|
|
|
|
Vol. 15, Issue 6, 2750-2757, June 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



* Department of Biology/Zoology, University of Fribourg, CH-1700 Fribourg, Switzerland;
Institut de Biologie Moléculaire des Plantes du Centre National de la Recherche Scientifique, Unité Propre de Recherche 2357, Université Louis Pasteur, 67084 Strasbourg Cedex, France
Submitted November 17, 2003;
Revised March 15, 2004;
Accepted March 19, 2004
Monitoring Editor: Thomas Fox
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The first question concerning the specificity of tRNA import has been most extensively studied in S. cerevisiae and Tetrahymena thermophila. In yeast, one of two cytosolic tRNALys isoacceptors is imported into mitochondria (Martin et al., 1979
). Import occurs in complex with the precursor of mitochondrial lysyl-tRNA synthetase via the protein import pathway (Tarassov et al., 1995
). Specificity of import is achieved by binding to the lysyl-tRNA synthetase, it requires amino-acylation and specific sequence elements in the acceptor stem and the anticodon loop of the imported tRNALys (Entelis et al., 1998
). In Tetrahymena, one of three nucleus-encoded homologuous tRNAGln isoacceptors, the tRNAGln(UUG), is imported into mitochondria (Rusconi and Cech, 1996b
), and it has been shown that the anticodon of this tRNA is both necessary and sufficient for import (Rusconi and Cech, 1996a
). Only fragmentary results are available for what determines the specificity of tRNA import in plants and trypanosomatids: a point mutation in the acceptor stem of tRNAAla of potato was shown to abolish import in vivo (Dietrich et al., 1996
) and more recently the D-loop and the anticodon region were implicated in import of plant tRNAVal (Delage et al., 2003
). In Leishmania, some studies suggest that the D-stem loop (D-arm) region of tRNAs might contribute to the localization determinants (Lima and Simpson, 1996
; Mahapatra et al., 1998
). Furthermore, analyses of randomized RNA substrates selected for import competence in an in vitro system have been performed but failed to recover sequence elements that could be clearly attributed to specific regions of existing tRNAs (Bhattacharyya et al., 2002
).
The second question of how the extent of import is regulated has only recently been addressed. It was shown that in T. brucei the fraction of a given tRNA that is found in the mitochondrion ranges from 1 to 8% and is independent of the expression level of the tRNA (Tan et al., 2002b
). Comparative analysis of cytosolic and mitochondrial fractions of various trypanosomal and leishmanial tRNAs revealed physical differences in the two populations: mitochondria-specific (Schneider et al., 1994b
; Crain et al., 2002
) as well as of cytosol-specific nucleotide modifications (Kaneko et al., 2003
) were detected. Further experiments suggested that the mitochondria-specific modifications in the anticodon loop are not responsible for mitochondrial targeting but rather reflect a consequence of import (Schneider et al., 1994b
). Interestingly, this seems to be different for the cytosol-specific 2-thiouridines, which are found in the anticodon wobble position of leishmanial tRNAGlu(UUC) and tRNAGln-(UUG), because the two tRNAs carrying these modifications were prevented from being imported in an in vitro system (Kaneko et al., 2003
).
All mitochondrial tRNAs in T. brucei are imported from the cytosol. However, a single cytosol-specific tRNA has been identified. This tRNA corresponds to the eukaryotic initiator tRNAMet (tRNAMet-i) and its cytosolic localization might be due to the fact that it cannot function in the context of the bacterial-type translation system of the mitochondrion (Tan et al., 2002a
). The tRNAMet-i is highly homologous to the elongator tRNAMet (tRNAMet-e), which as all other trypanosomal tRNAs is in part (5.5% of the cellular content) imported into mitochondria (Tan et al., 2002b
). In the present study, we have determined which nucleotides are responsible for the differential in vivo localization of the two tRNAsMet. In addition, it was shown that the same nucleotides also function in the context of two other tRNAs. Furthermore, we present evidence that contrary to the specific cytosolic localization of the tRNAMet-i the extent of import of tRNAMet-e might be mediated by nucleotide modifications.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Transfection of T. brucei
For expression of the tRNA variants derivatives of the pHD-437 plasmid were used that allow stable integration into the trypanosomal rDNA loci (Biebinger et al., 1996
). The KpnI/BamHI fragment of the plasmid was replaced by inserts containing the variant tRNA genes. Variations in tRNA genes were introduced by PCR-mediated mutagenesis and verified by sequencing. All variant tRNAs were expressed containing 261 nucleotides of the 5'-flanking region of the tRNALeu (CAG) gene and their own 3'-flanking region. The constructs were linearized with NotI, electroporated into T. brucei and transformants were selected with phleomycine and cloned as described previously (Beverley and Clayton, 1993
).
Analysis of In Vivo Import
Mitochondrial fractions of wild-type and transgenic cell lines were prepared by digitonin extractions (Tan et al., 2002b
). Washed cells (2 x 108 cells each) were resuspended in 0.5 ml of SoTE (0.6 M sorbitol, 20 mM Tris-HCl, pH 7.5, and 2 mM EDTA). Five percent of the sample (25 µl) was removed to isolate the total RNA. After the addition of 0.475 ml of SoTE containing 0.067% (wt/vol) digitonin, the samples were mixed by pipetting and incubated on ice for 5 min. The suspension was centrifuged (8000 g/5 min/4°C), and the supernatants were discarded. Next, the resulting pellets were resuspended in 500 µl of SoTE containing 1 µg of RNase A and incubated on ice for 15 min. After a final centrifugation, the supernatants were discarded, and RNA was isolated from the pellets. RNA from total cells or isolated mitochondrial fractions was purified by the acidic guanidiumisothiocyanate method as described previously (Chomczyinski and Sacchi, 1987
). Isolated total (0.5 x 107 cell equivalents) and mitochondrial RNA (108 cell equivalents) were resolved on 8 M urea/10% polyacrylamide gels and processed for Northern analysis as described previously (Tan et al., 2002b
). Transgenic tRNAs were detected by specific hybridization by using 5'-endlabeled oligonucleotides.
The following oligonucleotides were used to detect the indicated tRNAs or tRNA variants: wild-type tRNAMet-i, 5'GTTGGTTTCGATCCAACG3'; wildtype tRNAMet-e,5'GTGAGGCTCGAACTCACG3'; tRNAMet variants carrying the tagged D-arm of the tRNAMet-i, 5' CGCTCTTCCCCTGAGCCA3'; tRNAMet variants carrying the tagged D-arm of the tRNAMet-e, 5'CGCTCTGCCGACTGAGCC3'; wild-type tRNALys, 5'GTGGCACCCCCCGTGGGGCTCGAACCCA3'; variant tRNALys, 5'CAACGTCCTCACGGTTAA3'; wild-type tRNAIle, 5'TGCTCCCGGCGGGTTCGAA3'; and variant tRNAIle, 5'CCAACGTCCTTCGGTTCA3'.
Isolation of Native tRNAsMet
To isolate native, fully modified tRNAs, tRNAMet-e and tRNAMet-i present in total RNA fraction (5 µg) and the RNAMet-e present in the mitochondrial RNA fraction (5 µg) were labeled by using the highly efficient and specific 3'-end splint-labeling protocol. In this method, an oligonucleotide (5'AGTGGTGCGATCGGTGAGGCTCGAACTCA 3' for tRNAMet-e and 5'CAAGTGGTCCTTCCGGCCGGAATCGAAC3' for tRNAMet-i) is hybridized to the 3' end of the targeted tRNA where it leaves a 5' overhang. Sequenase will then add the corresponding complementary nucleotide (in our case, a dCTP) to the 3' end of the selected tRNA (Schneider et al., 1994b
). The labeled RNA fractions were then separated on an 8 M urea/10% polyacrylamide gels, the labeled band was localized, cut out, and eluted from the gel.
Analysis of In Vitro Import
A standard in vitro import reaction was performed in 16 µl of SoTE containing 2 mM dithiothreitol, 20 mM MgCl2 and isotonically isolated mitochondria (200 µg of protein) (Hauser et al., 1996
). After the addition of 2 pmol of substrate tRNA the reaction was incubated for 10 min at 27°C in either the absence or the presence of a mixture containing 2 mM ATP, 2 mM pyrophosphate, 0.6 mM creatine phosphate, and 0.7 µg of creatine kinase (Roche Diagnostics, Indianapolis, IN). Subsequently, CaCl2 was added to a final concentration of 2 mM, and the reaction was digested with 45 U of micrococcal nuclease (MBI Fermentas, Lithuania) for 30 min at 27°C. Finally, 1 ml of SoTE containing 4 mM EGTA and 4 mM EDTA was added, the mitochondria were reisolated by centrifugation (20,000 x g/4°C), and the supernatant was removed. The mitochondrial pellet was resuspended in 100 µl of 10 mM Tris-HCl, pH 7.5, containing 1 mM EDTA and 0.2% of SDS. RNA was isolated by phenol extraction and ethanol precipitation and analyzed 8 M urea/10% polyacrylamide gels.
Isolation and Direct Sequencing of tRNAMet-i
Separation of tRNAs by two-dimensional (2D)-PAGE and dot blotting were performed according to Maréchal-Drouard et al. (1995
). Determination of the tRNA sequence was performed using the postlabeling technique described in Stanley and Vassilenko (1978
). Briefly, 100 ng of pure tRNAMet-i was randomly hydrolyzed in the presence of 3 µl of formamide for 2 min at 85°C. After lyophilization, the generated tRNA fragments were 5'-end labeled using T4 polynucleotide kinase and separated on a 7 M urea/15% polyacrylamide gel. The gel was analyzed by autoradiography and each band containing a 5'-endlabeled tRNA fragment was cut out and eluted. The eluted tRNA fragments were then digested to completion by using 0.1 µg of nuclease P1. The reaction was performed at 22°C for 16 h in a buffer containing 50 mM ammonium acetate at pH 5.3. Identification of the labeled 5'-end nucleotide of each fragment was achieved by one- or two-dimensional thin layer chromatography (TLC) analysis as described previously (Nishimura, 1979
).
| RESULTS |
|---|
|
|
|---|
|
In Vivo Localization of tRNAMet-i Variants
In a first series of experiments cell lines expressing variants of tRNAMet-i carrying the acceptor stem, the D-arm, the anticodon stem loop or the T-stem loop (T-arm) of the imported tRNAMet-e were produced. Total and mitochondrial RNA from the transgenic cell lines where analyzed for the presence of the corresponding tRNAMet-i variants by using specific oligonucleotide hybridization. Figure 1B shows that the T-arm of the imported tRNAMet-e is sufficient to confer a mitochondrial localization to the normally cytosol-specific tRNAMet-i. The three other domains of the tRNAMet-e do not seem to contain targeting information. The bottom two panels of Figure 1B show the intracellular distribution of wildtype tRNAMet-i, which serves as cytosolic marker, and that of wild-type tRNAMet-e, respectively. Comparison of the hybridization signals on the top and bottom panels of the right column of Figure 1B indicate that the tRNAMet-i variant that carries the T-arm of the tRNAMet-e is imported with comparable efficiency than the wild-type tRNAMet-e. In a further analysis, we tested whether the whole T-arm is required for targeting of tRNAsMet. Four cell lines expressing variants of tRNAMet-i carrying the T-loop (1), the T-stem together with the variable loop (2), the T-stem only (3), or the single T-stem nucleotide pair A52:62U (4) of the imported tRNAMet-e were established. Analysis of total and mitochondrial RNA of the four transgenic cell lines indicates that it is the T-stem alone that contains the localization determinants (Figure 1C).
The T-stem of the tRNAMet-i and the tRNAMet-e differ by two nucleotide pairs only (Figure 1A). Further dissection of the T-stem localization determinants shows that the tRNAMet-i variant carrying the single tRNAMet-e-derived nucleotide pair A52:62U remained in the cytosol (Figure 1C, far right), whereas the tRNAMet-i variant carrying the tRNAMet-e nucleotide pair G51:63C was imported, albeit less efficiently than the wild-type tRNAMet-e (Figure 3B, right) (Note that the tRNAMet-i variant carrying the G51:C63 nucleotide pair of the tRNAMet-e is identical to the tRNAMet-i variant carrying the T-stem of the tRNALys). This suggests that it is the 51:63 nucleotide pair that plays the most important role in localization. The imported tRNAMet-i variants carrying the T-stem of the tRNAMet-e seem to be few nucleotides shorter than their cytosolic counterparts. The reason for this is not clear, but a possible explanation would be that the tRNAMet-i, which in vivo is only found in the cytosol, becomes truncated when present in the mitochondrion. Alternatively, the mobility shift might be caused by some mitochondria-specific nucleotide modification. Interestingly, however, the same shift was not observed for the tRNAMet-i variant shown in Figure 3B, right.
|
Finally, we also did the converse experiments. Variants of the tRNAMet-e carrying the T-arm or the T-stem only of the cytosolic tRNAMet-i were expressed and shown to be largely retained in the cytosol (Figure 2). It should be mentioned, though, that some residual import is still observed for the variant tRNAMet-e that carries the T-stem of the tRNAMet-i (Figure 2, right), indicating a minor but detectable role of the T-loop in the localization of the tRNAsMet.
|
In summary, the in vivo results show that the T-arm of the trypanosomal tRNAsMet is both necessary and sufficient to specify the localization of the tRNAsMet.
In Vivo Localization of Variant tRNALys and tRNAIle
Do the T-arm localization determinants of the tRNAMet-i also function in the context of other tRNAs? To test this, we chose the tRNALys of which 3.5% and the tRNAIle of which 8.5% are imported into mitochondria (Tan et al., 2002b
). Cell lines were established that express variants of the two tRNAs that carry the T-arm of the cytosolic tRNAMet-i (Figure 3A). Cell fractionation and Northern analysis show that both of these molecules are retained in the cytosol (Figure 3, B and C, left column). Furthermore, we also prepared cell lines expressing variant tRNAsMet-i carrying the T-stem of either the tRNALys (as discussed above, this tRNA is identical to the tRNAMet-i variant carrying the G51:C63 of the tRNAMet-e) or the tRNAIle and showed that both of these were imported into mitochondria. However, whereas the T-stem of the tRNALys induced import whose extent was comparable with that of wild-type tRNALys (Figure 3B, right column), the tRNAMet-i containing the T-stem of the tRNAIle was less efficiently imported than wild-type tRNAIle (Figure 3C, right column).
Localization of tRNAMet-i Is Independent of Nucleotide Modifications
It was recently shown that cytosol-specific 2-thiouridines that are found in the anticodon wobble position of leishmanial tRNAGlu(UUC) and tRNAGln(UUG) prevent in vitro import of these tRNAs (Kaneko et al., 2003
), suggesting that nucleotide modifications may act as anti-import determinants. To test whether modified nucleotides might also be responsible for the exclusive cytosolic localization of the tRNAMet-i, we determined the nucleotide modification in the T-arm region of T. brucei wild-type tRNAMet-i. To that end, the tRNAMet-i was isolated by 2D-gel electrophoresis (Figure 4A) and sequenced using the technique described by Stanley and Vassilenko (1978
). This method allows to simultaneously identify the position and the nature of most modified nucleotides (for details, see MATERIALS AND METHODS). The results in Figure 4B show that nucleotide modifications were detected at position 55 (corresponding to a pseudouridine) and at position 58, which according to 2D TLC (Nishimura, 1979
), most likely corresponds to a derivative of 1-methyladenosine [m(1)A] (our unpublished data). The nucleotide at position 46 in the variable loop could not be determined due to a compression of the nucleotide ladder in the first dimension. Most importantly, however, it is clear that no modified nucleotides are present within the T-stem itself. Furthermore, none of the detected modifications in the T-loop are expected to be specific for the tRNAMet-i. Indeed, the pseudouridine probably occurs in all tRNAs (Sprinzl et al., 1996
), and a m(1)A at position 58 has been detected in many different tRNAs, including the tRNAMet-i and tRNAMet-e (Anderson et al., 2000
). Thus, it is unlikely that changing the two T-stem nucleotide pairs that are responsible for the in vivo localization of tRNAMet-i will have any effect on the modification pattern of the tRNAMet-i variants. To confirm that the in vivo localization determinant does not correspond to a single nucleotide modification, we tested the in vivo import of a mutant tRNAMet-i carrying an A-to-U replacement at position 58. The transgenic tRNAMet-i lacks the m(1)A derivative at position 58 but nevertheless is correctly localized in vivo (Figure 4D, left). A survey of the literature shows that the only nucleotide modification described for the T-stem is found in tRNAsMet-i of yeast and plants and consists of an unusual 2'-O-phosphoribosyl purine [R(p)] at position 64. The function of Rp(p) is to prevent binding of the tRNAMet-i to eukaryotic elongation factor 1 (eEF1) (Forster et al., 1993
; Astrom and Bystrom, 1994
). Rp(p) is a large and complex modification that due to chemical instability might have been missed in our analysis shown in Figure 4B. To exclude this, we produced a cell line expressing a mutant tRNAMet-i containing the inversed base pair 50A:64U instead of the wild-type 50U:64A. This tRNAMet-i variant lacks any putative R(p) modification but nevertheless remains cytosol specific (Figure 4D, right).
|
In Vitro Import of Isolated tRNAMet
Analysis of transgenic trypanosomes expressing different tRNAMet variants allowed to identify the two adjacent unmodified T-stem nucleotide pairs (51:63 and 52:62) as the determinants for in vivo localization. In a next step, we tested whether tRNAMet variants that are in vivo either cytosolic or in part mitochondrially localized can be imported into isolated mitochondria. Preliminary experiments showed that in vitro transcripts of all tRNAsMet were imported (our unpublished data). Import of in vitro transcribed tRNAMet-i is unexpected, because in vivo the tRNA is cytosol specific. At present, we cannot explain these results. However, it is unlikely that in vitro import of tRNAMet-i is due to the lack of nucleotide modifications in the in vitro transcript because the in vivo localization determinants of tRNAMet-i do not consist of modified nucleotides (Figure 4). A potential trivial explanation for the results might therefore be that in vitro transcripts cannot efficiently adopt a native-like tRNA structure. In any case, these results show that, if in vitro-transcribed tRNAs are used for in vitro import experiments, the results may not automatically be applicable to the in vivo situation.
If isolated instead of in vitro transcribed tRNAsMet were used for in vitro import, the obtained results are compatible with the in vivo analysis. No import was observed for either the tRNAMet-i or the tRNAMet-e isolated from cytosolic RNA, whereas the tRNAMet-e isolated from the mitochondrial fraction was imported (Figure 5). Because the cytosolic and the mitochondrial tRNAMet-e derive from the same gene, these results suggest that, although nucleotide modifications are not involved in the localization of the tRNAMet-i (Figure 4), they may in analogy to the situation for tRNAGlu/Gln in Leishmania tarentolae (Kaneko et al., 2003
) be responsible for the lack of import of isolated cytosolic tRNAMet-e.
|
| DISCUSSION |
|---|
|
|
|---|
Our analysis of in vivo import of trypanosomal tRNAsMet confirms that the targeting determinants are localized within the coding sequence. Furthermore, the fact that tRNAMet-e and tRNAMet-i, despite their distinct intracellular localizations, are aminoacylated by the same enzyme suggests the methionyl-tRNA synthetase is not involved in import. Most importantly, our study identified the two T-stem nucleotide pairs (51:63 and 52:62) as elements that are both necessary and sufficient to specify the mitochondrial or cytosolic localization of the trypanosomal tRNAsMet. Further dissection of the elements suggests that the 51:63 is the more important of the two nucleotide pairs. T-stem localization determinants of the tRNAMet-i were also functional in the context of the tRNALys and tRNAIle. The tRNAIle is the same tRNA whose mitochondrial localization in L. tarentolae could not be changed by transplantation of the D-arm of the cytosolic tRNAGln(CUG) (Lima and Simpson, 1996
). Interestingly, the nucleotide pair U51:A63 is essentially unique for the cytosolic tRNAMet-i and is only found in one, the tRNAAsn(GUU), of the 40 known trypanosomal elongator tRNAs (Figure 6). tRNAAsn(GUU) is in part imported into mitochondria, indicating that in this case the T-stem localization determinants are not functional.
|
In summary, our work, for the first time, identified a specific region in a T. brucei tRNA that 1) when transplanted from a cytosolic to an imported tRNA, prevents its import; and 2) when transplanted from an imported to a cytosolic tRNA, induces its import.
How is the specificity of tRNA import determined in other organisms? The best studied case is Tetrahymena where a quantitative in vivo analysis has shown that the anticodon UUG of the imported tRNAGln is both necessary and sufficient to induce import of any of the three tRNAGln isoacceptors (Rusconi and Cech, 1996a
). However, whether the same determinant also works in the context of other tRNAs is not known. As discussed in Introduction, import of the tRNALys into yeast mitochondria requires aminoacylation and specific sequence elements in the acceptor stem and the anticodon loop (Entelis et al., 1998
). Recent work in higher plants indicated the importance of the D-arm as well as the anticodon for in vivo localization of the tRNAVal (Delage et al., 2003
). Thus, these results illustrate that, as might be expected due to the polyphyletic evolutionary origin of mitochondrial tRNA import (Schneider and Maréchal-Drouard, 2000
), the in vivo localization determinants are not conserved between different species.
In Vitro Import Experiments
The specificity of mitochondrial tRNA import in trypanosomatids has also been investigated in reconstituted systems. As illustrated below, the results were in many respects different from the ones obtained in vivo.
In vitro import of tRNALeu(CAA) into mitochondria of T. brucei requires a 5' extension (Yermovsky-Kammerer and Hajduk, 1999
), whereas in vivo experiments showed that the 5'-flanking sequence of the same tRNA can be replaced without affecting import (Tan et al., 2002b
).
In Leishmania, a short sequence element in the D-arm has been proposed as an import signal for the tRNATyr (Mahapatra et al., 1998
), and based on these and other results, a consensus purine-rich D-arm motif was suggested to be a general import determinant (Bhattacharyya et al., 2002
). The motif is claimed to be absent from yeast tRNAs, which were not able to compete for in vitro import of leishmanial tRNAs. However, the in vivo significance of the putative D-arm motif was questioned by a sequence analysis that failed to find a conserved D-arm motif, which as expected for an import determinant would consistently be present in imported trypanosomatid tRNAs but be absent from nonimported and yeast tRNAs (Suyama et al., 1998
).
-Finally, the interpretation of results obtained in in vitro assays is complicated by the fact that small RNA transcripts are imported independently of their sequence as was reported by two groups (Nabholz et al., 1999
; Rubio et al., 2000
).
In summary, it is clear that when in vitro systems are used to study the specificity of tRNA import in trypanosomatids, the results may not automatically be applicable to the in vivo situation. We believe that one reason for this might be the fact that in all discussed studies in vitro transcribed tRNAs were used as substrates in the in vitro assays, because by using isolated tRNAMet as substrates (Figure 5), we have obtained results that are compatible with the in vivo situation.
Import or Retention Signal?
There are two principally different ways of how the T-stem localization determinants could function: 1) they could act as retention signal and prevent import of cytosolic tRNA, or 2) they could act as a positive import signal in all imported tRNAs. In the first case, specificity might be mediated by a factor binding to tRNAMet-i only, whereas in the second case we expect to find a factor that specifically binds imported tRNAs. The results of the in vitro import experiments shown in Figure 5 argue against a soluble retention factor because a comparable import specificity than in vivo is obtained in the reconstituted system even though it is devoid of cytosolic factors. However, it is possible that some factors remain associated with the mitochondrial membranes during isolation; therefore, no definitive conclusions can be drawn.
Interestingly, in T. brucei all elongator tRNAs are in part imported, whereas the single tRNAMet-i is not (Tan et al., 2002b
). Could the import specificity therefore be linked to the initiation or elongation function of tRNAs? For a tRNAMet-i to be functional in initiation it needs 1) to interact with eukaryotic initiation factor 2 (eIF2) (Farruggio et al., 1996
), and 2) to be excluded from binding to eEF1 (Drabkin et al., 1998
). Elongator tRNAs, on the other hand, selectively interact with eEF1. In trypanosomes, the situation is complicated by the fact that T. brucei elongator tRNAs, because they are used in cytosolic and mitochondrial translation, are expected to bind to both the cytosolic eEF1 and its mitochondrial homologue, elongation factor Tu (EF-Tu). Should the T-stem localization determinants in the tRNAMet-i act as a retention signal, it could be the interaction of the tRNAMet-i with the eIF2 that prevents import. We believe that this is not very likely because a tRNAMet-i variant carrying the acceptor stem of the tRNAMet-e remains in the cytosol (Figure 1B). The A1:U72 nucleotide pair of the acceptor stem, however, is a specific hallmark of eukaryotic tRNAMet-i and one of the most important determinants for binding to eIF2 (Farruggio et al., 1996
). If we assume, on the other hand, that the T-stem localization determinants in the elongator tRNAs act as a positive import signal, import specificity might be mediated by binding to cytosolic eEF1 or to the mitochondrial precursor of the EF-Tu. The main determinants responsible for preventing the binding of vertebrate tRNAMet-i to eEF1 are nucleotides (A50:U64 and U51:A63), which are thought to introduce a sequence-specific perturbation of the sugar phosphate backbone in the T-stem (Drabkin et al., 1998
) and thus overlap with the main cytosolic T-stem localization determinant identified in our work, the nucleotide pair U51:A63. We therefore assume that also in T. brucei this nucleotide pair prevents interaction with either cytosolic eEF1 or the mitochondrial precursor of EF-Tu.
Surprisingly, the tRNAAsn(GUU) contains the cytosolic T-arm localization determinants and is therefore predicted not bind to eEF1. Nevertheless, it is imported into mitochondria and clearly functions in translation elongation (it is the only known tRNAAsn in T. brucei) (Tan et al., 2002b
). This suggests that the antideterminants for eEF1 binding are masked by some unknown structural feature specific for the tRNAAsn(GUU), which may explain why the tRNA can function in translation elongation and why it is imported into mitochondria.
Thus, it is a reasonable hypothesis that eEF1 or the precursor of EF-Tu might be responsible for the observed specificity of mitochondrial tRNA import. However, direct experimental evidence is missing, and it can at present not be excluded that the import specificity is mediated by as yet unknown proteins.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Corresponding author. E-mail address: andre.schneider{at}unifr.ch.
| REFERENCES |
|---|
|
|
|---|
Astrom, S.U., and Bystrom, A.S. (1994). Rit1, a tRNA backbone-modifying enzyme that mediates initiator and elongator tRNA discrimination. Cell 79, 535-546.[CrossRef][Medline]
Beverley, S.M., and Clayton, C.E. (1993). Transfection of Leishmania and Trypanosoma brucei by electroporation. Methods Mol. Biol. 21, 333-348.[Medline]
Bhattacharyya, S.N., Chatterjee, S., and Adhya, S. (2002). Mitochondrial RNA import in Leishmania tropica: aptamers homologous to multiple tRNA domains that interact cooperatively or antagonistically at the inner membrane. Mol. Cell. Biol. 22, 4372-4382.
Biebinger, S., Wirtz, L.E., Lorenz, P., and Clayton, C. (1996). Vectors for inducible expression of toxic gene products in bloodstream and procyclic Trypanosoma brucei. Mol. Biochem. Parasitol. 85, 99-112.
Chomczyinski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159.[Medline]
Crain, P.F., Alfonzo, J.D., Rozenski, J., Kapushoc, S.T., McCloskey, J.A., and Simpson, L. (2002). Modification of the universally unmodified uridine-33 in a mitochondria-imported edited tRNA and the role of the anticodon arm structure on editing efficiency. RNA 8, 752-761.[Abstract]
Delage, L., Duchene, A.M., Zaepfel, M., and Marechal-Drouard, L. (2003). The anticodon and the D-domain sequences are essential determinants for plant cytosolic tRNAVal import into mitochondria. Plant J. 34, 623-633.[CrossRef][Medline]
Dietrich, A., Marechal-Drouard, L., Carneiro, V., Cosset, A., and Small, I. (1996). A single base change prevents import of cytosolic tRNA(Ala) into mitochondria in transgenic plants. Plant J. 10, 913-918.[CrossRef][Medline]
Dietrich, A., Weil, J.H., and Maréchal-Drouard, L. (1992). Nuclear-encoded transfer RNAs in plant mitochondria. Annu. Rev. Cell Biol. 8, 115-131.[CrossRef][Medline]
Drabkin, H.J., Estrella, M., and Rajbhandary, U.L. (1998). Initiator-elongator discrimination in vertebrate tRNAs for protein synthesis. Mol. Cell. Biol. 18, 1459-1466.
Entelis, N.S., Kiefer, S., Kolesnikova, O.A., Martin, R.P., and Tarassov, I.A. (1998). Structural requirements of lysyl-tRNA for its import into yeast mitochondria. Proc. Natl. Acad. Sci. USA 95, 2838-2843.
Farruggio, D., Chaudhuri, J., Maitra, U., and RajBhandary, U.L. (1996). The A1 x U72 base pair conserved in eukaryotic initiator tRNAs is important specifically for binding to the eukaryotic translation initiation factor eIF2. Mol. Cell. Biol. 16, 4248-4256.[Abstract]
Feagin, J.E. (2000). Mitochondrial genome diversity in parasites. Int. J. Parasitol. 30, 371-390.[CrossRef][Medline]
Forster, C., Chakraburtty, K., and Sprinzl, M. (1993). Discrimination between initiation and elongation of protein biosynthesis in yeast: identity assured by a nucleotide modification in the initiator tRNA. Nucleic Acids Res. 21, 5679-5683.
Hancock, K., and Hajduk, S.L. (1990). The mitochondrial tRNAs of Trypanosoma brucei are nuclear encoded. J. Biol. Chem. 265, 19208-19215.
Hauser, R., Pypaert, M., Häusler, T., Horn, E.K., and Schneider, A. (1996). In vitro import of proteins into mitochondria of Trypanosoma brucei and Leishmania tarentolae. J. Cell Sci. 109, 517-523.[Abstract]
Hauser, R., and Schneider, A. (1995). tRNAs are imported into mitochondria of Trypanosoma brucei independent of their genomic context and of their genetic origin. EMBO J. 14, 4212-4220.[Medline]
Kaneko, T., Suzuki, T., Kapushoc, S.T., Rubio, M.A., Ghazvini, J., Watanabe, K., Simpson, L., and Suzuki, T. (2003). Wobble modification differences and subcellular localization of tRNAs in Leishmania tarentolae: implication for tRNA sorting mechanism. EMBO J. 22, 657-667.[CrossRef][Medline]
Kapushoc, S.T., Alfonzo, J.D., Rubio, M.A.T., and Simpson, L. (2000). End processing precedes mitochondrial importation and editing of tRNAs in Leishmania tarentolae. J. Biol. Chem. 275, 37907-37914.
Lima, B.D., and Simpson, L. (1996). Sequence-dependent in vivo import of tRNAs into the mitochondrion of Leishmania tarentolae. RNA 2, 429-440.[Abstract]
Mahapatra, S., Ghosh, S., Bera, S.K., Ghosh, T., Das, A., and Adhya, S. (1998). The D arm of tyrosine tRNA is necessary and sufficient for import into Leishmania mitochondria in vitro. Nucleic Acids Res. 26, 2037-2041.
Marechal-Drouard, L., Small, I., Weil, J.-H., and Dietrich, A. (1995). Transfer RNA import into plant mitochondria. Methods Enzymol. 260, 310-327.[Medline]
Martin, R.P., Schneller, J.-M., Stahl, A.J.C., and Dirheimer, G. (1979). Import of nuclear desoxyribonucleic acid coded lysine-accepting transfer ribonucleic acid (anticodon C-U-U) into yeast mitochondria. Biochemistry 18, 4600-4605.[CrossRef][Medline]
Nabholz, C.E., Horn, E.K., and Schneider, A. (1999). tRNAs and proteins are imported into mitochondria of Trypanosoma brucei by two distinct mechanisms. Mol. Biol. Cell 10, 2547-2557.
Nishimura, S. (1979). Chromatographic mobilities of modified nucleotides. In: Transfer RNA, Structure Properties and Recognition, ed. P. Schimmel, D. Söll, and J. Abelson: Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 547-552.
Rubio, M.A., Liu, X., Yuzawa, H., Alfonzo, J.D., and Simpson, L. (2000). Selective importation of RNA into isolated mitochondria from Leishmania tarentolae RNA. RNA 6, 988-1003.[Abstract]
Rusconi, C.P., and Cech, T.R. (1996a). The anticodon is the signal sequence for mitochondrial import of glutamine tRNA in Tetrahymena. Genes Dev. 10, 2870-2880.
Rusconi, C.P., and Cech, T.R. (1996b). Mitochondrial import of only one of three nuclear-encoded glutamine tRNAs in Tetrahymena thermophila. EMBO J. 15, 3286-3295.[Medline]
Schneider, A., and Maréchal-Drouard, L. (2000). Mitochondrial tRNA import: are there distinct mechanisms? Trends Cell Biol. 10, 509-513.[CrossRef][Medline]
Schneider, A., Martin, J.A., and Agabian, N. (1994a). A nuclear encoded tRNA of Trypanosoma brucei is imported into mitochondria. Mol. Cell. Biol. 14, 2317-2322.
Schneider, A., McNally, K.P., and Agabian, N. (1994b). Nuclear-encoded mitochondrial tRNAs of Trypanosoma brucei have a modified cytidine in the anticodon loop. Nucleic Acids Res. 22, 3699-3705.
Simpson, A.M., Suyama, Y., Dewes, H., Campbell, D.A., and Simpson, L. (1989). Kinetoplastid mitochondria contain functional tRNAs which are encoded in nuclear DNA and also contain small minicircle and maxicircle transcripts of unknown function. Nucleic Acids Res. 17, 5427-5445.
Sprinzl, M., Steegborn, C., Hübel, F., and Steinberg, S. (1996). Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 24, 68-72.
Stanley, J., and Vassilenko, S. (1978). A different approach to RNA sequencing. Nature 274, 87-89.[CrossRef][Medline]
Suyama, Y., Wong, S., and Campbell, D.A. (1998). Regulated tRNA import in Leishmania mitochondria. Biochim. Biophys. Acta 1396, 138-142.[Medline]
Tan, T.H.P., Bochud-Allemannn, N., Horn, E.K., and Schneider, A. (2002a). Eukaryotic-type elongator tRNAMet of Trypanosoma brucei becomes formylated after import into mitochondria. Proc. Natl. Acad Sci. USA 99, 1152-1157.
Tan, T.H.P., Pach, R., Crausaz, A., Ivens, A., and Schneider, A. (2002b). tRNAs in Trypanosoma brucei: genomic organization, expression and mitochondrial import. Mol. Cell. Biol. 22, 3707-3717.
Tarassov, I., Entelis, N., and Martin, R.P. (1995). Mitochondrial import of a cytoplasmic lysine-tRNA in yeast is mediated by cooperation of cytoplasmic and mitochondrial lysyl-tRNA synthetases. EMBO J. 14, 3461-3471.[Medline]
Tarassov, I., and Martin, R. (1996). Mechanisms of tRNA import into yeast mitochondria: an overview. Biochimie 78, 502-510.[Medline]
Yermovsky-Kammerer, A.E., and Hajduk, S. (1999). In vitro import of a nuclearly encoded tRNA into the mitochondrion of Trypanosoma brucei. Mol. Cell. Biol. 19, 6253-6259.
This article has been cited by other articles:
![]() |
R. Geslain, E. Aeby, T. Guitart, T. E. Jones, M. C. de Moura, F. Charriere, A. Schneider, and L. R. de Pouplana Trypanosoma Seryl-tRNA Synthetase Is a Metazoan-like Enzyme with High Affinity for tRNASec J. Biol. Chem., December 15, 2006; 281(50): 38217 - 38225. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chatterjee, P. Home, S. Mukherjee, B. Mahata, S. Goswami, G. Dhar, and S. Adhya An RNA-binding Respiratory Component Mediates Import of Type II tRNAs into Leishmania Mitochondria J. Biol. Chem., September 1, 2006; 281(35): 25270 - 25277. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Charriere, T. H. P. Tan, and A. Schneider Mitochondrial Initiation Factor 2 of Trypanosoma brucei Binds Imported Formylated Elongator-type tRNAMet J. Biol. Chem., April 22, 2005; 280(16): 15659 - 15665. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Esseiva, A. Naguleswaran, A. Hemphill, and A. Schneider Mitochondrial tRNA Import in Toxoplasma gondii J. Biol. Chem., October 8, 2004; 279(41): 42363 - 42368. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||