (ER) and Golgi recovered in fraction P, was decreased to 71%. Other, nongranular markers (calnexin for the ER and Na+/K+ ATPase for the plasma membrane) were unchanged, showing that comparison had been carried out between similar numbers of cells. In conclusion, our data in intact cells demonstrate that SNAP-23 functions in granule release, but it does so at resting Ca2+
|
It is possible that the biological effects induced by SNAP-23 expression on secretion are due to very high levels of the exogenous protein. Because parallel transfections with SNAP-25 had no effect on granule release, we determined the relative level of expression of exogenous SNAP-25 and SNAP-23 proteins in our assay by using GFP-tagged proteins as reference. Western blot analysis using anti-GFP antibodies shows that SNAP-25-GFP was approximately threefold more abundant than SNAP-23-GFP (Figure 9C). By using antibodies against SNAP-25, it seems that the SNAP-25-Myc protein without the GFP-tag (the same as used for the secretion studies in Figure 9A) was threefold more abundant than GFP-SNAP-25-Myc and 20- to 50-fold more abundant than endogenous SNAP-25 (Figure 9D). Differently, by using anti-SNAP-23 antibodies, it is found that SNAP-23 without the GFP tag was
10-fold less abundant that GFP-SNAP-23 (Figure 9E). Thus, exogenous SNAP-23 in N2A cells is less abundant (<10-fold) than exogenous SNAP-25 and seems to be expressed at levels comparable with those of endogenous SNAP-25.
Expression of the C2AB Domain of Syt1 in N2A Cells Inhibits the SNAP-25-, but Not the SNAP-23-dependent Release of Granules
In N2A cells, SNAP-25 activity is necessary for regulated granule release (Koticha et al., 2002
). We have shown here that Syt1, the proposed Ca2+ sensor (Perin et al., 1990
; Brose et al., 1992
), is specifically required for SNAP-25-dependent docking of granules, a process that occurs at high [Ca2+]. On the basis of these considerations, we hypothesized that expression of the C2AB domain of Syt1 in N2A cells could lead to an inhibition of regulated hormone release by engaging SNAP-25 in an unproductive interaction. We also predicted that Syt1C2AB would not impair the SNAP-23-dependent granule release in resting cells because SNAP-23-dependent docking does not require Syt1. Figure 10 shows that regulated release of granules was abolished by expression of Syt1C2AB. Differently, the SNAP-23-dependent release of the POMC-
-Gal peptides by resting cells was unchanged by expression of Syt1C2AB. Thus, Syt 1 is specifically involved in SNAP-25-dependent granule release. Expression of the C2AB domain of Syt7 in N2A cells inhibited both SNAP-25- and SNAP-23-dependent granule release (Figure 10). These data are in agreement with the observation that the C2AB domain of Syt7 inhibits both SNAP-25- and SNAP-23-dependent granule docking.
|
| DISCUSSION |
|---|
|
|
|---|
Here, we propose that SNAP-23 and SNAP-25 function in granule docking and release at low and elevated [Ca2+], respectively, by interacting with different members of the Synaptotagmin family. These conclusions are based on several observations. First, by using the in vitro docking assay, it was possible to directly compare the Ca2+ sensitivity of SNAP-25- and SNAP-23-dependent docking of granules to plasma membranes. It was found that the SNAP-25-dependent process occurs at high [Ca2+] (
1 µM), whereas SNAP-23-dependent docking occurs at 10-fold lower [Ca2+]. Second, by using a panel of 11 different SytC2AB domains it is found that Syt1, Syt3, and Syt7 block specifically SNAP-25-dependent docking, whereas Syt3 and Syt7, but not Syt1, abolish the SNAP-23-dependent process. Third, in the docking conditions, SNAP-25 forms complexes with overexpressed Syt1 and Syt7 (or Syt3), whereas SNAP-23 forms complexes with Syt7 (or Syt3), but not with Syt1. Fourth, the C2AB domains of Syt1, Syt7, and Syt3 inhibit both SNAP-25-dependent granule docking, formation of the complexes, and granule release. Importantly, the C2AB domain of Syt7 and Syt3, but not of Syt1, inhibits the corresponding SNAP-23-dependent processes.
The experiments presented in this study show that overexpressed Syt7 and Syt3 have largely overlapping function and participate both in SNAP-25- and SNAP-23-dependent granule docking. Endogenous Syt7 is expressed in N2A and AtT-20 cells, whereas Syt3 was not detected under out blotting conditions. Thus, in these cells, Syt7, rather than Syt3, is likely to participate in SNAP-25- and SNAP-23-dependent docking complexes. It has been reported that this protein is expressed in the
-cells of the pancreas and regulates insulin secretion (Brown et al., 2000
; Gao et al., 2000
). In agreement with these reports, the data presented here suggest that Syt3 may interact with SNAP-25 and Syt1 to support docking and fusion of insulin-containing granules.
On the basis of the results presented here and by other investigators, a novel model is proposed to explain docking/fusion at low and high Ca2+ in endocrine cells (Figure 11). In resting cells, granules are positioned near the cell membrane (morphological docking) by Rab3- and Munc-18-dependent mechanisms (Baldini et al., 1998
; Martelli et al., 2000
; Voets et al., 2001
). In response to an increase in intracellular [Ca2+], granules interact reversibly with the plasma membrane (functional docking) by forming a complex that includes Syt1 on the granule, SNAP-25 at the plasma membrane and Syt7 (or Syt3) either on the granules or at the plasma membrane. This conclusion is based on our in vitro findings that 1) Syt1, Syt7, and SNAP-25 form complexes that support granule docking at 1 µM Ca2+; 2) both granule and plasma membrane-associated Syt7 (or Syt3) interact with granule-bound Syt1 and plasma membrane-bound SNAP-25 to form the docking complex (Figures 5 and 6).
|
The model predicts that defects in Syt1, Syt7 and SNAP-25 proteins would affect functional granule docking induced by elevated [Ca2+] and not granule positioning near the plasma membrane (also referred to as morphological docking) at resting [Ca2+] levels. Thus, the model is consistent with the finding that in the SNAP-25 mutant mouse, there are no defects in accumulation of synaptic vesicles at the synapse or in the positioning of granules near the plasma membrane (Washbourne et al., 2002
; Sorensen et al., 2003
). However, it is possible that Syt1 is involved in vesicle docking to the plasma membrane at resting Ca2+ levels, perhaps by interacting with other plasma membrane components. This is suggested by the finding that the pool of docked synaptic vesicles is severely reduced in Synaptotagmin mutants of Drosophila (Reist et al., 1998
).
In the model, Syt1 acts as a low-affinity Ca2+ sensor that regulates SNAP-25-dependent granule docking. This model is based on the observation that Syt1 binds to Ca2+ with a lower apparent affinity than other synaptotatgmins (Shin et al., 2002
; Sugita et al., 2002
), that SNAP-25-dependent granule docking is triggered by elevated [Ca2+] (
1 µM), and that Syt1 is specifically required for the formation of the SNAP-25-dependent docking complex (Chieregatti et al., 2002
; this article). In the model, it is predicted that, after docking, additional ATP- and Ca2+-dependent steps lead to the formation of the SNARE complex and fusion (Klenchin and Martin, 2000
).
In agreement with the in vitro data showing that SNAP-23 supports granule docking at low Ca2+, it is found that overexpressed SNAP-23 leads to an increase of granule exocytosis in the absence of elevated intracellular Ca2+. This observation indicates that the ability of endocrine cells to store granules at resting [Ca2+] and, therefore, to release them in response to elevated Ca2+, is controlled by SNAP-23 expression level. The high apparent Ca2+ affinity of Syt7 and Syt3 and their ability to function in the SNAP-23-dependent docking in the absence of Syt1 can explain for the first time how both the docking and the fusion steps of regulated exocytosis, a process classically known as Ca2+-triggered, can take place at resting [Ca2+]i.
Studies in permeabilized insulinoma cells suggested that SNAP-23 replaces, albeit less efficiently, SNAP-25 activity in hormone secretion (Sadoul et al., 1995
). More recently, it has been reported that in chromaffin cells of SNAP-25 null mice, exogenous SNAP-23 competes with SNAP-25 for participation in granule secretion, but does not support an initial exocytotic burst (Sorensen et al., 2003
). Strikingly, the expression of SNAP-23 in control cells induced a decrease in the burst and overall secretion, indicating that a population of primed vesicles is depleted by expression of SNAP-23. However, in this study, the effect of SNAP-23 expression on granule release at low levels of Ca2+ was not investigated, so the possibility exists that secretion is inhibited by depletion of exocytotic vesicles that are efficiently released at resting Ca2+ levels. This possibility is indeed supported by our observation that the general pool of granules is severely depleted in N2A cells that overexpress SNAP-23, as expected by their enhanced ability to secrete these vesicles in resting conditions.
Recruitment of new vesicles able to fuse with the plasma membrane is a process that occurs both constitutively and in a regulated manner. Regulated exocytosis, a function classically attributed to neurons, endocrine and exocrine cells, is now recognized as a widespread and possibly ubiquitous cellular property (Dan and Poo, 1992
; Chavez et al., 1996
; Borgonovo et al., 2002
). The processes taking place in cells of different type are, however, profoundly different. The extensive work carried out on synaptic vesicle fusion has revealed fundamental aspects that probably have a general importance, adapted, however, to the diverse needs of the other cells. The nature and extent of these adaptations are not well understood. SNAP-23 had already been shown to be involved in the translocation of Glut4 vesicles (Rea et al., 1998
; Foster et al., 1999
; Kawanishi et al., 2000
), an insulin-induced form of vesicle exocytosis that takes place in adipocytes and does not need [Ca2+]i changes. Other forms of regulated exocytosis are known to be independent of increases in [Ca2+]i (Lorenz et al., 2003
). Based on our data, the hypothesis can be put forth that they function via the SNAP-23-Syt3 (or Syt7 or Syt5 or Syt6) interaction. In mast cell an increase in [Ca2+]i supports compound exocytosis by relocating SNAP-23 from plasma membrane lamellipodia-like projections to granule membranes (Guo et al., 1998
). In other cells that express SNAP-23, but not SNAP-25, similar [Ca2+]-dependent relocation mechanisms may function to support regulated exocytosis. For example in fibroblasts, Syt7 has been implicated in Ca2+-dependent exocytosis of lysosomes to repair plasma membrane wounds (Reddy et al., 2001
). SNAP-23 is expressed in fibroblasts and has been proposed to be associated with vimentin filaments that would act as a reservoir to supply the protein to the plasma membrane (Faigle et al., 2000
). More work is still needed to understand how the final steps of constitutive and regulated exocytosis work and how they are related. What is already clear, however, is that one, and possibly the most important mechanism by which the cell governs its regulated exocytotic process is its expression of SNAP-25, SNAP-23, and Syts.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Corresponding author. E-mail address: gb74{at}columbia.edu.
| REFERENCES |
|---|
|
|
|---|
Binz, T., Blasi, J., Yamasaki, S., Baumeister, A., Link, E., Sudhof, T.C., Jahn, R., and Niemann, H. (1994). Proteolysis of SNAP-25 by types E and A botulinal neurotoxins. J. Biol. Chem. 269, 1617-1620.
Bittner, M.A., and Holz, R.W. (1992). Kinetic analysis of secretion from permeabilized adrenal chromaffin cells reveals distinct components. J. Biol. Chem. 267, 16219-16225.
Blasi, J., Chapman, E.R., Yamasaki, S., Binz, T., Niemann, H., and Jahn, R. (1993). Botulinum neurotoxin C1 blocks neurotransmitter release by means of cleaving HPC-1/syntaxin. EMBO J. 12, 4821-4828.[Medline]
Borgonovo, B., Cocucci, E., Racchetti, G., Podini, P., Bachi, A., and Meldolesi, J. (2002). Regulated exocytosis: a novel, widely expressed system. Nat. Cell Biol. 4, 955-962.[CrossRef][Medline]
Brickner, J.H., Blanchette, J.M., Sipos, G., and Fuller, R.S. (2001). The Tlg SNARE complex is required for TGN homotypic fusion. J. Cell Biol. 155, 969-978.
Brose, N., Petrenko, A.G., Sudhof, T.C., and Jahn, R. (1992). Synaptotagmin: a calcium sensor on the synaptic vesicle surface. Science 256, 1021-1025.
Brown, H., Meister, B., Deeney, J., Corkey, B.E., Yang, S.N., Larsson, O., Rhodes, C.J., Seino, S., Berggren, P.O., and Fried, G. (2000). Synaptotagmin III isoform is compartmentalized in pancreatic beta-cells and has a functional role in exocytosis. Diabetes 49, 383-391.[Abstract]
Chapman, E.R. (2002). Synaptotagmin: a Ca(2+) sensor that triggers exocytosis? Nat. Rev. Mol. Cell. Biol. 3, 498-508.[CrossRef][Medline]
Chavez, R.A., Miller, S.G., and Moore, H.H. (1996). A biosynthetic secretory pathway in constitutive secretory cells. J. Cell Biol. 133, 1177-1191.
Chen, Y.A., Scales, S.J., Patel, S.M., Doung, Y.C., and Scheller, R.H. (1999). SNARE complex formation is triggered by Ca2+ and drives membrane fusion. Cell 97, 165-174.[CrossRef][Medline]
Chieregatti, E., Witkin, J.W., and Baldini, G. (2002). SNAP-25 and synaptotagmin 1 function in Ca2+-dependent reversible docking of granules to the plasma membrane. Traffic 3, 496-511.[CrossRef][Medline]
Dan, Y., and Poo, M.M. (1992). Quantal transmitter secretion from myocytes loaded with acetylcholine. Nature 359, 733-736.[CrossRef][Medline]
Desai, R.C., Vyas, B., Earles, C.A., Littleton, J.T., Kowalchyck, J.A., Martin, T.F., and Chapman, E.R. (2000). The C2B domain of synaptotagmin is a Ca(2+)-sensing module essential for exocytosis. J. Cell Biol. 150, 1125-1136.
Earles, C.A., Bai, J., Wang, P., and Chapman, E.R. (2001). The tandem C2 domains of synaptotagmin contain redundant Ca2+ binding sites that cooperate to engage t-SNAREs and trigger exocytosis. J. Cell Biol. 154, 1117-1123.
Faigle, W., Colucci-Guyon, E., Louvard, D., Amigorena, S., and Galli, T. (2000). Vimentin filaments in fibroblasts are a reservoir for SNAP23, a component of the membrane fusion machinery. Mol. Biol. Cell 11, 3485-3494.
Foran, P., Lawrence, G.W., Shone, C.C., Foster, K.A., and Dolly, J.O. (1996). Botulinum neurotoxin C1 cleaves both syntaxin and SNAP-25 in intact and permeabilized chromaffin cells: correlation with its blockade of catecholamine release. Biochemistry 35, 2630-2636.[CrossRef][Medline]
Foster, L.J., Yaworsky, K., Trimble, W.S., and Klip, A. (1999). SNAP23 promotes insulin-dependent glucose uptake in 3T3-L1 adipocytes: possible interaction with cytoskeleton. Am. J. Physiol. 276, C1108-C1114.
Fukuda, M., Ogata, Y., Saegusa, C., Kanno, E., and Mikoshiba, K. (2002). Alternative splicing isoforms of synaptotagmin VII in the mouse, rat and human. Biochem. J. 365, 173-180.[CrossRef][Medline]
Gao, Z., Reavey-Cantwell, J., Young, R.A., Jegier, P., and Wolf, B.A. (2000). Synaptotagmin III/VII isoforms mediate Ca2+-induced insulin secretion in pancreatic islet beta-cells. J. Biol. Chem. 275, 36079-36085.
Gerona, R.R., Larsen, E.C., Kowalchyk, J.A., and Martin, T.F. (2000). The C terminus of SNAP25 is essential for Ca(2+)-dependent binding of synaptotagmin to SNARE complexes. J. Biol. Chem. 275, 6328- 6336.
Guo, Z., Turner, C., and Castle, D. (1998). Relocation of the t-SNARE SNAP-23 from lamellipodia-like cell surface projections regulates compound exocytosis in mast cells. Cell 94, 537-548.[CrossRef][Medline]
Inoue, A., Obata, K., and Akagawa, K. (1992). Cloning and sequence analysis of cDNA for a neuronal cell membrane antigen, HPC-1. J. Biol. Chem. 267, 10613-10619.
Jahn, R., and Sudhof, T.C. (1999). Membrane fusion and exocytosis. Annu. Rev. Biochem. 68, 863-911.[CrossRef][Medline]
Kawanishi, M., Tamori, Y., Okazawa, H., Araki, S., Shinoda, H., and Kasuga, M. (2000). Role of SNAP23 in insulin-induced translocation of GLUT4 in 3T3-L1 adipocytes. Mediation of complex formation between syntaxin4 and VAMP2. J. Biol. Chem. 275, 8240- 8247.
Klenchin, V.A., and Martin, T.F. (2000). Priming in exocytosis: attaining fusion-competence after vesicle docking. Biochimie 82, 399- 407.[Medline]
Koticha, D.D., Huddleston, S.J., Witkin, J.W., and Baldini, G. (1999). Role of the cysteine-rich domain of syndet in membrane binding and cellular localization. J. Biol. Chem. 274, 9053-9060.
Koticha, D.D., McCarthy, E.E., and Baldini, G. (2002). Plasma membrane targeting of SNAP-25 increases its local concentration and is necessary for SNARE complex formation and regulated exocytosis. J. Cell Sci. 115, 3341-3351.
Latterich, M., Frohlich, K.U., and Schekman, R. (1995). Membrane fusion and the cell cycle: Cdc48p participates in the fusion of ER membranes. Cell 82, 885-893.[CrossRef][Medline]
Li, C., Ullrich, B., Zhang, J.Z., Anderson, R.G., Brose, N., and Sudhof, T.C. (1995). Ca(2+)-dependent and -independent activities of neural and non- neural synaptotagmins. Nature 375, 594-599.[CrossRef][Medline]
Littleton, J.T., Serano, T.L., Rubin, G.M., Ganetzky, B., and Chapman, E.R. (1999). Synaptic function modulated by changes in the ratio of synaptotagmin I and IV. Nature 400, 757-760.[CrossRef][Medline]
Lorenz, D., Krylov, A., Hahm, D., Hagen, V., Rosenthal, W., Pohl, P., and Maric, K. (2003). Cyclic AMP is sufficient for triggering the exocytic recruitment of aquaporin-2 in renal epithelial cells. EMBO Rep. 4, 88-93.[CrossRef][Medline]
Martelli, A.M., Baldini, G., Tabellini, G., Koticha, D.D., Bareggi, R., and Baldini, G. (2000). Rab3A and Rab3D control the total granule number and the fraction of granules docked at the plasma membrane in PC12 cells. Traffic 1, 976-986.[CrossRef][Medline]
Montecucco, C. (1998). Protein toxins and membrane transport. Curr. Opin. Cell Biol. 10, 530-536.[CrossRef][Medline]
Neher, E. (1998). Vesicle pools and Ca2+ microdomains: new tools for understanding their roles in neurotransmitter release. Neuron 20, 389-399.[CrossRef][Medline]
Olofsson, C.S., Gopel, S.O., Barg, S., Galvanovskis, J., Ma, X., Salehi, A., Rorsman, P., and Eliasson, L. (2002). Fast insulin secretion reflects exocytosis of docked granules in mouse pancreatic B-cells. Pfuegers Arch. 444, 43-51.
Oyler, G.A., Higgins, G.A., Hart, R.A., Battenberg, E., Billingsley, M., Bloom, F.E., and Wilson, M.C. (1989). The identification of a novel synaptosomal- associated protein, SNAP-25, differentially expressed by neuronal subpopulations. J. Cell Biol. 109, 3039-3052.
Perin, M.S., Fried, V.A., Mignery, G.A., Jahn, R., and Sudhof, T.C. (1990). Phospholipid binding by a synaptic vesicle protein homologous to the regulatory region of protein kinase C. Nature 345, 260-263.[CrossRef][Medline]
Ravichandran, V., Chawla, A., and Roche, P.A. (1996). Identification of a novel syntaxin- and synaptobrevin/VAMP-binding protein, SNAP-23, expressed in non-neuronal tissues. J. Biol. Chem. 271, 13300-13303.
Rea, S., Mc Intosh, S., Macaulay, S.L., Martin, L., Ramsdale, T., Baldini, G., and James, D.E. (1998). Syndet: an adipocyte t-SNARE involved in the insulin- induced translocation of Glut-4 to the cell surface. J. Biol. Chem. 273, 18784- 18792.
Reddy, A., Caler, E.V., and Andrews, N.W. (2001). Plasma membrane repair is mediated by Ca(2+)-regulated exocytosis of lysosomes. Cell 106, 157-169.[CrossRef][Medline]
Reist, N.E., Buchanan, J., Li, J., DiAntonio, A., Buxton, E.M., and Schwarz, T.L. (1998). Morphologically docked synaptic vesicles are reduced in synaptotagmin mutants of Drosophila. J. Neurosci. 18, 7662-7673.
Rettig, J., and Neher, E. (2002). Emerging roles of presynaptic proteins in Ca2+-triggered exocytosis. Science 298, 781-785.
Rossetto, O., Caccin, P., Rigoni, M., Tonello, F., Bortoletto, N., Stevens, R.C., and Montecucco, C. (2001). Active-site mutagenesis of tetanus neurotoxin implicates TYR-375 and GLU-271 in metalloproteolytic activity. Toxicon 39, 1151-1159.[Medline]
Sadoul, K., Lang, J., Montecucco, C., Weller, U., Regazzi, R., Catsicas, S., Wollheim, C.B., and Halban, P.A. (1995). SNAP-25 is expressed in islets of Langerhans and is involved in insulin release. J. Cell Biol. 128, 1019-1028.
Schiavo, G., Benfenati, F., Poulain, B., Rossetto, O., Polverino de Laureto, P., DasGupta, B.R., and Montecucco, C. (1992). Tetanus and botulinum-B neurotoxins block neurotransmitter release by proteolytic cleavage of synaptobrevin. Nature 359, 832-835.[CrossRef][Medline]
Schiavo, G., Shone, C.C., Bennett, M.K., Scheller, R.H., and Montecucco, C. (1995). Botulinum neurotoxin type C cleaves a single Lys-Ala bond within the carboxyl-terminal region of syntaxins. J. Biol. Chem. 270, 10566-10570.
Schiavo, G., Stenbeck, G., Rothman, J.E., and Sollner, T.H. (1997). Binding of the synaptic vesicle v-SNARE, synaptotagmin, to the plasma membrane t-SNARE, SNAP-25, can explain docked vesicles at neurotoxin-treated synapses. Proc. Natl. Acad. Sci. USA 94, 997-1001.
Shin, O.H., Rizo, J., and Sudhof, T.C. (2002). Synaptotagmin function in dense core vesicle exocytosis studied in cracked PC12 cells. Nat. Neurosci. 10, 10.
Slepnev, V.I., and De Camilli, P. (2000). Accessory factors in clathrin-dependent synaptic vesicle endocytosis. Nat. Rev. Neurosci. 1, 161-172.[Medline]
Sollner, T., Whiteheart, S.W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., and Rothman, J.E. (1993). SNAP receptors implicated in vesicle targeting and fusion. Nature 362, 318-324.[CrossRef][Medline]
Sorensen, J.B., Nagy, G., Varoqueaux, F., Nehring, R.B., Brose, N., Wilson, M.C., and Neher, E. (2003). Differential control of the releasable vesicle pools by SNAP-25 splice variants and SNAP-23. Cell 114, 75-86.[CrossRef][Medline]
Sudhof, T.C. (2001). Synaptotagmins: why so many? J. Biol. Chem. 5, 5.
Sugita, S., Han, W., Butz, S., Liu, X., Fernandez-Chacon, R., Lao, Y., and Sudhof, T.C. (2001). Synaptotagmin VII as a plasma membrane Ca(2+) sensor in exocytosis. Neuron 30, 459- 473.[CrossRef][Medline]
Sugita, S., Shin, O.H., Han, W., Lao, Y., and Sudhof, T.C. (2002). Synaptotagmins form a hierarchy of exocytotic Ca(2+) sensors with distinct Ca(2+) affinities. EMBO J. 21, 270-280.[CrossRef][Medline]
Tucker, W.C., Edwardson, J.M., Bai, J., Kim, H.J., Martin, T.F., and Chapman, E.R. (2003). Identification of synaptotagmin effectors via acute inhibition of secretion from cracked PC12 cells. J. Cell Biol. 162, 199-209.
Ullrich, B., Li, C., Zhang, J.Z., McMahon, H., Anderson, R.G., Geppert, M., and Sudhof, T.C. (1994). Functional properties of multiple synaptotagmins in brain. Neuron 13, 1281-1291.[CrossRef][Medline]
Voets, T., Toonen, R.F., Brian, E.C., de Wit, H., Moser, T., Rettig, J., Sudhof, T.C., Neher, E., and Verhage, M. (2001). Munc18-1 promotes large dense-core vesicle docking. Neuron 31, 581-591.[CrossRef][Medline]
von Poser, C., Ichtchenko, K., Shao, X., Rizo, J., and Sudhof, T.C. (1997). The evolutionary pressure to inactivate. A subclass of synaptotagmins with an amino acid substitution that abolishes Ca2+ binding. J. Biol. Chem. 272, 14314-14319.
Wang, C.T., Grishanin, R., Earles, C.A., Chang, P.Y., Martin, T.F., Chapman, E.R., and Jackson, M.B. (2001). Synaptotagmin modulation of fusion pore kinetics in regulated exocytosis of dense-core vesicles. Science 294, 1111-1115.
Wang, G., Witkin, J.W., Hao, G., Bankaitis, V.A., Scherer, P.E., and Baldini, G. (1997). Syndet is a novel SNAP-25 related protein expressed in many tissues. J. Cell Sci. 110, 505-513.[Abstract]
Washbourne, P., Pellizzari, R., Baldini, P., Wilson, M.C., and Montecucco, C. (1997). Botulinum neurotoxin types A and E require the SNARE motif in SNAP-25 for proteolysis. FEBS Lett. 418, 1-5.[CrossRef][Medline]
Washbourne, P., et al. (2002). Genetic ablation of the t-SNARE SNAP-25 distinguishes mechanisms of neuroexocytosis. Nat. Neurosci. 5, 19-26.[Medline]
Whitehead, J.P., Molero, J.C., Clark, S., Martin, S., Meneilly, G., and James, D.E. (2001). The role of Ca2+ in insulin-stimulated glucose transport in 3T3-L1 cells. J. Biol. Chem. 276, 27816-27824.
Williamson, L.C., Halpern, J.L., Montecucco, C., Brown, J.E., and Neale, E.A. (1996). Clostridial neurotoxins and substrate proteolysis in intact neurons: botulinum neurotoxin C acts on synaptosomal-associated protein of 25 kDa. J. Biol. Chem. 271, 7694-7699.
Xu, T., Rammner, B., Margittai, M., Artalejo, A.R., Neher, E., and Jahn, R. (1999). Inhibition of SNARE complex assembly differentially affects kinetic components of exocytosis. Cell 99, 713-722.[CrossRef][Medline]
Zhang, X., Kim-Miller, M.J., Fukuda, M., Kowalchyk, J.A., and Martin, T.F. (2002). Ca2+-dependent synaptotagmin binding to SNAP-25 is essential for Ca2+-triggered exocytosis. Neuron 34, 599- 611.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
V. Montana, W. Liu, U. Mohideen, and V. Parpura Single molecule measurements of mechanical interactions within ternary SNARE complexes and dynamics of their disassembly: SNAP25 vs. SNAP23 J. Physiol., May 1, 2009; 587(9): 1943 - 1960. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Nagy, I. Milosevic, R. Mohrmann, K. Wiederhold, A. M. Walter, and J. B. Sorensen The SNAP-25 Linker as an Adaptation Toward Fast Exocytosis Mol. Biol. Cell, September 1, 2008; 19(9): 3769 - 3781. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Delgado-Martinez, R. B. Nehring, and J. B. Sorensen Differential Abilities of SNAP-25 Homologs to Support Neuronal Function J. Neurosci., August 29, 2007; 27(35): 9380 - 9391. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tsuboi and M. Fukuda Synaptotagmin VII modulates the kinetics of dense-core vesicle exocytosis in PC12 cells Genes Cells, April 1, 2007; 12(4): 511 - 519. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Lynch and T. F. J. Martin Synaptotagmins I and IX function redundantly in regulated exocytosis but not endocytosis in PC12 cells J. Cell Sci., February 15, 2007; 120(4): 617 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ahras, G. P. Otto, and S. A. Tooze Synaptotagmin IV is necessary for the maturation of secretory granules in PC12 cells J. Cell Biol., April 24, 2006; 173(2): 241 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukuda, E. Kanno, M. Satoh, C. Saegusa, and A. Yamamoto Synaptotagmin VII Is Targeted to Dense-core Vesicles and Regulates Their Ca2+-dependent Exocytosis in PC12 Cells J. Biol. Chem., December 10, 2004; 279(50): 52677 - 52684. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Rao, C. Huynh, V. Proux-Gillardeaux, T. Galli, and N. W. Andrews Identification of SNAREs Involved in Synaptotagmin VII-regulated Lysosomal Exocytosis J. Biol. Chem., May 7, 2004; 279(19): 20471 - 20479. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||