![]() |
|
|
Vol. 15, Issue 6, 2842-2852, June 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of Cell Biology and Molecular Biophysics and Biochemistry, Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, Connecticut 06536
Submitted February 10, 2004;
Revised March 30, 2004;
Accepted March 31, 2004
Monitoring Editor: Joseph Gall
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In addition to the bona fide Sm proteins, there are other proteins that contain the Sm motif. Sm-like proteins have been found in all sequenced eukaryotic genomes as well as certain archaebacteria (Achsel et al., 1999
; Mayes et al., 1999
; Salgado-Garrido et al., 1999
) and eubacteria (Moller et al., 2002
; Zhang et al., 2002
). A bacterial Sm-like protein, Hfq, forms a homohexameric ring that associates with many small RNAs, facilitating RNA-RNA interactions (Moller et al., 2002
; Zhang et al., 2002
) and protecting the associated small RNAs from nucleases (reviewed by Masse et al., 2003
).
In eukaryotic cells, Sm-like proteins are present in several distinct complexes. One complex, consisting of the seven proteins Lsm2Lsm8 (Lsm stands for Like Sm), binds and stabilizes the 3' end of the spliceosomal U6 snRNA (Pannone et al., 1998
; Achsel et al., 1999
; Mayes et al., 1999
; Salgado-Garrido et al., 1999
; Vidal et al., 1999
). Lsm proteins facilitate the annealing of U6 snRNA with U4 snRNA in vitro and interact with the U4/U6 annealing factor Prp24, suggesting that Lsm proteins function in U4/U6 snRNP formation in vivo (Achsel et al., 1999
; Rader and Guthrie, 2002
). Using electron microscopy, the Lsm2Lsm8 complex appears as a doughnut, similar in size and shape to the core Sm snRNPs. Thus, the Lsm2Lsm8 proteins likely form a heteroheptameric ring (Achsel et al., 1999
).
A second complex of Sm-like proteins, Lsm1Lsm7, functions in mRNA decay (Bouveret et al., 2000
; Tharun et al., 2000
). Capped mRNA degradation intermediates accumulate in yeast containing mutations in these proteins, indicating the Lsm1Lsm7 complex functions in mRNA decapping (Bouveret et al., 2000
; Tharun et al., 2000
). As 3'-shortened mRNAs accumulate in mutant strains, the Lsm1Lsm7 complex may protect 3' ends of deadenylated mRNAs from nucleases (Bouveret et al., 2000
; He and Parker, 2001
). Immunofluorescence experiments reveal that Lsm1p is mostly cytoplasmic, whereas Lsm7p, a component of both complexes, is nuclear and cytoplasmic (Diez et al., 2000
; Tharun et al., 2000
). Within the cytoplasm, Lsm1p localizes to structures called P-bodies, which represent sites of mRNA degradation (Ingelfinger et al., 2002
; Sheth and Parker, 2003
). Thus, the Lsm2Lsm8 complex may be nuclear, consistent with its role as a U6 snRNP component, whereas the Lsm1Lsm7 complex appears largely cytoplasmic.
Experiments in vertebrate cells have identified two additional Lsm protein-containing complexes. The U7 snRNA, which functions in histone 3' end formation, is bound by five Sm proteins and two Sm-like proteins (Pillai et al., 2003
). One Sm-like protein, Lsm11, contributes to histone 3' end processing (Pillai et al., 2003
). In Xenopus oocytes, an Lsm complex binds the U8 small nucleolar RNA (snoRNA), a member of the box C/D class of snoRNAs (Tomasevic and Peculis, 2002
). Six Lsm proteins (Lsm24 and Lsm68) were identified in this complex, making it unclear whether the Lsm2Lsm8 complex has a second function or whether an unidentified Lsm protein confers specificity for U8 (Tomasevic and Peculis, 2002
). The role played by Lsm proteins in the biogenesis and/or function of U8 snoRNA is unknown.
The total number of Lsm-containing complexes in eukaryotic cells as well as the roles they play, is unknown. In yeast, a small fraction of the precursor to RNase P RNA, which functions in pre-tRNA processing, is bound by Lsm2Lsm7 proteins (Salgado-Garrido et al., 1999
). However, as the amount of pre-RNase P bound is very low (12%), the significance of this association for RNase P biogenesis is unclear. As depletion of essential Lsm proteins results in accumulation of certain pre-tRNAs and tRNA degradation products, defects in rRNA processing, and loss of certain U3 snoRNA precursors, Lsm proteins have been proposed to contribute to the maturation of all these RNAs (Kufel et al., 2002
, 2003a
, 2003b
).
Here we report that a novel Lsm complex resides in yeast nucleoli. We demonstrate that six Lsm proteins, Lsm2Lsm7, associate with the small nucleolar RNA (snoRNA) snR5. This RNA is a member of the box H/ACA class of snoRNAs that function in pseudouridylation of rRNA. There are >20 box H/ACA snoRNAs in yeast, all of which are bound by four core proteins: Gar1p, Nhp2p, Nop10p, and the pseudouridine synthase Cbf5p (reviewed by Kiss, 2001
). Approximately half the snR5 RNA in cells is bound by Lsm proteins. The Lsm complex bound to snR5 is distinct from the Lsm2Lsm8 and Lsm1Lsm7 complexes, because neither Lsm1p nor Lsm8p are associated with the snoRNA. Experiments in which binding of Lsm proteins to snR5 was reconstituted in vitro reveal that the 3' end of snR5 is required for Lsm protein recognition. We demonstrate that components of the Lsm2Lsm7 complex are present in nucleoli. Interestingly, biochemical fractionation and immunoprecipitation experiments suggest that at least some of the Lsm2Lsm7/snR5 complex is distinct from the fraction of snR5 bound by Gar1p and Nhp2p. Consistent with a separate complex, Lsm proteins are not required for the function of snR5 in pseudouridylation. Our experiments suggest that in addition to the Lsm1Lsm7 and Lsm2Lsm8 complexes, an Lsm2Lsm7 complex resides in nucleoli, contributing to the biogenesis or function of certain snoRNAs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
lsm8::HIS3 ura3 lys2 ade2 trp1 his3 leu2 carrying p22myc) contains myc-tagged Lsm8p (Pannone et al., 1998
trp1
1 his3-11-15 ura3-1 leu2-3-112 ade2-1 can1-100), AEMY31 (MAT
trp1
1 his3-11-15, ura3-1 leu2-3-112 ade2-1 can1-100 lsm3
::TRP1 pBM125-HA:Lsm3), AEMY33 (MAT
trp1
1 his3
20015 ura3-1 leu2-3-112 ade2-1 can1-100 lsm2
::HIS3 pBM125-LSM2-HA), and AEMY46 (MAT
trp1
1 his3-11-15 ura3-1 leu2-3-112 ade2-1 can1-100 lsm8
::TRP1 pBM125-HA:LSM8) were gifts of J. Beggs (University of Edinburgh). Strains described in this work are BP17 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM2::MYC3), BP18 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM3::MYC3), BP19 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM6::MYC3), BP22 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM5::MYC3), BP23 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM4::MYC3), BP27 (MATa ura3 lys2 ade2 trp1 his3 leu2 SMB1::MYC3,URA3), BP28 (MATa ura3 lys2 ade2 trp1 his3 leu2 snr5::URA3), BP29 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM1::MYC3,URA3), BP30 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM7::MYC3,URA3), BP31 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM9::MYC3,URA3), BP32 (MATa ura3 lys2 ade2 trp1 his3 leu2 SMD2::MYC3,URA3), DNY7 (MATa ura3 lys2 ade2 trp1 his3 leu2 lsm6::URA3), DNY10 (MAT
ura3 lys2 ade2 trp1 his3 leu2 lsm7::TRP1), DNY11 (MAT
ura3 lys2 ade2 trp1 his3 leu2 lsm5::HIS3), CF1 (MAT
ura3 lys2 ade2 trp1 his3 leu2 lsm6::HIS3), CF2 (MATa ura3 lys2 ade2 trp1 his3 leu2 SMX3::MYC3), CF3 (MATa ura3 lys2 ade2 trp1 his3 leu2 SMX2::MYC3,URA3), CF4 (MATa ura3 lys2 ade2 trp1 his3 leu2 SME1::MYC3), CF38 (MAT
ura3 lys2 ade2 trp1 his3 leu2 GAR1::HA3,KANMX6), CF44 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM4::MYC3 GAR1::HA3,KANMX6), CF46 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM5::MYC3 GAR1::HA3,KANMX6), CF49 (MAT
ura3 lys2 ade2 trp1 his3 leu2 LSM8::MYC3,URA3 GAR1::HA3,KANMX6), CF126 (MAT
ura3 lys2 ade2 trp1 his3 leu2 LSM8::yEGFP,KANMX6 pRS314-DSRED-NOP1), CF128 (MAT
ura3 lys2 ade2 trp1 his3 leu2 LSM5::yEGFP,KANMX6 pRS314-DSRED-NOP1), CF132 (MAT
ura3 lys2 ade2 trp1 his3 leu2 LSM4::yEGFP,KANMX6 pRS314-DSRED-NOP1), and CF169 (MATa ura3 lys2 ade2 trp1 his3 leu2 LSM4::MYC3 GAL1::HA3GAR1, KANMX6).
Construction of Epitope-tagged Proteins, Immunoprecipitations, and Gradients
Three copies of the c-myc epitope were integrated at the C-terminus of Lsm and Sm proteins. For each protein, the forward primer contained the last 60 nt of the ORF followed by AGGGAACAAAAGCTGG, which is complementary to sequences in pMPY-3xMYC (Schneider et al., 1995
). The reverse primer contained 60 nt downstream of the ORF up to and including the stop codon, followed by CTATAGGGCGAATTGG, which is complementary to pMPY-3xMYC. Each amplified DNA contained the last 60 base pairs of Lsm or Sm coding sequence, three copies of the c-myc epitope, URA3, a second copy of the 3X-myc epitope, and 60 base pairs of downstream sequence. DNA was transformed into CY3 or a wild-type diploid strain and transformants selected on synthetic complete (SC) media lacking uracil. For epitope-tagged LSM2, LSM3, LSM4, LSM5, LSM6, SME1, and SMX3, the URA3 gene and the second copy of the 3X-myc epitope were eliminated by growth on 5-fluoroorotic acid. For LSM7, SMD2, SMD3, and SMX2, URA3 was not removed. Tagging with yEGFP and 3xHA was as described (Knop et al., 1999
) using pYM12 for yEGFP and pYM1 for 3xHA. Forward primers contained the last 4560 nt of the ORF followed by CGTACGCTGCAGGTCGAC, which is complementary to pYM1 and pYM12. Reverse primers contained 4560 nt downstream of the ORF followed by ATCGATGAATTCGAGCTCG, which is complementary to pYM1 and pYM12. Amplified DNA was transformed into CY1, plated on YPD overnight and replica-plated onto YPD-G418 (200 µg/ml). Integration of the GAL1 promoter and (HA)3 epitope upstream of GAR1 was as described (Longtine et al., 1998
) using pFA6a-kanMx6-PGAL13HA. All tagged strains exhibited wild-type growth at 16, 30, and 37°C.
Immunoprecipitations were performed as described (Pannone et al., 1998
) using anti-myc antibodies (Evan et al., 1985
), anti-HA antibodies (BAbCO, Berkeley, CA) and anti-Nhp2p antibodies. Anti-Nhp2p was the gift of Y. Henry (CNRS, Toulouse, France). RNAs in immunoprecipitates were labeled at the 3' end with [32P]pCp (England et al., 1980
). Synthesis of cDNA was as described (O'Brien and Wolin, 1994
). Glycerol gradients (1036%) were performed as described (Yang et al., 2002
).
Depletion of Lsm Proteins and Temperature Shift Experiments
A high copy SNR6 plasmid was constructed by inserting the BamHI fragment from pRS426-SNR6 (a gift of D. Brow, University of Wisconsin) into the same site of YEplac181. For depletions, strains BMA64 and AEMY31 were transformed with YEplac181 or YEplac181-SNR6. Cells were grown in SC-leu containing 2% galactose, grown to OD600 = 0.10.3 at 25°C, spun down, washed twice with water, and transferred to SC-leu media containing 2% glucose at 25°C. Cultures were diluted in SC-leu containing 2% glucose to keep cells in log phase.
For temperature shifts, strains CY1, BP28, DNY7, DNY10, and DNY11 were grown at 30°C to OD600 = 0.3. After shifting to 37°C, cultures were kept in log phase by diluting with YPD. After 7 h, cells were collected and stored at -80°C.
Northerns, Pseudouridylation Assays, and Oligonucleotides
RNA was extracted from yeast using hot phenol and SDS (Ausubel et al., 1998
), fractionated in 5% polyacrylamide/8.3 M urea gels, and transferred to Zetaprobe GT nylon membranes (Bio-Rad, Hercules, CA) in 0.5x TBE at 150 mA for 16 h. Probes were U1: 5' GACCAAGGAGTTTGCAGC 3', U6: 5' AAAACGAAATAAATCTCTTTG 3', RPR1: 5' GACGTCCTACGATTGCAC 3', snR5: 5' ATAGACATATGGAGGCGTG 3', U3: 5' TTCGGTTTCTCACTCTG 3', snR3: 5' TCGATCTTCGTACTGTCT 3', snR8: 5' GCACAGTGAATAGAAGGCATG 3', snR10: 5' CATGGGTCAAGAACGCCCCGGAGGGG 3', snR13: 5' AGTAAAAAAAGGTAGCTTGAG 3', snR30: 5' CCGAAGCGCCATCTAGATGAATACGTGAGGCCC 3', snR31: 5' GTAGAACGAATCATGACC 3', snR37: 5' GATAGTATTAACCACTACTG 3', snR44: 5' GAGGTGTAATCCATAACCGTG 3', snR45: 5' CCTCAGATCGCTCCGAGAAGA 3',
: 5' ATCCTTGCTTAAGCAAATGCGC 3',
: 5' AAGATTTCGTAGTGATAA 3', pre-5.8S: 5' TGAGAAGGAAATGACGCT 3', U33': 5' GTGGTTAACTTGTCA 3'. Quantitation was performed using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Pseudouridylation was assayed by primer extension (Bakin and Ofengand, 1993
) using oligonucleotides 25S1G (site
1003) 5' AATAGGTCAAGGTCATTT 3' and 25S2G (
1123) 5' TACGTTCGGTTCATCCCGC 3'.
In Vitro Assembly
The DNA fragment used to transcribe U5L was described (Xue et al., 2000
). To transcribe U6 snRNA, the plasmid pU62G (gift of Y. Shamoo, Rice University) was cut with DraI. For snR5, a DNA fragment containing snR5 behind the T7 promoter was synthesized using overlapping oligonucleotides. One oligonucleotide contained a T7 promoter, followed by nt 196 of snR5 sequence. The second oligonucleotide encoded the antisense strand of snR5 from nucleotides 19777. After annealing, oligonucleotides were extended using Pfu polymerase. In this construct, the first nt of snR5 was replaced by GG to allow initiation by T7 RNA polymerase. Transcription was performed using 50 µCi of either [
-32P]UTP (for U5L), [
-32P]ATP (for U6), or [
-32P]CTP (for snR5) as described (Yisraeli and Melton, 1989
). DNAs allowing transcription of snR5 RNA fragments were synthesized from overlapping oligonucleotides and transcribed with [
-32P]CTP.
Extracts were prepared from strains CY1, BP17, BP19, BP22, and BP10 as described (Xue et al., 2000
). To examine Lsm binding, 50,000 cpm (15 fmol) of each RNA was incubated with 4 µl extract for 30 min at 23°C in a volume of 10 µl under splicing conditions (Xue et al., 2000
).
In Situ Hybridization and Live Cell Imaging
To create an antisense snR5 probe, the snR5 coding sequence was amplified from genomic DNA and cloned into the EcoRI/BamHI sites of pSP64 to create pSP64 SNR5. To allow transcription of sense RNA, the oligonucleotide used to amplify the snR5 5' end contained a T7 promoter. For antisense snR5 RNA, pSP64 SNR5 was digested with EcoRI, transcribed and labeled with digoxigenin-UTP using the DIG RNA kit (Roche, Indianapolis, IN). For in situ hybridization, cells carrying a Nop1-GFP plasmid (a gift of E. Hurt) were grown to OD600
0.40.8 and fixed with 4% formaldehyde for 1 h. Cells were spheroplasted with 40 µg/ml zymolase 100T and 30 mM
-mercaptoethanol in 100 mM potassium phosphate, pH 7.4, 1.2 M sorbitol for 30 min at 37°C. After plating for 10 min on poly-L-lysinecoated coverslips, cells were rinsed in 0.2x SSC and incubated with hybridization solution (50% formamide, 5x SSC, 1 mg/ml Escherichia coli tRNA, 100 µg/ml heparin, 1x Denhardt's solution, 0.1% Tween-20, 0.1% Triton X-100, 5 mM EDTA, pH 8.0) for 1 h at 22°C, followed by incubation overnight with 5 ng/µl snR5 probe in hybridization solution at 37°C. Coverslips were rinsed in 0.2x SSC, washed three times for 20 min in 0.2x SSC at 37°C, and rinsed in 0.2x SSC. Cells were incubated in blocking buffer (0.1 M Tris-Cl, pH 7.5, 0.15 M NaCl, 5.0% fetal bovine serum) for 5 min and incubated with antidigoxin (Jackson ImmunoResearch Laboratories, West Grove, PA) at 1.3 µg/ml in blocking buffer for 30 min at 37°C. Coverslips were rinsed in wash buffer (0.1 M Tris-Cl, pH 7.5, 0.15 M NaCl, 0.05% Tween-20), washed three times for 10 min at 22°C, incubated with goat anti-mouse AlexaFluor 546 (1:500 in blocking buffer) at 22°C for 1 h, and washed three times for 10 min at 22°C. Coverslips were mounted with VectaShield (Vector Laboratories, Burlingame, CA) containing 1.25 µg/ml DAPI and viewed with an Axioplan2 Zeiss microscope (Thornwood, NY). Images were taken with a Hamamatsu CCD camera (Bridgewater, NJ) using MetaMorph software (Universal Imaging, Downington, PA).
Strains carrying Lsm-GFP fusions were transformed with pRS314 DsRed-Nop1 (a gift of E. Hurt). After growth in SC-trp to OD600 = 0.30.6, 1 ml of culture was spun down and resuspended in 3060 µl of SC-TRP. Cells were placed on a microscope slide and mixed with 2% low melting point agarose in PBS (precooled to 42°C). A coverslip was placed on top, and live cells viewed with a Zeiss LSM 510 confocal laser scanning microscope equipped with krypton/argon laser.
| RESULTS |
|---|
|
|
|---|
200 nts was detected in LSM3(myc)3 and LSM5(myc)3 immunoprecipitates (lanes 4 and 6, asterisk), but not in immunoprecipitates from the untagged and LSM8(myc)3 strains (lanes 3 and 7).
|
Because both the La protein and the Lsm2Lsm8 complex bind the uridylates at the 3' end of U6 snRNA (Achsel et al., 1999
; Vidal et al., 1999
; Wolin and Cedervall, 2002
), it was suggested that binding by the more abundant La to small RNAs ending in uridylates prevents Lsm protein binding (Achsel et al., 1999
). To test this possibility, we performed immunoprecipitations from a LSM3(myc)3 strain lacking the yeast La protein Lhp1p. Although the novel band was present in the immunoprecipitate, no additional major species were detected (lane 5).
The identity of the small RNA in the LSM3(myc)3 and LSM5(myc)3 immunoprecipitates was determined by sequencing cDNAs. The RNA is snR5, a member of the box H/ACA class of snoRNAs (Tollervey, 1987
; Balakin et al., 1996
). To determine whether snR5 associated with other Lsm proteins, we performed immunoprecipitations from strains containing tagged versions of each of the nine Lsm proteins. RNAs in immunoprecipitates were subjected to Northern analysis. snR5 RNA was present in immunoprecipitates from myc-tagged LSM2LSM7 strains (Figure 2A, lanes 49), but was undetectable in immunoprecipitates from myc-tagged LSM1, LSM8 and LSM9 strains (lanes 3, 10, and 11). Reprobing for U1 and U6 RNAs revealed that while U1 was undetectable, U6 RNA was present in tagged LSM2LSM8 immunoprecipitates, as expected (lanes 311, bottom and middle panels).
|
As most characterized Sm-like protein complexes contain seven distinct proteins, we tested whether an Sm protein was the seventh member of the complex. Anti-c-myc immunoprecipitations were performed from strains containing tagged versions of six of the seven Sm proteins (SmB1, SmD2, SmD3, SmE, SmF, and SmG). Although U1 and U6 RNA were present in all immunoprecipitates, snR5 RNA was undetectable (Figure 2A, lane 12 and unpublished data). Immunoprecipitations using an antibody against the seventh protein, Smd1p, also did not reveal snR5 in the immunoprecipitate (lane 13). Thus, only six Lsm proteins associate with snR5 RNA.
To determine the fraction of snR5 bound by Lsm proteins, we compared the portion of snR5 in the immunoprecipitates with that in the supernatants. PhosphorImager quantitation revealed that 56% of the snR5 and 86% of the U6 RNA were immunoprecipitated from the tagged LSM5 strain (Figure 2B, lane 5). As described (Salgado-Garrido et al., 1999
), pre-RNase P RNA, but not the mature RNA, was present at low levels (
12%) in Lsm2Lsm7 immunoprecipitates (lane 5 and unpublished data). In contrast, while
and several U3 RNA precursors were also reported to associate with Lsm proteins at low levels (Kufel et al., 2002
; Kufel et al., 2003b
), we did not detect these RNAs in our immunoprecipitates (Figure 2B, lane 5).
We also examined whether other snoRNAs associate with Lsm proteins. Probing to detect the box H/ACA snoRNAs snR3, snR8, snR10, snR30, snR31, snR37, and snR44 failed to reveal these RNAs in the immunoprecipitates (Figure 2B, see also Figure 5A and unpublished data). Similarly, the box C/D snoRNAs U3, snR13, and snR45 were undetectable (Figure 2B and unpublished data). Thus, although a substantial fraction of snR5 associates with Lsm2Lsm7 proteins, we have not detected significant levels of other mature snoRNAs associated with this complex.
|
An Intact 3' End of snR5 RNA Is Critical for Lsm Protein Binding
To examine the features of snR5 required for Lsm2Lsm7 binding, we determined whether these proteins associate with snR5 in vitro. Using T7 RNA polymerase, we synthesized 32P-labeled snR5 RNA and incubated the RNA in extracts prepared from c-myc-tagged LSM2, LSM5, LSM6, and LSM8 strains. As controls, we included U5L, the longer of two mature forms of U5 snRNA, and U6 snRNA. Immunoprecipitation revealed that snR5 was bound by c-myc-tagged Lsm2, Lsm5, and Lsm6 proteins (Figure 3, lanes 79), but did not associate with tagged Lsm8 (lane 10). In contrast, U6 snRNA was bound by all four proteins (lanes 710).
|
To determine the region of snR5 RNA that was recognized by Lsm proteins, we examined binding to truncated forms of snR5 consisting of nts 186, nts 60140, and nts 110197 (Figure 4A). The 110197 fragment, and to a lesser extent the 60140 fragment, were present in LSM2(myc)3, LSM5(myc)3, and LSM6(myc)3 immunoprecipitates (Figure 4B, lanes 2223 and 1617; also unpublished data). These fragments were not detected in LSM8(myc)3 immunoprecipitates (lanes 18 and 24).
|
To further characterize the binding site, we examined additional mutant RNAs. An snR5 RNA lacking the stem loop between nts 131178 (snR5 1131,178197; Figure 4A), was bound by c-myc-tagged Lsm2, Lsm5, and Lsm6 proteins but was not bound by tagged Lsm8 (Figure 4C, lanes 1012). However, snR5 lacking the last 20 nts (snR5 1177, Figure 4A) failed to associate with Lsm(myc)3 proteins, suggesting the 3' end was required (unpublished data). Similarly, variants of snR5 110197, in which the last 9 nts were deleted (snR5 110188) or converted to Cs (snR5 110188, C9) were not bound by Lsm(myc)3 proteins (Figure 4C, lanes 1618, 2224). As snR5 60140, which lacks the 3' end, associated with Lsm proteins, there may be other determinants for binding that we have not uncovered. For example, nts 132140 in the snR5 60140 construct, which are basepaired in full-length snR5 (Figure 4A), may contain a cryptic binding site that becomes accessible when these nts are single-stranded. Nonetheless, the result that full-length and truncated snR5 RNAs lacking the last 9 nts do not associate with Lsm proteins reveals that these nts are critical for binding.
A Fraction of Lsm-containing snR5 snoRNPs May Lack Box H/ACA Core Proteins
As a box H/ACA snoRNA, snR5 associates with the proteins Gar1, Nhp2, Cbf5, and Nop10 (Kiss, 2001
). We asked whether Lsm proteins and the box H/ACA proteins are found in a single complex with snR5. In initial experiments, immunoprecipitations from LSM4(myc)3, LSM5(myc)3, and LSM8(myc)3 strains were assayed for Nhp2p by Western blotting. Nhp2p was undetectable in the immunoprecipitates, either because it was not associated with Lsm proteins, or was of too low abundance to be detected. Similar experiments using LSM4(myc)3, LSM5(myc)3, and LSM8(myc)3 strains containing influenza hemagglutinin (HA) epitope-tagged Gar1p also failed to detect Gar1p in the immunoprecipitates (unpublished data). In a second approach, we performed sequential immunoprecipitations. First, we established that two sequential immunoprecipitations with antic-myc were sufficient to remove the majority of the Lsm5(myc)3-containing snR5 from the extract (Figure 5A, lanes 13). However,
42% of the remaining snR5 could be immunoprecipitated with anti-Nhp2p (Figure 5A, lane 7), suggesting that a population of Nhp2p-containing snR5 lacks Lsm proteins. Similarly, two immunoprecipitations with anti-Nhp2p removed the majority of the immunoprecipitable snR5 from the extract (lanes 912). The fraction of snR5 that could be immunoprecipitated with anti-Nhp2p was 46%, whereas 72% of snR10, another H/ACA RNA, was immunoprecipitated (lanes 9, 10 and 13, 14). Subsequent immunoprecipitation with anti-c-myc revealed that
35% of the remaining snR5 RNA was bound by Lsm proteins (lane 15). Similar results were obtained using a strain containing c-myc--tagged LSM5 and HA-tagged GAR1 (unpublished data). In these experiments, we cannot exclude the possibility that our failure to quantitatively immunoprecipitate snR5 with anti-Nhp2p, anti-HA or antic-myc antibodies results from masking of the epitopes, rather than absence of these proteins in the snoRNP. Nonetheless, our data suggest that a fraction of the Lsm-associated snR5 RNA may be distinct from the snR5 RNA bound to box H/ACA proteins.
To confirm that the Lsm2Lsm7-associated snR5 RNA and the box H/ACA core protein-associated snR5 represent partly distinct populations, we ran glycerol gradients. As only limited quantities of the anti-Nhp2p antibody were available, we used a strain containing c-myctagged LSM5 and HA-tagged GAR1. After gradient fractionation, samples were divided into three aliquots. Total RNA was extracted from one aliquot, and the other aliquots were subjected to immunoprecipitation with either antic-myc or anti-HA antibodies. For size markers, we examined the sedimentation of the U1 snRNP, (
18S), the U4/U6.U5 tri-snRNP (
25S), and the U3 snoRNP (
12S) (Fabrizio et al., 1994
). Analysis of total RNA revealed that most snR5 was found in the heaviest fractions, 15, with some snR5 also in fractions 711 (Figure 5B, third panel). The majority of snR5 sediments as >25S in gradients, which is larger than the 1417S estimated for two purified box H/ACA snoRNPs, snR42 and snR30 (Watkins et al., 1998
). Thus, in addition to the box H/ACA proteins, other components may associate with snR5 snoRNPs. Lsm5(myc)3-associated snR5 RNA was detected in two peaks, one corresponding to the heaviest fraction 1 and the remainder in fractions 59 (Figure 5B, top panel), between 18S and 25S. In contrast, Gar1-associated snR5 RNA peaked in fraction 3 (>25S) (second panel). The finding that Lsm-associated snR5 sediments differently in gradients from Gar1p-bound snR5 suggests that these may represent separate populations of snR5 RNA.
Localization of snR5 and Lsm Proteins to Nucleoli
As at least part of the Lsm2Lsm7-associated snR5 may be distinct from the snR5 associated with box H/ACA proteins, we used in situ hybridization to determine whether a fraction of snR5 localized outside nucleoli. Using Nop1p-GFP as a nucleolar marker, snR5 was nucleolar in wild-type strains (Figure 6A). The localization of snR5 was unchanged in strains lacking the nonessential Lsm proteins LSM5, LSM6, and LSM7 (Figure 6A and unpublished data), revealing that these proteins are not required for snR5 localization.
|
Previously, yeast Lsm proteins were localized to the nucleus and cytoplasm (Diez et al., 2000
; Tharun et al., 2000
; Sheth and Parker, 2003
). Our finding that snR5 associates with Lsm2Lsm7 suggested these proteins might also be nucleolar, as described for Xenopus Lsm4p (Tomasevic and Peculis, 2002
). We used GFP-tagged LSM4, LSM5, and LSM8 strains and examined their distribution by confocal microscopy. For a nucleolar marker, cells were transformed with a plasmid carrying DsRed-Nop1p. In addition to being distributed throughout the nucleoplasm and cytoplasm, Lsm5p-GFP and Lsm4p-GFP were present in nucleoli (Figure 6B, ac and df, respectively). As described (Sheth and Parker, 2003
), these proteins were also detected in punctate cytoplasmic structures proposed to be sites of mRNA decay. Lsm8p-GFP was concentrated in nuclei although some staining was detected throughout the cell (Figure 6B, gi). Some colocalization of Lsm8p with the DsRed-Nop1 nucleolar marker was observed, mostly in areas where there is a transition from the nucleus to the nucleolus. Thus, in addition to their nuclear and cytoplasmic locations, two Lsm proteins that associate with snR5 are found in nucleoli.
Lsm Proteins Are Not Required for snR5 RNA Accumulation or Its Function in Pseudouridylation
To examine the role of Lsm proteins in snR5 function, we used strains in which LSM2, LSM3, and LSM8 were under control of the glucose-repressible GAL promoter (Mayes et al., 1999
) to deplete the proteins. To distinguish direct effects of depleting Lsm proteins from indirect effects due to lowering U6 levels, we transformed each strain with either a high copy plasmid containing SNR6 or with the vector alone. As reported (Mayes et al., 1999
), GAL::LSM cells slow in growth within 12 h in glucose-containing media. However, in the presence of extra U6 genes, growth was near normal (Figure 7A). Western blotting revealed that Lsm proteins became undetectable in both strains within 8 h after the switch to glucose media. Thus, as described (Mayes et al., 1999
; Pannone et al., 2001
), these Lsm proteins become dispensable for growth in the presence of extra U6 genes.
|
At intervals after the shift to glucose media, RNA was extracted and subjected to Northern analyses. As expected, U6 RNA levels declined during Lsm2, Lsm3, or Lsm8p depletion (Figure 7B, lanes 1521, and unpublished data). However, in cells carrying high copy SNR6, U6 levels were elevated compared with wild-type cells, and remained stable during Lsm protein depletion (Figure 7B, lanes 2228). Examination of snR5 revealed that levels of this RNA were unaffected by Lsm protein depletion (Figure 7B, lanes 1521, and unpublished data). Thus, Lsm2p, Lsm3p, and Lsm8p are not required for snR5 accumulation.
Unexpectedly, we found that certain RNA processing defects previously detected during Lsm protein depletion (Kufel et al., 2002
, 2003a
, 2003b
) were suppressed by U6 RNA overexpression. Specifically, pre-tRNAs accumulate during depletion of essential Lsm proteins, as do intron-containing pre-U3 RNAs (Kufel et al., 2002
, 2003b
). Also, both spliced pre-U3 RNAs and certain rRNA processing intermediates decline during Lsm protein depletion (Kufel et al., 2003a
). As reported, pre-tRNATyrGUA and intron-containing pre-U3 RNA increase during Lsm3p depletion, whereas spliced pre-U3 RNA decreases (Figure 7B, lanes 1521). Similarly, two pre-5.8S rRNA processing intermediates (7S and 6S) decreased (Figure 7B, 1521). However, all these effects were ameliorated when U6 was overexpressed during Lsm3p depletion (Figure 7B, lanes 2228), suggesting these processing anomalies may be indirect effects of lowering U6 levels and inhibiting splicing.
We examined whether Lsm proteins were required for the function of snR5 in pseudouridylation. Modification of 25S rRNA at two sites,
1003 and
1123, requires snR5 (Ganot et al., 1997
). Total RNA from strains depleted of Lsm3p was analyzed for pseudouridines (Figure 7C). After treatment of the RNA with N-cyclohexyl-N-
-(4-methylmorpholinum)-ethylcarbodiimide p-tosylate (CMC), which reacts irreversibly with pseudouridines, sites of modification were detected by primer extension (Bakin and Ofengand, 1993
). Pseudouridylation was efficient at both positions 1003 and 1123 in strains depleted of Lsm3p (Figure 7C).
As snR5 associates with both Lsm proteins and box H/ACA specific proteins, we determined whether depleting essential Lsm proteins resulted in increased binding of box H/ACA proteins to snR5 RNA. At intervals during the shift to glucose media, we performed immunoprecipitations with anti-Nhp2p. No increase in the levels of snR5 bound by Nhp2p was detected during Lsm3p depletion. Similarly, depletion of Gar1p using a GAL::GAR1 LSM4(myc)3 strain did not result in increased levels of snR5 in antic-myc immunoprecipitates (unpublished data).
Although LSM2LSM4 are essential, strains lacking LSM5, LSM6, or LSM7 are viable but temperature sensitive for growth (Mayes et al., 1999
; Salgado-Garrido et al., 1999
). We examined whether LSM5, LSM6, or LSM7 are required for accumulation of snR5 RNA or for its role in pseudouridylation. Cells lacking each of these proteins were grown either at 30°C or examined during growth at the nonpermissive temperature of 37°C. As expected, U6 snRNA levels were slightly reduced at 30°C in strains lacking LSM proteins and were drastically reduced at 37°C. However, snR5 levels were unaffected, as was pseudouridylation at positions 1003 and 1123 in 25S rRNA (unpublished data). Thus, the Lsm2Lsm7 complex does not appear to be required for the accumulation of snR5 RNA or for its role in pseudouridylation.
| DISCUSSION |
|---|
|
|
|---|
Although all well-characterized eukaryotic Sm and Lsm protein complexes contain seven subunits, only six Lsm proteins associate with snR5 and pre-RNase P RNA. One possibility is that an unidentified yeast protein, whose homology to Lsm proteins has escaped detection, forms the seventh member of the complex. Alternatively, one Lsm protein could be present in two copies, resulting in a seven-membered ring. Finally, as described for Hfq (Moller et al., 2002
; Zhang et al., 2002
), the snR5-bound Lsm complex may be a hexamer. Consistent with a hexamer, only six proteins were identified in the Xenopus Lsm complex that binds U8 snoRNA (Tomasevic and Peculis, 2002
).
The finding that both RNAs that bind Lsm2Lsm7, snR5, and pre-RNase P RNA, are nucleolar (Srisawat et al., 2002
; see also Figure 6) suggests that the Lsm2Lsm7 complex functions in nucleoli. For the Lsm1Lsm7 and Lsm2Lsm8 complexes, Lsm1p and Lsm8p are likely responsible for the different subcellular locations of their respective complexes. Similarly, Lsm10, a member of the Sm complex that binds U7 snRNA, may govern localization of U7 to coiled bodies (Pillai et al., 2001
). Thus, an unidentified seventh Lsm protein could confer nucleolar localization of the Lsm2Lsm7 complex. Alternatively, the default subcellular location for Lsm proteins may be nucleoli, with Lsm1p or Lsm8p required to localize the complex elsewhere in cells. As a different set of six Lsm proteins (Lsm2Lsm4 and Lsm6Lsm8) were identified in the complex that binds Xenopus U8 RNA (Tomasevic and Peculis, 2002
), another possibility is that any complex containing only six Lsm proteins will localize to nucleoli.
Our finding that binding of Lsm proteins to snR5 requires the RNA 3' end is consistent with the fact that Lsm2Lsm8 and Lsm1Lsm7 likely associate with the 3' ends of their target RNAs. The 3' end of U6 snRNA is protected by Lsm2Lsm8 proteins from nucleases (Achsel et al., 1999
) and is required for Lsm protein binding in vitro (Vidal et al., 1999
). Similarly, the presence of 3' trimmed mRNAs in lsm mutant strains suggests that Lsm1Lsm7 stabilizes the 3' ends of deadenylated mRNAs from exonucleases (He and Parker, 2001
). To date, the sole exception is the Lsm complex that associates with U8 snoRNA, which requires an internal sequence for efficient binding in vitro (Tomasevic and Peculis, 2002
). One possibility is that Lsm complexes play a general role in stabilizing associated RNAs from nucleases. Our finding that snR5 is stable during Lsm depletion does not negate this possibility, because other proteins may redundantly stabilize this RNA. A role in stabilizing 3' ends would be reminiscent of the La protein, which stabilizes the 3' ends of nascent RNAs ending in UUUOH (Wolin and Cedervall, 2002
). However, our finding that additional RNAs do not become bound by Lsm proteins in strains lacking Lhp1p (Figure 1) indicates that binding of these proteins to RNA 3' ends is not interchangeable.
How many roles do Lsm complexes play in eukaryotic cells? In bacteria, the Sm-like protein Hfq binds a myriad of small RNAs, stabilizing them from degradation, and facilitating basepairing between many of these RNAs and their targets. Hfq is also implicated in the translation and degradation of several mRNAs (reviewed by Masse et al., 2003
). In yeast, Lsm2Lsm8 and Lsm1Lsm7 function in U6 metabolism and mRNA decay, respectively. Because abnormalities in pre-tRNA processing, rRNA processing and U3 snoRNA maturation occur on depletion of essential Lsm proteins, Lsm proteins have also been proposed to function in these processes (Kufel et al., 2002
, 2003a
, 2003b
). However, as overexpression of U6 snRNA suppresses many of the detected changes in processing (Figure 7), these defects may be secondary to the decline in U6 snRNA levels. Nonetheless, our finding that Lsm2Lsm7 associate with about half the snR5 in yeast, coupled with the finding that Xenopus Lsm proteins bind U8 RNA (Tomasevic and Peculis, 2002
), implies an additional function for these proteins in the biogenesis or function of at least a subset of nucleolar RNAs.
What role might Lsm proteins play in snoRNA metabolism? One possibility is that Lsm proteins assist specific snoRNAs in basepairing with their rRNA targets. This role would be consistent with the finding that Hfq assists RNA-RNA pairing (Moller et al., 2002
; Zhang et al., 2002
) and the fact that most small RNAs bound by Sm family members function by basepairing with other RNAs. In this scenario, the fact that rRNA pseudouridylation is unaffected by Lsm protein depletion may reflect redundancy between box H/ACA-specific proteins and Lsm proteins in assisting basepairing. However, although snR5 and U8 snoRNAs base pair with rRNA (Ganot et al., 1997
; Tomasevic and Peculis, 2002
), basepairing has not been described between RNase P and pre-tRNAs. It is also unclear why snR5 and U8, and not the many other snoRNAs that base pair with rRNA, would require Lsm-assisted basepairing. One possibility is that the Lsm2Lsm7 complex interacts transiently with many snoRNAs to facilitate basepairing, but associates stably with snR5, perhaps because the 3' end of snR5 contains a high-affinity site for Lsm protein binding.
A second possibility is that the Lsm2Lsm7 complex assists in the biogenesis of snR5, RNase P, and perhaps additional snoRNAs. A role in snoRNA biogenesis is suggested by the finding that LSM5 has genetic interactions with SRP40, a gene implicated in both box H/ACA and box C/D snoRNA biogenesis (Yang and Meier, 2003
). Possible roles include localization or retention of these snoRNAs in nucleoli and facilitation of RNA maturation or RNP assembly.
Finally, the Lsm2Lsm7 complex may assist snR5, and perhaps pre-RNase P, in functions that are distinct from their roles in rRNA pseudouridylation and pre-tRNA maturation. Consistent with this possibility, our experiments suggest that the Lsm-associated snR5 is at least partly nonoverlapping with the complex formed by snR5 RNA with the box H/ACA-specific proteins Gar1 and Nhp2. Moreover, the fact that Lsm proteins require the last 9 nt of snR5, which contain the conserved ACA box, hints that the binding of box H/ACA snoRNP proteins and Lsm proteins may be mutually exclusive. Interestingly, our gradient fractionations reveal that the Lsm-associated snR5 RNA sediments in complexes ranging from
18S to greater than 25S, suggesting that additional proteins or RNAs are present. Identification of these other components may give insights into the role of the Lsm2Lsm7/snR5 RNA complex in cell function.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
* Corresponding author. E-mail address: sandra.wolin{at}yale.edu.
| REFERENCES |
|---|
|
|
|---|
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (1998). Current Protocols in Molecular Biology. New York: John Wiley & Sons.
Bakin, A., and Ofengand, J. (1993). Four newly located pseudouridylate residues in Escherichia coli 23S ribosomal RNA are all at the peptidyltransferase center: analysis by the application of a new sequencing technique. Biochemistry 32, 9754-9762.[CrossRef][Medline]
Balakin, A.G., Smith, L., and Fournier, M.J. (1996). The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86, 823-834.[CrossRef][Medline]
Bouveret, E., Rigaut, G., Shevchenko, A., Wilm, M., and Seraphin, B. (2000). A Sm-like protein complex that participates in mRNA degradation. EMBO J. 19, 1661-1671.[CrossRef][Medline]
Diez, J., Ishikawa, M., Kaido, M., and Ahlquist, P. (2000). Identification and characterization of a host protein required for efficient template selection in viral RNA replication. Proc. Natl. Acad. Sci. USA 97, 3913-3918.
England, T.E., Bruce, A.G., and Uhlenbeck, O.C. (1980). Specific labeling of 3' termini of RNA with T4 RNA ligase. Methods Enzymol. 65, 65-74.[Medline]
Evan, G.I., Lewis, G.K., Ramsay, G., and Bishop, J.M. (1985). Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. Cell. Biol. 5, 3610-3616.
Fabrizio, P., Esser, S., Kastner, B., and Luhrmann, R. (1994). Isolation of S. cerevisiae snRNPs: comparison of U1 and U4/U6.U5 to their human counterparts. Science 264, 261-265.
Ganot, P., Bortolin, M.L., and Kiss, T. (1997). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89, 799-809.[CrossRef][Medline]
He, W., and Parker, R. (2001). The yeast cytoplasmic LsmI/Pat1p complex protects mRNA 3' termini from partial degradation. Genetics 158, 1445-1455.
Ingelfinger, D., Arndt-Jovin, D.J., Luhrmann, R., and Achsel, T. (2002). The human LSm17 proteins colocalize with the mRNA-degrading enzymes Dcp1/2 and Xrnl in distinct cytoplasmic foci. RNA 8, 1489-1501.[Abstract]
Kiss, T. (2001). Small nucleolar RNA-guided post-transcriptional modification of cellular RNAs. EMBO J. 20, 3617-3622.[CrossRef][Medline]
Knop, M., Siegers, K., Pereira, G., Zachariae, W., Winsor, B., Nasmyth, K., and Schiebel, E. (1999). Epitope tagging of yeast genes using a PCR-based strategy: more tags and improved practical routines. Yeast 15, 963-972.[CrossRef][Medline]
Kufel, J., Allmang, C., Petfalski, E., Beggs, J., and Tollervey, D. (2003a). Lsm Proteins are required for normal processing and stability of ribosomal RNAs. J. Biol. Chem. 278, 2147-2156.
Kufel, J., Allmang, C., Verdone, L., Beggs, J., and Tollervey, D. (2003b). A complex pathway for 3' processing of the yeast U3 snoRNA. Nucleic Acids Res. 31, 6788-6797.
Kufel, J., Allmang, C., Verdone, L., Beggs, J.D., and Tollervey, D. (2002). Lsm proteins are required for normal processing of pre-tRNAs and their efficient association with La-homologous protein Lhp1p. Mol. Cell. Biol. 22, 5248-5256.
Longtine, M.S., McKenzie III, A., Demarini, D.J., Shah, N.G., Wach, A., Brachaat, A., Philippsen, P., and Pringle, J.R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953-961.[CrossRef][Medline]
Lund, E., and Dahlberg, J.E. (1992). Cyclic 2',3' phosphates and nontemplated nucleotides at the 3' end of spliceosomal U6 small nuclear RNA's. Science 255, 327-330.
Masse, E., Majdalani, N., and Gottesman, S. (2003). Regulatory roles for small RNAs in bacteria. Curr. Opin. Microbiol. 6, 120-124.[CrossRef][Medline]
Mathews, D.H., Sabina, J., Zuker, M., and Turner, D.H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911-940.[CrossRef][Medline]
Mayes, A.E., Verdone, L., Legrain, P., and Beggs, J.D. (1999). Characterization of Sm-like proteins in yeast and their association with U6 snRNA. EMBO J. 18, 4321-4331.[CrossRef][Medline]
Moller, T., Franch, T., Hojrup, P., Keene, D.R., Bachinger, H.P., Brennan, R.G., and Valentin-Hansen, P. (2002). Hfq: a bacterial Sm-like protein that mediates RNA-RNA interaction. Mol. Cell 9, 23-30.[CrossRef][Medline]
O'Brien, C.A., and Wolin, S.L. (1994). A possible role for the 60 kd Ro autoantigen in a discard pathway for defective 5S ribosomal RNA precursors. Genes Dev. 8, 2891-2903.
Pannone, B.K., Kim, S.D., Noe, D.A., and Wolin, S.L. (2001). Multiple functional interactions between components of the Lsm2-Lsm8 complex, U6 snRNA, and the yeast La protein. Genetics 158, 187-196.
Pannone, B.K., Xue, D., and Wolin, S.L. (1998). A role for the yeast La protein in U6 snRNP assembly: evidence that the La protein is a molecular chaperone for RNA polymerase III transcripts. EMBO J. 17, 7442-7453.[CrossRef][Medline]
Pillai, R.S., Grimmler, M., Meister, G., Will, C.L., Luhrmann, R., Fischer, U., and Schumperli, D. (2003). Unique Sm core structure of U7 snRNPs: assembly by a specialized SMN complex and the role of a new component, Lsm11, in histone RNA processing. Genes Dev. 17, 2321-2333.
Pillai, R.S., Will, C.L., Luhrmann, R., Schumperli, D., and Muller, B. (2001). Purified U7 snRNPs lack the Sm proteins D1 and D2 but contain Lsm10, a new 14 kDa Sm D1-like protein. EMBO J. 20, 5470-5479.[CrossRef][Medline]
Rader, S.D., and Guthrie, C. (2002). A conserved Lsm-interaction motif in Prp24 required for efficient U4/U6 di-snRNP formation. RNA 8, 1378-1392.[Abstract]
Salgado-Garrido, J., Bragado-Nilsson, E., Kandels-Lewis, S., and Seraphin, B. (1999). Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18, 3451-3462.[CrossRef][Medline]
Schneider, B.L., Seufert, W., Steiner, B., Yang, Q.H., and Futcher, A.B. (1995). Use of polymerase chain reaction epitope tagging for protein tagging in Saccharomyces cerevisiae. Yeast 11, 1265-1274.[CrossRef][Medline]
Seto, A.G., Zaug, A.J., Sobel, S.G., Wolin, S.L., and Cech, T.R. (1999). Saccharomyces cerevisiae telomerase is an Sm small nuclear ribonucleoprotein particle. Nature 401, 177-180.[CrossRef][Medline]
Sherman, F. (1991). Getting started with yeast. Methods Enzymol. 194, 3-21.[CrossRef][Medline]
Sheth, U., and Parker, R. (2003). Decapping and decay of messenger RNA occur in cytoplasmic processing bodies. Science 300, 805-808.
Srisawat, C., Houser-Scott, F., Bertrand, E., Xiao, S., Singer, R.H., and Engelke, D.R. (2002). An active precursor in assembly of yeast nuclear ribonuclease P. RNA 8, 1348-1360.[Abstract]
Tharun, S., He, W., Mayes, A.E., Lennertz, P., Beggs, J.D., and Parker, R. (2000). Yeast Sm-like proteins function in mRNA decapping and decay. Nature 404, 515-518.[CrossRef][Medline]
Tollervey, D. (1987). A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA. EMBO J. 6, 4169-4175.[Medline]
Tomasevic, N., and Peculis, B.A. (2002). Xenopus LSm proteins bind U8 snoRNA via an internal evolutionarily conserved octamer sequence. Mol. Cell. Biol. 22, 4101-4112.
Vidal, V.P., Verdone, L., Mayes, A.E., and Beggs, J.D. (1999). Characterization of U6 snRNA-protein interactions. RNA 5, 1470-1481.[Abstract]
Watkins, N.J., Gottschalk, A., Neubauer, G., Kastner, B., Fabrizio, P., Mann, M., and Luhrmann, R. (1998). Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNPs and constitute a common bipartite structure. RNA 4, 1549-1568.[Abstract]
Will, C.L., and Luhrmann, R. (2001). Spliceosomal UsnRNP biogenesis, structure and function. Curr. Opin. Cell Biol. 13, 290-301.[CrossRef][Medline]
Wolin, S.L., and Cedervall, T. (2002). The La protein. Annu. Rev. Biochem. 71, 375-402.[CrossRef][Medline]
Xue, D., Rubinson, D.A., Pannone, B.K., Yoo, C.J., and Wolin, S.L. (2000). U snRNP assembly in yeast involves the La protein. EMBO J. 19, 1650-1660.[CrossRef][Medline]
Yang, P.K., Rotondo, G., Porras, T., Legrain, P., and Chanfreau, G. (2002). The Shq1p·Naf1p complex is required for box H/ACA small nucleolar ribonucleoprotein particle biogenesis. J. Biol. Chem. 277, 45235-45242.
Yang, Y., and Meier, U.T. (2003). Genetic interaction between a chaperone of small nucleolar ribonucleoprotein particles and cytosolic serine hydroxymethyl-transferase. J. Biol. Chem. 278, 23553-23560.
Yisraeli, J.K., and Melton, D.A. (1989). Synthesis of long, capped transcripts in vitro by SP6 and T7 RNA polymerases. Methods Enzymol. 180, 42-50.[Medline]
Yoo, C.J., and Wolin, S.L. (1997). The yeast La protein is required for the 3' endonucleolytic cleavage that matures tRNA precursors. Cell 89, 393-402.[CrossRef][Medline]
Zhang, A., Wassarman, K.M., Ortega, J., Steven, A.C., and Storz, G. (2002). The Sm-like Hfq protein increases OxyS RNA interaction with target mRNAs. Mol Cell 9, 11-22.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
D. G. Scofield and M. Lynch Evolutionary Diversification of the Sm Family of RNA-Associated Proteins Mol. Biol. Evol., November 1, 2008; 25(11): 2255 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Spiller, M. A. M. Reijns, and J. D. Beggs Requirements for nuclear localization of the Lsm2-8p complex and competition between nuclear and cytoplasmic Lsm complexes J. Cell Sci., December 15, 2007; 120(24): 4310 - 4320. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. COPELA, G. CHAKSHUSMATHI, R. L. SHERRER, and S. L. WOLIN The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability. RNA, April 1, 2006; 12(4): 644 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.L. WOLIN and E.J. WURTMANN Molecular Chaperones and Quality Control in Noncoding RNA Biogenesis Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 505 - 511. [Abstract] [PDF] |
||||
![]() |
S. Tharun, D. Muhlrad, A. Chowdhury, and R. Parker Mutations in the Saccharomyces cerevisiae LSM1 Gene That Affect mRNA Decapping and 3' End Protection Genetics, May 1, 2005; 170(1): 33 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kufel, C. Bousquet-Antonelli, J. D. Beggs, and D. Tollervey Nuclear Pre-mRNA Decapping and 5' Degradation in Yeast Require the Lsm2-8p Complex Mol. Cell. Biol., November 1, 2004; 24(21): 9646 - 9657. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||