![]() |
|
|
Vol. 15, Issue 8, 3642-3657, August 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tubulin Complexes by Pericentrin Controls Spindle Organization and Mitotic Entry
Department of Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts 01605
Submitted November 7, 2003;
Revised April 29, 2004;
Accepted May 3, 2004
Monitoring Editor: Tim Stearns
| ABSTRACT |
|---|
|
|
|---|
tubulin ring complexes (
TuRCs). However, little is known about the molecules that anchor these complexes to centrosomes. In this study, we show that the centrosomal coiled-coil protein pericentrin anchors
TuRCs at spindle poles through an interaction with
tubulin complex proteins 2 and 3 (GCP2/3). Pericentrin silencing by small interfering RNAs in somatic cells disrupted
tubulin localization and spindle organization in mitosis but had no effect on
tubulin localization or microtubule organization in interphase cells. Similarly, overexpression of the GCP2/3 binding domain of pericentrin disrupted the endogenous pericentrin
TuRC interaction and perturbed astral microtubules and spindle bipolarity. When added to Xenopus mitotic extracts, this domain uncoupled
TuRCs from centrosomes, inhibited microtubule aster assembly, and induced rapid disassembly of preassembled asters. All phenotypes were significantly reduced in a pericentrin mutant with diminished GCP2/3 binding and were specific for mitotic centrosomal asters as we observed little effect on interphase asters or on asters assembled by the Ran-mediated centrosome-independent pathway. Additionally, pericentrin silencing or overexpression induced G2/antephase arrest followed by apoptosis in many but not all cell types. We conclude that pericentrin anchoring of
tubulin complexes at centrosomes in mitotic cells is required for proper spindle organization and that loss of this anchoring mechanism elicits a checkpoint response that prevents mitotic entry and triggers apoptotic cell death. | INTRODUCTION |
|---|
|
|
|---|
tubulin and associated proteins that have a ring-like structure and mediate the nucleation of microtubules called
tubulin ring complexes or
TuRCs (Moritz et al., 1995a
tubulin (Sampaio et al., 2001
During cell cycle progression, centrosomes "mature" by recruiting additional
TuRCs and several other proteins, resulting in an increase in the nucleation capacity of the centrosome (reviewed in Blagden and Glover, 2003
). However, we still know very little about proteins that directly anchor
TuRCs to centrosomes in vertebrate cells. In the budding yeast, a small
tubulin complex composed of
tubulin (Tub4p), Spc97p, and Spc98p (
700 kDa) is bound to the nuclear side of the spindle pole body (the centrosome equivalent) through an interaction with Spc110p (Knop and Schiebel, 1997
) and to the cytoplasmic side of the spindle pole body through Spc72p (Knop and Schiebel, 1998
). Spc97p and Spc98p mediate binding of the complex to Spc110p and Spc72p (Knop and Schiebel, 1997
; Knop and Schiebel, 1998
; Nguyen et al., 1998
). Although there is no apparent homology between their SPC97/98 interacting domains, chimeras formed by fusing the binding domain of one with the localization domain of the other can rescue knockouts of the proteins encoding the localization domains, suggesting that the two binding domains are functionally homologous (Knop and Schiebel, 1998
).
TuRCs in vertebrate cells and Drosophila contain orthologues of the three yeast proteins (
tubulin and
complex proteins 2 and 3 [GCP2, 3]) as well as several additional components (Zheng et al., 1995
; Martin et al., 1998
; Moritz et al., 1998
; Murphy et al., 1998
, 2001
; Oegema et al., 1999
; reviewed in Job et al., 2003
). In vertebrates, the centrosome protein pericentrin (pericentrin A) forms a large complex with
tubulin in the cytoplasm, and the two proteins are also in proximity at the centrosome (Dictenberg et al., 1998
). Recent evidence suggests there may be as many as 10 isoforms of pericentrin in human cells (Flory and Davis, 2003
). A large isoform (pericentrin B/kendrin; Flory and Davis, 2003
) and another centrosome protein called AKAP450/GC-NAP share homology with the calmodulin binding domain of Spc110p (Flory et al., 2000
; Gillingham and Munro, 2000
; Li et al., 2001
). Other potential Spc110p orthologues have been identified in Schizosacharomyces pombe, Aspergillus nudulans, and Drosophila based on sequence homology (Flory et al., 2002
; Kawaguchi and Zheng, 2003
) and in vertebrates (Xenopus and human) based on immunological cross-reactivity with Spc110p-specific antibodies (Tassin et al., 1997
). All proposed vertebrate orthologues of Spc110p localize to the centrosome and coimmunoprecipitate with
TuRCs (Tassin et al., 1997
; Dictenberg et al., 1998
; Takahashi et al., 2002
). No Spc72p orthologues have been identified in other species.
In vertebrate cells, pericentrin B and AKAP450 have recently been shown to bind GCP2 in vitro (Takahashi et al., 2002
). Antibody inhibition and immunodepletion studies demonstrated a role for pericentrin isoforms and AKAP450 in microtubule nucleation in vertebrates and Drosophila (Doxsey et al., 1994
; Takahashi et al., 2002
; Kawaguchi and Zheng, 2003
; Keryer et al., 2003
), perhaps by localizing the small Ran GTPase to centrosomes (AKAP450) (Keryer et al., 2003
). However, other studies show that antibody depletion of pericentrin B or reduction of pericentrin A and B do not affect aster formation, microtubule organization, or centrosome-associated
tubulin (Li et al., 2001
; Takahashi et al., 2002
; Dammermann and Merdes, 2002
). Moreover, loss of AKAP450 from centrosomes does not affect centrosomal
tubulin localization, even though microtubule organization is disrupted (Keryer et al., 2003
). Another potential centrosomal
TuRC-anchoring protein has recently been identified in vertebrate cells called ninein-like protein (Nlp), which can bind
TuRC complexes, inhibit nucleation when neutralized with antibodies, and enhance nucleation when overexpressed (Casenghi et al., 2003
). However, we know little about the role of these putative scaffold proteins in centrosomal anchoring of
TuRCs during the cell cycle and the cellular consequences of specifically disrupting their interactions with
TuRCs at centrosomes.
In this study, we show that siRNAs targeting both pericentrin isoforms (A and B) induced specific loss of
tubulin from spindle poles in mitosis, reduction of astral microtubules, and formation of monopolar spindles. This phenotype seemed to be specific for the smaller isoform of pericentrin because it was not observed when the larger pericentrin isoform was specifically reduced. A region at the C terminus of pericentrin interacted with both GCP2 and GCP3 in vitro as shown by coimmunoprecipitation and two-hybrid analysis. Expression of the GCP2/3 binding domain of pericentrin produced a phenotype similar to that observed in cells with reduced pericentrin. It disrupted the interaction between endogenous pericentrin and
TuRCs, and adsorbed
TuRCs from cell extracts. It reduced astral microtubules and centrosomal
tubulin in mitotic cells and induced formation of small spindles and monopolar spindles. No effect on interphase microtubules was observed. When added to Xenopus extracts this domain dissociated
tubulin from mitotic centrosomes and rapidly induced mitotic aster disassembly. The loss of
tubulin from centrosomes in cells with reduced pericentrin levels or in cells expressing the GCP2/3 binding domain of pericentrin ultimately triggered a checkpoint inducing G2/antephase arrest and apoptosis in somatic cells. These phenotypes were not observed after specific reduction in the levels of the larger pericentrin isoform, expression of a mutant pericentrin defective in GCP2/3 binding, or expression of a homologous region of pericentrin B. We conclude that the smaller isoform of pericentrin provides a molecular scaffold for centrosomal anchoring
TuRCs during mitosis in both embryonic and somatic cell systems.
| MATERIALS AND METHODS |
|---|
|
|
|---|
tubulin-containing constructs were obtained from Dr. Tim Stearns (Stanford University, Stanford, CA).
Small Interfering RNA (siRNA)
Twenty-one nucleotide RNAs were chemically synthesized by Dharmacon Reasearch (Lafayette, CO). and introduced to cells using Oligofectamine (Invitrogen, Carlsbad, CA.) in accordance with the manufacturer's instructions. The target sequences used were AAUUGGAACAGCUGCAGCAGA against pericentrin A and B in human (Dammermann and Merdes, 2002
), AAUGAGGUUGUCCACAGGAGA against pericentrin A and B in mouse, and AAGCUCUGAUUUAUCAAAAGA against the PACT domain of pericentrin B in human. AACUGGACUUCCAGAAGAACA, which targets human lamin A and is nonspecific in mouse, was used as a control for all siRNA studies. Crude cell lysates were analyzed for protein silencing. Cells were treated with 2 mM thymidine for 18 h starting 24 h post-siRNA treatment. Six hours after thymidine release, cells were harvested and lysed in phosphate-buffered saline (PBS) supplemented with 1% Triton X-100, 10 µg/ml leupeptin, 10 µg/ml pepstatin, 10 µg/ml chymotripsin,10 µg/ml phenylmethylsulfonyl fluoride, 2.0 µg/ml p-amino-benzamidine, 5 mM iodoacetamide, and 5 mg/ml N-ethylmaleimide. Cell lysates were clarified at top speed in a Microfuge for 15 min at 5°C. Protein concentration for each lysate was determined using Bio-Rad protein dye reagent, loads were adjusted, proteins were resolved by SDS-PAGE, and analyzed by Western Blot.
Antibodies
Anti-myc, anti-
-tubulin, and anti-tubulin antibodies were obtained from Sigma-Aldrich (St. Louis, MO). Phosphohistone H3 rabbit polyclonal antibody was purchased from Upstate Biotechnology (Lake placid, NY). M30 Cytodeath and anti-HA rat monoclonal antibody 3F10 was obtained from Roche Diagnostics (Indianapolis, IN) Anti-human lamin A/C antibody was purchased from Cell Signaling Technology (Beverley, MA). Other antibodies included M8 anti-pericentrin antibody, (Dictenberg et al., 1998
), human autoimmune serum 5051 that recognizes centrosome proteins (Doxsey et.al., 1994
), anti-pericentrin B/kendrin-specific antibody (Flory et.al., 2000
) (obtained from Trisha Davis, University of Washington, Seattle, WA), anti-GCP2 antibody (Murphy et al., 1998
) (obtained from Dr. Tim Stearns), and anti-GCP3 antibody (a gift from Michel Bornens, Institut Curie, Paris, France).
Yeast Two-Hybrid Cloning/Methods
Direct yeast two-hybrid interactions were performed essentially as described previously (Gromley et al., 2003
). Pericentrin,
tubulin, GCP2, and GCP3 coding sequences were amplified from plasmid DNA by PCR by using Pfu Turbo (Stratagene, La Jolla, CA), cloned into either pGBKT7 or pGADT7 (BD Biosciences Clontech, Palo Alto, CA) and completely sequenced. Yeast strains AH109 and Y187 were transformed with GAL4 DNA binding domain (GAL4-DBD) or GAL4 transactivation domain (GAL4-TAD) expression constructs, respectively, and diploid strains generated by mating. Interactions between pericentrin and members of the
tubulin ring complex were tested for by streaking yeast onto synthetic defined (SD) medium lacking leucine, tryptophan, histidine, and adenine.
Biochemical Techniques
Immunoprecipitations from Xenopus extracts were performed as described previously (Dictenberg et al., 1998
) by using the antibodies to the pericentrin amino terminus (M8) (Doxsey et al., 1994
) and
tubulin (Zheng et al., 1995
). For disruption of
TuRCs from pericentrin in coimmunoprecipitations, active or heat denatured pericentrin fractions were added directly to Xenopus highspeed extracts before immunoprecipitation. Protein affinity experiments to recruit
TuRCs (Figure 2) were performed using partially purified fractions of pericentrin domains (see below). Proteins were bound to anti-HA beads, added to extracts for 60 min, washed in extract buffer (Murray, 1991
), run on SDS gels, and probed with the indicated antibodies.
|
Proteins for recruitment of
TuRCs (Figure 2) and for aster inhibition assays (Figures 4 and 5) were produced in COS cells and purified as follows. Confluent COS cells were transiently transfected with 3 µg of DNA/60-mm dish by using LipofectAMINE Plus reagent (Invitrogen). Transfected cells were maintained for 3 d in DMEM with 5% serum and then collected with 5 mM EDTA in PBS. Cells were lysed in PBS supplemented with protease inhibitor cocktail (#1836153; Roche Diagnostics, Basel, Switzerland), 1% Triton X-100, and 5 mg/ml N-ethylmaleimide. For recruitment of
tubulin from extracts, HA beads were prepared by pretreating Dynabeads 450 (#110.05; Dynal, Lake Success, NY) with a saturating amount of anti-HA antibody 12CA5 (Covance, Denver, PA). Anti-HA IgG beads were treated with COS cell lysate containing an excess of the indicated HA-tagged pericentrin polypeptides, washed three times in PBS lysis buffer, two times in PBS, and two times in extract buffer, before addition of Xenopus extracts for
TuRC recruitment experiments. For preparation of soluble HA-tagged pericentrin, 12CA5 antibody was cross-linked to protein A beads (Bio-Rad, Hercules, CA) by using standard methods (Harlow and Lane, 1988
). HA-tagged pericentrin was batch depleted from COS lysates by incubation with HA cross-linked beads at 5°C with gentle agitation for 1 h. Treated beads (configured as a column) were washed with 10 column volumes of lysis buffer, 10 volumes of PBS with protease inhibitors, and 10 volumes of 10 mM Tris, pH 8.0. HA-tagged pericentrin was eluted with 2 volumes of 150 mM glycine, pH 2.5, into 1/4 volume of 1 M Tris, pH 8.0, and dialyzed against PBS overnight.
|
|
Coimmunoprecipitations
Coimmunnoprecipitation of pericentrin isoforms and
TuRC components (Figure 3) was performed in COS cells 4048 h after transient cotransfection of the indicated constructs by using LipofectAMINE Plus reagent. Cells were collected using 5 mM EDTA in PBS. Cell pellets were lysed with 1% NP-40, 1 mM dithiothreitol, 10% glycerol in buffer C (100 mM PIPES, pH 6.9, 6 mM MgCl2, 0.5 mM EGTA, 10 µg/ml leupeptin, 10 µg/ml pepstatin, 10 µg/ml chymotripsin, 10 µg/ml phenylmethylsulfonyl fluoride, 2.0 µg/ml p-aminobenzamidine, 5 mM iodoacetamide). Lysates were clarified 15 min at top speed in a Microfuge at 5°C and then applied to HA Dyna beads (see above). Beads were treated for 1 h at 5°C with end-over-end agitation and washed two times in lysis buffer (see above) and two times in wash buffer (buffer C with 100 mM Na acetate, pH 6.9). Loads and treated beads (immunoprecipitates) were analyzed by SDS gel electrophoresis and Western blot by using the indicated antibodies.
|
Xenopus Extracts
Cytostatic factor (CSF)-arrested Xenopus extracts were prepared, and aster assembly assays were preformed as described previously (Murray, 1991
; Stearns and Kirschner, 1994
). For purpose of quantization, two hundred sperm were counted and scored for the presence of assembled microtubules. In some cases, the standard fix [0.3 volume of 37% formaldehyde, 0.6 volumes of 80% (wt/vol) glycerol, 0.1 volume 10x MMR, 1 µg/ml 4,6-diamidino-2-phenylindole (DAPI)] was modified by the addition of 0.05% Oligreen (Molecular Probes, Eugene, OR) to facilitate visualization of sperm nuclei with a scanning confocal microscope. Centrosome assembly in the presence of nocodazole was preformed using published methods (Stearns and Kirschner, 1994
). Treated nuclei were prefixed in 5% formaldehyde, spun onto coverslips through a 20% sucrose cushion by using a JS13.1 rotor at 8000 rpm 15 min, and postfixed in methanol (-20°C) before staining for immunofluorescence. Ran-mediated asters were prepared using constitutively active RanL43E as described previously (Wilde and Zheng, 1999
). Centrosome-dependent and -independent Xenopus mitotic asters were fixed in formaldehyde on coverslips as described previously (Murray, 1991
; Wilde and Zheng, 1999
).
Cell Lines
Cell lines (COS-7, SAOS, and U2OS) were grown as described previously (American Type Culture Collection, Manassas, VA) and prepared for transfection experiments as described previously (Purohit et al., 1999
). Primary mouse embryonic fibroblasts (MEFs) were obtained from Dr. Geoffrey Wahl (Salk Institute for Biological Studies, La Jolla, CA) and used at less than six passages.
Transfection and Immunofluorescence
For transfection and immunofluorescence analysis, logarithmically growing cells were transfected as indicated by the manufacturer with 1 µg of DNA/35-mm dish of the appropriate construct by using LipofectAMINE Plus (Invitrogen) for COS cells and LipofectAMINE for SAOS and U2OS cells. The transfection efficiency for COS cells with control constructs ranged from 35 to 60%. MEFs were transfected using Superfect (QIAGEN, Valencia, CA). For immunofluorescence, cells were fixed with 20°C MeOH as described previously (Purohit et al., 1999
). Data were collected as a Z series for deconvolution with 0.3 µm between planes. Images were deconvolved using MetaMorph software, no neighbors algorithm. All images were rendered two dimensional by showing maximum intensity at each point.
Microinjection Experiments
For microinjection, COS cells were synchronized by thymidine block. Cells were treated 16 h with 2 mM thymidine and released (single block), or treated for an additional 16 h with 2 mM thymidine after 8 h of release (double block). The mitotic index of synchronized cells was determined using replicate coverslips, fixed and stained with DAPI, and then counted at the indicated times postrelease from thymidine block. 1000 cells were counted for each time point. Microinjection into the nucleus of released cells was performed using an Eppendorf transjector 5246, with Eppendorf femtotips, with an injection pressure of 100 hPa, injection time of 0.4 s, and DNA at a concentration of 0.2 µg/µl in PBS.
| RESULTS |
|---|
|
|
|---|
Tubulin from Spindle Poles and Disrupts Spindle Bipolarity
tubulin ring complex and that pericentrin antibodies disrupt spindle organization and function (Doxsey et al., 1994
Tubulin was reduced at spindle poles in mitotic cells, although centrioles were present; centrosomes in adjacent interphase cells retained strong
tubulin staining (Figure 1, G and H). Selective silencing of the larger isoform of pericentrin (B) had no effect on interphase or mitotic microtubule organization (Figure 1C, C', C'', and D), although we cannot rule out the possibility that activity of the residual protein is sufficient to support these functions. These results suggested that the phenotype observed after pericentrin A/B silencing resulted from reduction in pericentrin A, although this isoform could not be specifically targeted because it is homologous through most of its length with pericentrin B (Flory and Davis, 2003
|
Pericentrin Interacts with the
TuRC in Xenopus Extracts through GCP2 and 3
We next examined the relationship of pericentrin and the
tubulin ring complex in more detail. We found that immunoprecipitation of pericentrin from Xenopus extracts coprecipitated several components of the
TuRC, including
tubulin, GCP2, and GCP3 (Figure 2A). Conversely, immunoprecipitation of
tubulin coprecipitated pericentrin in addition to GCP2 and GCP3. Additional evidence for the pericentrin-
TuRC interaction was obtained by showing that an HA-tagged C-terminal region of pericentrin affixed to beads could be used to specifically pull out endogenous
tubulin and associated proteins from Xenopus extracts (Figure 2B, 13401920; our unpublished data). Moreover, the C-terminal region of pericentrin was able to disrupt the endogenous pericentrin
TuRC interaction when added to extracts as shown by the loss of
tubulin from pericentrin immunoprecipitates (Figure 2C). These results demonstrate that pericentrin interacts with the
TuRC and that the interaction is mediated by a domain at the C-terminal region of the protein.
To determine the molecular basis of the interaction of pericentrin with the
TuRC, we tested whether pericentrin could bind individual proteins of the complex in vitro. We found that HA-tagged full-length pericentrin and the C-terminal third of pericentrin coimmunoprecipitated myctagged GCP3 when the proteins were cooverexpressed in COS-7 cells (Figure 3, A and B). In parallel assays, the pericentrin C terminus coimmunoprecipitated myc-tagged GCP2 (Figure 3, A and C) but not myc-tagged
tubulin (Figure 3D). GCP2/3 binding was specific for the C terminus of pericentrin because several domains comprising the amino terminal two-thirds of the molecule showed no interaction (Figure 3, B and C). Direct two-hybrid analysis confirmed the interaction of the pericentrin C terminus with both GCP2 and GCP3 (Figure 3E) and failed to detect an interaction with
tubulin or amino terminal domains of pericentrin (our unpublished data). In addition, domains of the larger isoform (pericentrin B) that included the GCP2/3 interacting region of pericentrin as well as an additional exon not present in pericentrin (66% identical, 78% similarity) did not interact with GCP2 (or GCP3) by immunoprecipitation (Figure 3G) or two-hybrid analysis (Figure 3F, see accession numbers gi458668 and gi31296687 for more details on sequence differences). Data from these two independent assays demonstrate that pericentrin interacts specifically with at least two members of the
TuRC, GCP2 and GCP3. The C terminus of pericentrin seemed to bind GCP2 and GCP3 more efficiently than the full-length molecule. Similar binding patterns have been observed for other pericentrin-interacting proteins such as the dynein light intermediate chain, and they could result from increased accessibility to epitopes that are masked in the full-length protein (Tynan et al., 2000
).
The C Terminus of Pericentrin Disassembles Mitotic Asters and Centrosomal
Tubulin in Xenopus Extracts
Microtubule aster formation on nascent centrosomes of sperm nuclei in Xenopus extracts is dependent on the recruitment of soluble
TuRCs to these sites (Felix et al., 1994
; Stearns and Kirschner, 1994
). Previous studies implicated pericentrin in this process (Dictenberg et al., 1998
; Doxsey et al., 1994
). To address this issue directly, we examined the effect of the GCP2/3 interacting domain of pericentrin on microtubule aster assembly in mitotic Xenopus extracts. Addition of this domain to extracts before the aster assembly reaction significantly reduced aster formation (Figure 4, A and B). Even after extended periods (30 min), few asters were detected, and they had few microtubules and were highly disorganized, a phenotype almost never observed in controls. Half maximal aster inhibitory activity was seen at a protein concentration
4:1 with endogenous pericentrin (Figure 4C). No change in aster assembly was observed in the presence of the pericentrin N terminus, heat-denatured C terminus, bovine serum albumin, or buffer alone (Figure 4D, 16). The activity seemed to be specific for mitotic extracts as there was no detectable effect on aster assembly in interphase extracts (Figure 4D, 79).
The mechanism of aster inhibition was examined in more detail by monitoring recruitment of
tubulin onto nascent centrosomes in Xenopus mitotic extracts as described previously (Doxsey et al., 1994
; Felix et al., 1994
; Stearns and Kirschner, 1994
). The pericentrin C-terminal domain and subdomains of this protein specifically inhibited recruitment of
tubulin onto centrosomes to the same extent and at the same concentration that prevented microtubule aster assembly and disrupted the interaction between pericentrin and the
TuRC (Figure 4, EG). These results suggested that the pericentrin C terminus inhibited microtubule aster formation in mitotic extracts by preventing recruitment of
tubulin to pericentrin sites on the nascent centrosome.
To more directly test whether pericentrin anchored
TuRCs to nascent centrosomes, we examined the effect of the pericentrin C-terminal polypeptide on asters preassembled in extracts. Within 60 s after addition of the protein, the focus of microtubules in preassembled asters was disrupted, and free microtubules were observed in the region surrounding the aster (Figure 4, HK). By 2 min after addition of the protein, most microtubules seemed to have lost their attachment to the centrosome; the remaining microtubules were of normal length and often formed bundles. By 35 min, no microtubules were detected at most centrosomes. In contrast, preassembled asters exposed to heat-inactivated pericentrin C terminus (Figure 4L), other pericentrin domains, the pericentrin B homology domain, or buffer alone showed no detectable loss of centrosomal microtubules, no change in microtubule organization, and few to no free microtubules in the vicinity of the aster. Pericentrin C-terminal peptide was just as effective at disrupting preexisting asters as it was at inhibiting their assembly, through a range of test concentrations. Pericentrin C terminal peptide caused loss of
tubulin from preassembled centrosomes within the same time frame that it caused loss of microtubules from asters (90% reduction in 5 min). These results indicate that the pericentrin C terminus disrupts the interaction of
TuRCs with centrosomes releasing the complexes and attached microtubules.
Microtubule asters can form in Xenopus extracts by a centrosome-independent pathway that requires the Ran GTPase (reviewed in Dasso, 2002
). Ran-mediated aster assembly can be inhibited by a dominant negative form of Ran and enhanced by a dominant active form of the protein. Under conditions that resulted in rapid disassembly of mitotic asters, the pericentrin C terminus did not significantly affect Ran-mediated aster assembly even after extended periods of incubation (Figure 4, M and N). Thus, although formation of Ran asters requires
tubulin (Wilde and Zheng, 1999
), it seems to be less dependent on pericentrin than does centrosome-mediated aster assembly.
Mapping the GCP2/3 Binding Domain and Aster-disrupting Activity of Pericentrin
We further defined the pericentrinGCP2/3 interaction site and made point mutants that inhibited the pericentrinGCP2/3 interaction. Using directed two-hybrid and coimmunoprecipitation analyses, we identified a subdomain of the C terminus that was required for strong GCP2/3 binding in both assays (Figure 5A, consensus). We identified a point mutation in this domain with significantly reduced binding to GCP2 in vitro and lacked aster activity in Xenopus extracts. GCP2 and GCP3 bind cooperatively to pericentrin with in the consensus region because myc-tagged GCP2 showed cooperative binding to HA-tagged pericentrin in the presence of GCP3 (Figure 5C). In functional assays, pericentrin domains that bound GCP2/3 showed aster inhibitory activity in Xenopus extracts (Figure 5A). Those that did not interact with GCP2/3 lacked aster inhibitory activity, including the pericentrin mutant, a domain of pericentrin B containing all pericentrin sequences required for activity (Figure 5A), and several pericentrin domains outside the GCP2/3 interacting domain (Figure 5A, consensus). The strong correlation between regions of pericentrin that interacted with GCP2/3 and those that showed mitotic aster and
TuRC-disrupting activity indicated that pericentrin was required for anchoring
TuRCs to centrosomes in Xenopus mitotic extracts.
To further address differences in GCP2/3 binding between pericentrin (A) and pericentrin B, we excised most of an extra exon (and some additional sequences) that is present in the homologous region of pericentrin B. Truncated pericentrin B proteins lacking the amino acids encoded by these sequences had weak GCP2 binding activity (Figure 5, A and D), suggesting that pericentrin B binding to the
TuRC in this region may be blocked by incorporation of an extra exon.
GCP2/3 Interacting Domains of Pericentrin Disrupt Mitotic Asters and Spindles in Vertebrate Cells
We next tested whether the GCP2/3-interacting domains of pericentrin affected microtubule organization in vertebrate cells. We found that these domains had no detectable effect on the organization or nucleation of microtubules or the organization of centrosomes in interphase SAOS cells (Figure 6A). However, the same domains disrupted microtubule structures in mitotic cells (Figure 6, BK). The most common phenotype was monopolar spindles, which represented
15% of all mitotic cells at early times posttransfection (2022 h) and increased to
90% at later times (44 h post-transfection, Figure 6, H, H', and M). Most monopolar spindles had two duplicated and separated centrosomes. We also observed spindles with reduced numbers of centrosome-associated astral microtubules (Figure 6, C', G, J, and K'), bipolar spindles with shortened pole-to-pole axes (Figure 6, C' and G, minispindles) and half spindles with single focused poles (Figure 6, II''). In many spindles, we observed a decrease in the centrosome level of
tubulin (Figure 6, E and I) and other centrosome proteins (Figure 6C), although the proteins were never reduced to undetectable levels. Pericentrin domains that bound both GCP2 and GCP3 induced the same defects, and those that did not interact had little or no effect (Figure 6, KK''). Moreover, we were unable to detect aster inhibitory activity in Xenopus extracts (Figures 4D and 5A), disruption of spindle organization (Figure 6, MM') or apoptosis (below) associated with the homologous region of pericentrin B, suggesting that these two molecules may not be functionally analogous. Together, these results suggest that uncoupling of the pericentrin A
tubulin interaction in mitotic cells caused a reduction in the centrosome-associated
TuRCs and disrupted astral microtubules and spindle organization, ultimately producing monopolar spindles.
|
Overexpression of the GCP2/3 Binding Domain of Pericentrin and Reduction in Pericentrin Levels Both Induce G2/Antephase Delay and Apoptosis
During the course of these studies, we observed a marked reduction in cell density in cultures transfected with the GCP2/3 binding domain (Figure 7, A and A'). Typically, half the cells detached from their substrate by 44 h, whereas there was little change in cell density before protein expression (Figure 7A', 20 h). To investigate this further, we examined cells for apoptosis and found that a significant fraction of the cells stained with an apoptosis-specific marker that detects a caspase 3 product of cytokeratin 18 produced early in apoptosis (Figure 7A'', M30); control cells showed low levels of M30 staining.
|
Apoptosis required that cells be actively cycling, because we did not detect apoptosis when cells were plated at high density to induce G1/G0 arrest during the period of protein expression. In cycling cells of several different origins, we observed a low mitotic index (Figure 7C) suggesting that cells were delayed at some point in the cell cycle. We found that cells accumulated in a premitotic stage based on their ability to stain for a form of histone H3 that is phosphorylated by aurora B in early mitotic cells (Swedlow and Hirano, 2003
; Hans and Dimitrov, 2001
); control cell staining was significantly lower (Figure 7, D and F). The cell cycle period between late G2 and mitosis (before chromosome condensation occurs) is termed antephase (Pines and Rieder, 2001
). Antephase arrest was linked to apoptosis because most early mitotic cells (phospho-H3-positive) were also early apoptotic (Figure 7G, M30-positive). Moreover, most centrosomes in apoptotic cells seemed duplicated and separated (Figure 7H, two
tubulin spots), consistent with cells in late G2 or early prophase.
To confirm the link between cell cycle arrest and cell death, we microinjected cDNA into nuclei of COS cells arrested in S phase by thymidine block. Approximately 8 h after release from the block cells entered mitosis. At this time, a significant proportion of cells expressing the GCP2/3 binding domain of pericentrin expressed the M30 antigen or detached from the substrate whereas control cells remained attached and often increased in number (Figure 8, A, B, and D). Cell loss was cell cycle specific because premitotic cycling cells or cells kept under S phase arrest remained viable and adherent (Figure 8C). These results suggested that uncoupling the pericentrin
TuRC interaction and disruption of astral microtubules induced apoptosis at the G2/M transition. (Figure 8C).
|
We reasoned that if apoptosis resulted from a cellular defect common to both overexpression and reduction of pericentrin, we should observe cell cycle arrest and apoptosis after pericentrin silencing. Significant cell death was in several cell types knocked down for pericentrin A and B at 4872 h posttreatment (our unpublished data). Pericentrin A/B silencing also induced a significant increase in antephase, and a decrease in mitotic index 4872 h after protein silencing (Figure 7, C and D). These provide further support for the idea that antephase arrest and apoptosis may be caused by disruption of the pericentrin
tubulin interaction.
| DISCUSSION |
|---|
|
|
|---|
tubulin interacted in Xenopus extracts and that the proteins were in proximity at centrosomes in vertebrate cells, suggesting that they interacted at this site as well (Dictenberg et al., 1998
TuRC via domains that bind GCP2 and GCP3 and that this interaction is important for microtubule organization in mitotic cells. The results of this study are consistent with our previous work showing that pericentrin overexpression induces severe spindle defects (Purohit et al., 1999
TuRCs at mitotic centrosomes/spindle poles. This interaction seems to be required not only for astral microtubule organization but also for maintaining spindle bipolarity and for mitotic entry. The monopolar spindles and "minispindles" induced by disruption of the pericentrin-GCP2/3 interaction, indicate that pericentrin anchoring of
TuRCs also may play a role in organizing microtubules of the central spindle.
Centrosomal Anchoring of
TuRCs by Pericentrin Is Required for Mitotic Microtubule Aster Organization in Xenopus Extracts and Somatic Cells
Our results indicate that pericentrin anchoring of
TuRCs at centrosomes is required for mitotic aster organization. If anchoring is disrupted,
tubulin is dramatically depleted at mitotic centrosomes in Xenopus extracts and reduced at spindle poles in somatic cells. The more dramatic loss of centrosomal
tubulin from Xenopus asters suggests that pericentrin plays a more dominant role in the organization of
TuRCs at centrosomes in this system and perhaps in embryonic systems in general. We have not investigated the fate of
TuRCs once dissociated from centrosomes, although one possibility is that they remain attached to the minus ends of microtubules where they could cap microtubule growth (Wiese and Zheng, 2000
). In somatic cells, a fraction of
tubulin remains at centrosomes/spindle poles under conditions that disrupt the GCP2/3-pericentrin interaction. This fraction could be anchored by other proteins that have been shown to bind
TuRC components such as AKAP450, pericentrin B (Takahashi et al., 2002
) Nlp (Casenghi et al., 2003
), and centrosomin (Terada et al., 2003
)
In this study, we map the GCP2/3 binding site of pericentrin to the C terminus of the protein, a region that shows no apparent homology to AKAP450, Spc110, Spc72, or CP309 (Kawaguchi and Zheng, 2003
; Takahashi et al., 2002
), although it is conserved between mouse, human, and rat (6675% identical, 7884% similarity). Whereas the amino terminus of pericentrin B binds GCP2 (Takahashi et al., 2002
) (W. Zimmerman and S. Doxsey, unpublished observations), a similar region in the smaller pericentrin isoform does not, perhaps because it lacks exons found in pericentrin B. More information on the GCP2/3 interacting domain will require mapping these sites in all the GCP2 binding proteins.
The phenotype observed with the GCP2/3-pericentrin disrupting polypeptides and after pericentrin silencing is similar in many respects to that seen after functional abrogation of
tubulin and other proteins of the
TuRC. Under these conditions, centrosomes in Caenorhabditis elegans and Drosophila embryos were compromised in their ability to form mitotic asters (Hannak et al., 2002
; Strome et al., 2001
), separate from one another (Barbosa et al., 2003
; Sampaio et al., 2001
), and organize meiotic and mitotic spindles (Sunkel et al., 1995
; Barbosa et al., 2000
, 2003
). It is of interest that mitotic asters in some of these systems formed in the absence of
tubulin or other
tubulin ring complex proteins (Strome et al., 2001
; Hannak et al., 2002
; Barbosa et al., 2003
). This is in contrast to our results in Xenopus extracts where microtubule asters did not form in the presence of the pericentrin interacting domain of GCP2/3 even after extended periods (30 min). Moreover, preformed mitotic asters were rapidly disassembled after addition of this polypeptide. Future studies will be required to determine whether pericentrin and
tubulin are more critical for mitotic aster formation in Xenopus extracts than in the other systems, or whether uncoupling
tubulin from pericentrin prevents both
tubulin-mediated microtubule nucleation and nucleation by a proposed
tubulin-independent pathway (Hannak et al., 2002
).
Pericentrin Is Not Essential for Assembly and Anchoring of
TuRCs at Interphase Centrosomes
The GCP2/3-interacting pericentrin domains described in this study had no detectable effect on assembly of asters in interphase extracts prepared from Xenopus or in interphase somatic cells. Moreover, silencing of both isoforms also had no apparent effect on localization of
tubulin at the centrosome or microtubule organization in interphase cells. This suggests that the protein does not play a major role in
tubulin assembly or anchoring at interphase centrosomes but rather that the asterorganizing function of pericentrin is mitosis specific. Because both proteins are normally present at the centrosome throughout the cell cycle, we cannot conclude that they do not interact during interphase. Only that this specific interaction is not necessary for
tubulin localization. It has been shown that
tubulin and associated proteins are crucial for microtubule nucleation from interphase centrosomes (Joshi et al., 1992
; Hannak et al., 2002
). It is thus likely that proteins other than pericentrin provide microtubule-anchoring sites at centrosomes in interphase cells.
Other Proteins Involved in Centrosomal
TuRC Anchoring and Microtubule Organization
Several other proteins play a role in centrosome organization and microtubule nucleation. However, their ability to directly anchor components of the
TuRC and thus serve as molecular scaffolds for tethering these complexes to centrosomes has not been demonstrated. These include the centrosome proteins Asp (do Carmo Avides and Glover, 1999
), NuMA (Merdes et al., 1996
), TPX-2 (Wittmann et al., 2000
; Garrett et al., 2002
), SPD-5 (Hamill et al., 2002
), PCM-1 (Dammermann and Merdes, 2002
), Sas-4 (Kirkham et al., 2003
) centrosomin (Megraw et al., 1999
; Terada et al., 2003
), and several regulatory molecules, including Aurora A (Hannak et al., 2001
; Giet et al., 2002
), Polo (Lane and Nigg, 1996
; Barbosa et al., 2000
), PP1 (Katayama et al., 2001
), and PP4 (Sumiyoshi et al., 2002
).
Some of these proteins play a critical role in a centrosome-independent spindle assembly pathway mediated by the Ran GTPase (see Dasso, 2002
) including NuMA (Nachury et al., 2001
; Wiese et al., 2001
) and TPX-2 (Gruss et al., 2001
). This is in contrast with pericentrin, which seems to be critical for assembly of mitotic asters but not Ran-mediated asters. In this regard, the proposed function of pericentrin in aster formation also differs from that of epsilon tubulin, which seems to be required for centrosome-independent but not centrosome-dependent microtubule aster formation (Chang et al., 2003
). From this discussion, it seems that different molecules are required to organize asters in centrosome-dependent and -independent pathways as well as at different stages of the cell cycle.
Regulation of the PericentrinGCP2/3 Interaction
Pericentrin,
tubulin, and
tubulin-associated proteins are localized to centrosomes throughout the cell cycle (Stearns et al., 1991
; Zheng et al., 1991
; Dictenberg et al., 1998
). However, the pericentrinGCP2/3 interaction seems to be involved in
TuRC anchoring only during mitosis. This suggests that the interaction of pericentrin and
TuRCs is regulated. The mechanism and regulation of cell cycle-specific binding between these centrosome components is unknown. One model is that
TuRCs are anchored to different centrosome scaffold proteins at different cell cycle stages and that these interactions are regulated in a cell cycle-dependent manner. For example, the
TuRC binding activity of pericentrin could be regulated by phosphorylation by mitotic kinases.
TuRC binding also could be regulated at least in part, through differential patterns of protein expression. Consistent with this idea is the observation that pericentrin, which is expressed primarily in mitosis and in tissues that are highly proliferative (Doxsey et al., 1994
; Figure 6N), has a mitotic phenotype. Future experiments will be required to determine the contribution of these and other centrosome proteins in the anchoring of
TuRCs to centrosomes at different cell cycle stages.
G2/Antephase Delay and Apoptosis
G2 accumulation of cells expressing the GCP2/3 binding domain of pericentrin or after silencing of pericentrin A/B suggests that disruption of the pericentrin
TuRC interaction in vivo elicits a checkpoint response at this time in the cell cycle. Recent studies have implicated
tubulin as well as the Spc110p homologue Pcp1p in regulation of the metaphase to anaphase transition (Prigozhina et al., 2004
; Rajagopalan et al., 2004
), but this is the first study suggesting a role for these or related molecules in regulation of mitotic entry. We do not yet know what this checkpoint may be monitoring. We favor a model in which the checkpoint senses spindle pole assembly/centrosome maturation because disruption of the
tubulinpericentrin interaction disrupts spindle pole assembly and possibly centrosome maturation, which increases in size fourfold between G2 and early prophase (Piehl et al., 2004
), concurrent with the onset of
tubulin mislocalization and antephase arrest that we observe.
Our results showing that pericentrin A/B silencing has no significant affect on interphase microtubule arrays confirms previous work (Dammermann and Merdes, 2002
). In this earlier study, the authors did not address mitotic defects most likely because a G2 checkpoint is activated, apoptosis follows, and mitotic cells are rarely observed, a phenomenon that we have encountered in two of the cell lines used by these authors; U2OS and HeLa (Figure 7C; data not shown). In this study, we overcame this problem by using a cell line that that apparently lacks this checkpoint and fails to undergo apoptosis.
Apoptosis is commonly observed after checkpoint activation if a cellular imbalance cannot be repaired. We have not determined which molecular pathway is involved in the G2/antephase arrest identified in this study. DNA damage induces two molecularly distinct pathways involved in G2 arrest, one ATM dependent, the other ATM independent (Xu et al., 2002
). Cellular insults other than DNA damage also can induce late G2 arrest, including microtubule disruption, hypothermia, fluoride treatment, and viral protein expression (Pines and Rieder, 2001
; Tyler et al., 2001
; Elder et al., 2002
; Mikhailov and Rieder, 2002
).
Antephase delay and subsequent apoptosis also can be activated through pathways that include p53 and Rb. Our data demonstrate that that p53 is not involved because primary MEFs lacking p53 retain the checkpoint response. SAOS cells, which do not arrest and apoptose have been reported to lack Rb (Scolnick and Halazonetis, 2000
). We are currently testing the role of Rb in the checkpoint response. We also are investigating other mechanisms for inducing apoptosis. For example, apoptosis can be triggered by mislocalization of antiapoptotic signals from centrosomes (Li, 1998
).
Tubulin has recently been shown to associate with DAP-like kinase, which is implicated in apoptosis (Preuss et al., 2003
). However, the role of
tubulin mislocalization from centrosomes and induction of apoptosis through DAP-like kinase has not been explored. Mislocalization of survivin and other antiapoptotic proteins from centrosomes can induce apoptosis (Reed and Reed, 1999
; Piekorz et al., 2002
; Sandal et al., 2003
). Additional studies will be required to identify the proteins and pathways involved in the apoptotic response observed after disruption of the pericentrinGCP2/3 interaction.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
tubulin. We thank T.N. Davis for pericentrin B/kendrin-specific antibody. We also thank C. Wiese for constitutively active RanL43E This work was supported by National Institutes of Health GM-51994 (to S.J.D.). | Footnotes |
|---|
* Corresponding author. E-mail address: stephen.doxsey{at}umassmed.edu.
| REFERENCES |
|---|
|
|
|---|
Barbosa, V., Yamamoto, R.R., Henderson, D.S., and Glover, D.M. ((2000). ). Mutation of a Drosophila gamma tubulin ring complex subunit encoded by discs degenerate-4 differentially disrupts centrosomal protein localization. Genes Dev. 14, , 3126-3139.
Blagden, S.P., and Glover, D.M. ((2003). ). Polar expeditionsprovisioning the centrosome for mitosis. Nat. Cell Biol. 5, , 505-511.[CrossRef][Medline]
Bobinnec, Y., Khodjakov, A., Mir, L.M., Rieder, C.L., Edde, C.L., and Bornens, M. ((1998). ). Centriole disassembly in vivo and its effect on centrosome structure and function in vertebrate cells. J. Cell Biol. 143, , 1575-1589.
Casenghi, M., Meraldi, P., Weinhart, U., Duncan, P.I., Korner, R., and Nigg, E.A. ((2003). ). Polo-like kinase 1 regulates Nlp, a centrosome protein involved in microtubule nucleation. Dev. Cell. 5, , 113-125.[CrossRef][Medline]
Chang, P., Giddings, Jr., T.H., Winey, M., and Stearns, T. ((2003). ). Epsilontubulin is required for centriole duplication and microtubule organization. Nat. Cell Biol. 5, , 71-76.[CrossRef][Medline]
Dammermann, A., and Merdes, A. ((2002). ). Assembly of centrosomal proteins and microtubule organization depends on PCM-1. J. Cell Biol. 159, , 255-266.
Dasso, M. ((2002). ). The Ran GTPase: theme and variations. Curr. Biol. 12, , R502-508.[CrossRef][Medline]
Dictenberg, J., Zimmerman, W., Sparks, C., Young, A., Vidair, C., Zheng, Y., Carrington, W., Fay, F., and Doxsey, S.J. ((1998). ). Pericentrin and gamma tubulin form a protein complex and are organized into a novel lattice at the centrosome. J. Cell Biol. 141, , 163-174.
do Carmo Avides, M., and D. M. Glover. ((1999). ). Abnormal spindle protein, ASP, and the integrity of mitotic centrosomal microtubule organizing centers. Science 283, , 1733-1735.
Doxsey, S.J. ((2001). ). Re-evaluating centrosome function. Nat. Rev. Mol. Biol. 2, , 688-699.
Doxsey, S.J., Stein, P., Evans, L., Calarco, P., and Kirschner, M. ((1994). ). Pericentrin, a highly conserved protein of centrosomes involved in microtubule organization. Cell 76, , 639-650.[CrossRef][Medline]
Elder, R.T., Benko, Z., and Zhao, Y. ((2002). ). HIV-1 VPR Modulates cell cycle G2/M transition through an alternative cellular mechanism other than the classic mitotic checkpoints. Front. Biosci. 7, , d349-357.[Medline]
Felix, M.-A., Antony, C., Wright, M., and Maro, B. ((1994). ). Centrosome assembly in vitro: role of
-tubulin recruitment in Xenopus sperm aster formation. J. Cell Biol. 124, , 19-31.
Flory, M.R., and Davis, T.N. ((2003). ). The centrosomal proteins pericentrin and kendrin are encoded by alternatively spliced products of one gene. Genomics 82, , 401-405.[CrossRef][Medline]
Flory, M.R., Morphew, M., Joseph, J.D., Means, A.R., and Davis, T.N. ((2002). ). Pcp1p, an Spc110p-related calmodulin target at the centrosome of the fission yeast Schizosaccharomyces pombe. Cell Growth Differ. 13, , 47-58.
Flory, M.R., Moser, M.J., Monnat, Jr., R.J., and Davis, T.N. ((2000). ). Identification of a human centrosomal calmodulin-binding protein that shares homology with pericentrin. Proc. Natl. Acad. Sci. USA 97, , 5919-5923.
Garrett, S., Auer, K., Compton, D.A., and Kapoor, T.M. ((2002). ). hTPX2 is required for normal spindle morphology and centrosome integrity during vertebrate cell division. Curr. Biol. 12, , 2055-2059.[CrossRef][Medline]
Giet, R., McLean, D., Descamps, S., Lee, M.J., Raff, J.W., Prigent, C., and Glover, D.M. ((2002). ). Drosophila Aurora A kinase is required to localize D-TACC to centrosomes and to regulate astral microtubules. J. Cell Biol. 156, , 437-451.
Gillingham, A.K., and Munro, S. ((2000). ). The PACT domain, a conserved centrosomal targeting motif in the coiled-coil proteins AKAP450 and pericentrin. EMBO Rep. 1, , 524-529.[CrossRef][Medline]
Gromley, A., Jurczyk, A., Sillibourne, J., Halilovic, E., Mogensen, M., Groisman, I., Blomberg, M., and Doxsey, S. ((2003). ). A novel human protein of the maternal centriole is required for the final stages of cytokinesis and entry into S phase. J. Cell Biol. 161, , 535-545.
Gruss, O.J., Carazo-Salas, R.E., Schatz, C.A., Guarguaglini, G., Kast, J., Wilm, M., Le Bot, N., Vernos, I., Karsenti, E., and Mattaj, I.W. ((2001). ). Ran induces spindle assembly by reversing the inhibitory effect of importin alpha on TPX2 activity. Cell 104, , 83-93.[CrossRef][Medline]
Hamill, D.R., Severson, A.F., Carter, J.C., and Bowerman, B. ((2002). ). Centrosome maturation and mitotic spindle assembly in C. elegans require SPD-5, a protein with multiple coiled-coil domains. Dev. Cell 3, , 673-684.[CrossRef][Medline]
Hannak, E., Kirkham, M., Hyman, A.A., and Oegema, K. ((2001). ). Aurora-A kinase is required for centrosome maturation in Caenorhabditis elegans. J. Cell Biol. 155, , 1109-1116.
Hannak, E., Oegema, K., Kirkham, M., Gonczy, P., Habermann, B., and Hyman, A.A. ((2002). ). The kinetically dominant assembly pathway for centrosomal asters in Caenorhabditis elegans is gamma-tubulin dependent. J. Cell Biol. 157, , 591-602.
Harlow, E., and Lane, D. ((1988). ). Antibodies: A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Hans, F., and Dimitrov, S. ((2001). ). Histone H3 phosphorylation and cell division. Oncogene 20, , 3021-3027.[CrossRef][Medline]
Job, D., Valiron, O., and Oakley, B. ((2003). ). Microtubule nucleation. Curr. Opin. Cell Biol. 15, , 111-117.[CrossRef][Medline]
Joshi, H.C., Palacios, M.J., McNamara, L., and Cleveland, D.W. ((1992). ). Gamma-tubulin is a centrosome protein required for cell cycle-dependent microtubule nucleation. Nature 356, , 80-83.[CrossRef][Medline]
Katayama, H., Zhou, H., Li, Q., Tatsuka, M., and Sen, S. ((2001). ). Interaction and feedback regulation between STK15/BTAK/Aurora-A kinase and protein phosphatase 1 through mitotic cell division cycle. J. Biol. Chem. 276, , 46219-46224.
Kawaguchi, S.-I., and Zheng, Y. ((2003). ). Characterization of a Drosophila centrosome protein CP309 that shares homology with Kendrin and CG-NAP. Mol. Biol. Cell 15, , 37-45.
Keryer, G., Di Fiore, B., Celati, C., Lechtreck, K.F., Mogensen, M., Delouvee, A., Lavia, P., Bornens, M., and Tassin, A.-M. ((2003). ). Part of Ran is associated with AKAP450 at the centrosome: involvement in microtubule-organizing activity. Mol. Biol. Cell 14, , 4260-4271.
Khodjakov, A., Rieder, C.L., Sluder, G., Cassels, G., Sibon, O., and Wang, C.L. ((2002). ). De novo formation of centrosomes in vertebrate cells arrested during S phase. J. Cell Biol. 158, , 1171-1181.
Kirkham, M., Muller-Reichert, T., Oegema, K., Grill, S., and Hyman, A.A. ((2003). ). SAS-4 is a C. elegans centriolar protein that controls centrosome size. Cell 112, , 575-587.[CrossRef][Medline]
Knop, M., and Schiebel, E. ((1997). ). Spc98p and Spc97p of the yeast gammatubulin complex mediate binding to the spindle pole body via their interaction with Spc110p. EMBO J. 16, , 6985-6995.[CrossRef][Medline]
Knop, M., and Schiebel, E. ((1998). ). Receptors determine the cellular localization of a gamma-tubulin complex and thereby the site of microtubule formation. EMBO J. 17, , 3952-3967.[CrossRef][Medline]
Lane, H.A., and Nigg, E.A. ((1996). ). Antibody microinjection reveals an essential role for human polo-like kinase (Plk1) in the functional maturation of centrosomes. J. Cell Biol. 135, , 1701-1713.
Li, F., Ambrosini, G., Chu, E.Y., Plescia, J., Tognin, S., Marchisio, P.C., and Altiere, D.C. ((1998). ). Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 396, : 580-584.[CrossRef][Medline]
Li, Q., Hansen, D., Killilea, A., Joshi, H.C., Palazzo, R.E., and Balczon, R. ((2001). ). Kendrin/pericentrin-B, a centrosome protein with homology to pericentrin that complexes with PCM-1. J. Cell Sci. 114, , 797-809.[Abstract]
Marshall, W.F., Vucica, Y., and Rosenbaum, J.L. ((2001). ). Kinetics and regulation of de novo centriole assembly. Implications for the mechanism of centriole duplication. Curr. Biol. 11, , 308-317.[CrossRef][Medline]
Martin, O.C., Gunawardane, R.N., Iwamatsu, A., and Zheng, Y. ((1998). ). Xgrip 109, a gamma tubulin-associated protein with an essential role in gamma tubulin ring complex (gammaTuRC) assembly and centrosome function. J. Cell Biol. 141, , 675-687.
Megraw, T.L., Li, K., Kao, L.R., and Kaufman, T.C. ((1999). ). The centrosomin protein is required for centrosome assembly and function during cleavage in Drosophila. Development 126, , 2829-2839.[Abstract]
Merdes, A., Ramyar, K., Vechio, J.D., and Cleveland, D.W. ((1996). ). A complex of NuMA and cytoplasmic dynein is essential for mitotic spindle assembly. Cell 87, , 447-458.[CrossRef][Medline]
Mikhailov, A., and Rieder, C.L. ((2002). ). Cell cycle: stressed out of mitosis. Curr. Biol. 12, , R331-R333.[CrossRef][Medline]
Moritz, M., Braunfeld, M.B., Sedat, J.W., Alberts, B., and Agard, D.A. ((1995a). ). Microtubule nucleation by gamma-tubulin-containing rings in the centrosome. Nature 378, , 638-640.[CrossRef][Medline]
Moritz, M., Zheng, Y., Alberts, B.M., and Oegema, K. ((1998). ). Recruitment of the g tubulin ring complex to Drosophila salt-stripped centrosome scaffolds. J. Cell Biol. 142, , 775-786.
Murphy, S.M., Preble, A.M., Patel, U.K., O'Connell, K.L., Dias, D.P., Moritz, M., Agard, D., Stults, J.T., and Stearns, T. ((2001). ). GCP5 and GCP 6, two new members of the human gamma-tubulin complex. Mol. Biol. Cell 12, , 3340-3352.
Murphy, S.M., Urbani, L., and Stearns, T. ((1998). ). The mammalian gammatubulin complex contains homologues of the yeast spindle pole body components spc97p and spc98p. J. Cell Biol. 141, , 663-674.
Murray, A.W. ((1991). ). Cell cycle extracts. Methods Cell Biol. 36, , 581-605.[Medline]
Nachury, M.V., Maresca, T.J., Salmon, W.C., Waterman-Storer, C.M., Heald, R., and Weis, K. ((2001). ). Importin beta is a mitotic target of the small GTPase Ran in spindle assembly. Cell 104, , 95-106.[CrossRef][Medline]
Nguyen, T., Vinh, D.B., Crawford, D.K., and Davis, T.N. ((1998). ). A genetic analysis of interactions with Spc110p reveals distinct functions of Spc97p and Spc98p, components of the yeast gamma-tubulin complex. Mol. Biol. Cell 9, , 2201-2216.
Oegema, K., Wiese, C., Martin, O.C., Milligan, R.A., Iwamatsu, A., Mitchison, T.J., and Zheng, Y. ((1999). ). Characterization of two related Drosophila gammatubulin complexes that differ in their ability to nucleate microtubules. J. Cell Biol. 144, , 721-733.
Piehl, M., Tulu, U.S., Wadsworth, P., and Cassimeris, L. ((2004). ). Centrosome maturation: measurement of microtubule nucleation throughout the cell cycle by using GFP-tagged EB1. Proc Natl Acad Sci USA 101, , 1584-1588.
Piekorz, R.P., Hoffmeyer, A., Duntsch, C.D., McKay, C., Nakajima, H., Sexl, V., Snyder, L., Rehg, J., and Ihle, J.N. ((2002). ). The centrosomal protein TACC3 is essential for hematopoietic stem cell function and genetically interfaces with p53 regulated apoptosis. EMBO Journal 21, , 653-664.[CrossRef][Medline]
Pines, J., and Rieder, C.L. ((2001). ). Re-staging mitosis: a contemporary view of mitotic progression. Nat. Cell Biol. 3, , E3-E6.[CrossRef][Medline]
Preuss, U., Bierbaum, H., Buchenau, P., and Scheidtmann, K.H. ((2003). ). DAP-like kinase, a member of the death-associated protein kinase family, associates with centrosomes, centromeres, and the contractile ring during mitosis. Eur. J. Cell Biol. 82, , 447-459.[Medline]
Prigozhina, N.L., Oakley, C.E., Lewis, A.M., Nayaka, T., Osmani, S.A., and Oakley, B.R. ((2004). ).
-Tubulin plays an essential role in the coordination of mitotic events. Mol. Biol. Cell 15, , 1374-1386.
Purohit, A., Pihan, G., and Doxsey, S. ((2001). ). Methods for the study of pericentrin in centrosome assembly and function. Methods Cell Biol. 2001, , 53-69.
Purohit, A., Tynan, S.H., Vallee, R., and Doxsey, S.J. ((1999). ). Direct interaction of pericentrin with cytoplasmic dynein light intermediate chain contributes to mitotic spindle organization. J. Cell Biol. 147, , 481-491.
Rajagopalan, S., Bimbo, A., Balasubramanian, M.K., and Oliferenko, S. ((2004). ). A potential tension-sensing mechanism that ensures timely antephase onset upon metaphase spindle orientation. Curr. Biol. 14, , 69-74.[CrossRef][Medline]
Reed, J.C., and Reed, S.I. ((1999). ). Survivin'cell-separation anxiety. Nat. Cell Biology 1, , E199-E200.[CrossRef][Medline]
Sampaio, P., Rebollo, E., Varmark, H., Sunkel, C.E., and Gonzalez, C. ((2001). ). Organized microtubule arrays in gamma-tubulin-depleted Drosophila spermatocytes. Curr. Biol. 11, , 1788-1793.[CrossRef][Medline]
Sandal, T., Aumo, L., Hedin, L., Gjertsen, B.T., and Doskeland, S.O. ((2003). ). Irod/Ian 5, an inhibitor of
-radiation- and okadaic acid-induced apoptosis. Mol. Biol. Cell 14, , 3292-3304.
Scolnick, D.M., and Halazonetis, T.D. ((2000). ). Chfr defines a mitotic stress checkpoint that delays entry into metaphase. Nature 406, , 430-435.[CrossRef][Medline]
Stearns, T., Evans, L., and Kirschner, M. ((1991). ). Gamma tubulin is a highly conserved component of the centrosome. Cell 65, , 825-836.[CrossRef][Medline]
Stearns, T., and Kirschner, M. ((1994). ). Reconstitution of centrosome assembly, role of gamma tubulin. Cell 76, , 623-637.[CrossRef][Medline]
Strome, S., Powers, J., Dunn, M., Reese, K., Malone, C.J., White, J., Seydoux, G., and Saxton, W. ((2001). ). Spindle dynamics and the role of gamma-tubulin in early Caenorhabditis elegans embryos. Mol. Biol. Cell 12, , 1751-1764.
Sumiyoshi, E., Sugimoto, A., and Yamamoto, M. ((2002). ). Protein phosphatase 4 is required for centrosome maturation in mitosis and sperm meiosis in C. elegans. J. Cell Sci. 115, , 1403-1410.
Sunkel, C.E., Gomes, R., Sampaio, P., Perdigao, J., and Gonzalez, C. ((1995). ). Gamma-tubulin is required for the structure and function of the microtubule organizing centre in Drosophila neuroblasts. EMBO J. 14, , 28-36.[Medline]
Swedlow, J.R., and Hirano, T. ((2003). ). The making of the mitotic chromosome: modern insights into classical questions. Mol. Cell 11, , 557-569.[CrossRef][Medline]
Takahashi, M., Yamagiwa, A., Nishimura, T., Mukai, H., and Ono, Y. ((2002). ). Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol. Biol. Cell 13, , 3235-3245.
Tassin, A.M., Celati, C., Paintrand, M., and Bornens, M. ((1997). ). Identification of an Spc110p-related protein in vertebrates. J. Cell Sci. 110, , 2533-2545.[Abstract]
Terada, Y., Uetake, Y., and Kuriyama, R. ((2003). ). Interaction of Aurora-A and centrosomin at the microtubule-nucleating site in Drosophila and mammalian cells. J. Cell Biol. 162, , 757-763.
Tyler, K.L., Clarke, P., DeBiasi, R.L., Kominsky, D., and Poggioli, G.J. ((2001). ). Reoviruses and the host cell. Trends Microbiol. 9, , 560-564.[CrossRef][Medline]
Tynan, S.H., Purohit, A., Doxsey, S.J., and Vallee, R.B. ((2000). ). Light intermediate chain 1 defines a functional subfraction of cytoplasmic dynein which binds to pericentrin. J. Biol. Chem. 275, , 32763-32768.
Wiese, C., Wilde, A., Moore, M.S., Adam, S.A., Merdes, A., and Zheng, Y. ((2001). ). Role of importin-beta in coupling Ran to downstream targets in microtubule assembly. Science 291, , 653-656.
Wiese, C., and Zheng, Y. ((2000). ). A new function for the gamma-tubulin ring complex as a microtubule minus-end cap. Nat. Cell Biol. 2, , 358-364.[CrossRef][Medline]
Wilde, A., and Zheng, Y. ((1999). ). Stimulation of microtubule aster formation and spindle assembly by the small GTPase ran. Science 284, , 1359-1362.
Wittmann, T., Wilm, M., Karsenti, E., and Vernos, I. ((2000). ). TPX2, A novel Xenopus MAP involved in spindle pole organization. J. Cell Biol. 149, , 1405-1418.
Xu, B., Kim, S., Lim, D., and Kastan, M.B. ((2002). ). Two molecularly distinct G2/M checkpoints are induced by ionizing irradiation. Mol. Cell. Biol. 22, , 1049-1059.
Zheng, Y., Jung, M.K., and Oakley, B.R. ((1991). ).
-Tubulin is present in Drosophila melanogaster and Homo sapiens and is associated with the centrosome. Cell 65, , 817-823.[CrossRef][Medline]
Zheng, Y., Wong, M.L., Alberts, B., and Mitchison, T. ((1995). ). Nucleation of microtubule assembly by a gamma tubulin-containing ring complex. Nature 378, , 578-583.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
X. Zhang, Q. Chen, J. Feng, J. Hou, F. Yang, J. Liu, Q. Jiang, and C. Zhang Sequential phosphorylation of Nedd1 by Cdk1 and Plk1 is required for targeting of the {gamma}TuRC to the centrosome J. Cell Sci., July 1, 2009; 122(13): 2240 - 2251. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Fant, N. Gnadt, L. Haren, and A. Merdes Stability of the small {gamma}-tubulin complex requires HCA66, a protein of the centrosome and the nucleolus J. Cell Sci., April 15, 2009; 122(8): 1134 - 1144. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Barr and F. Gergely MCAK-Independent Functions of ch-Tog/XMAP215 in Microtubule Plus-End Dynamics Mol. Cell. Biol., December 1, 2008; 28(23): 7199 - 7211. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sudo and Y. Maru LAPSER1/LZTS2: a pluripotent tumor suppressor linked to the inhibition of katanin-mediated microtubule severing Hum. Mol. Genet., August 15, 2008; 17(16): 2524 - 2540. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Trammell, N. M. Mahoney, D. A. Agard, and R. D. Vale Mob4 plays a role in spindle focusing in Drosophila S2 cells J. Cell Sci., April 15, 2008; 121(8): 1284 - 1292. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Cunningham and R. A. Kahn Cofactor D Functions as a Centrosomal Protein and Is Required for the Recruitment of the {gamma}-Tubulin Ring Complex at Centrosomes and Organization of the Mitotic Spindle J. Biol. Chem., March 14, 2008; 283(11): 7155 - 7165. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rauch, C. T. Thiel, D. Schindler, U. Wick, Y. J. Crow, A. B. Ekici, A. J. van Essen, T. O. Goecke, L. Al-Gazali, K. H. Chrzanowska, et al. Mutations in the Pericentrin (PCNT) Gene Cause Primordial Dwarfism Science, February 8, 2008; 319(5864): 816 - 819. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-W. Fong, Y.-K. Choi, J. B. Rattner, and R. Z. Qi CDK5RAP2 Is a Pericentriolar Protein That Functions in Centrosomal Attachment of the {gamma}-Tubulin Ring Complex Mol. Biol. Cell, January 1, 2008; 19(1): 115 - 125. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wiese Distinct Dgrip84 Isoforms Correlate with Distinct {gamma}-Tubulins in Drosophila Mol. Biol. Cell, January 1, 2008; 19(1): 368 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Sarmah, V. P. Winfrey, G. E. Olson, B. Appel, and S. R. Wente A role for the inositol kinase Ipk1 in ciliary beating and length maintenance PNAS, December 11, 2007; 104(50): 19843 - 19848. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Sillibourne, B. Delaval, S. Redick, M. Sinha, and S. J. Doxsey Chromatin Remodeling Proteins Interact with Pericentrin to Regulate Centrosome Integrity Mol. Biol. Cell, September 1, 2007; 18(9): 3667 - 3680. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jeong, J. Lee, K. Kim, J. C. Yoo, and K. Rhee Characterization of NIP2/centrobin, a novel substrate of Nek2, and its potential role in microtubule stabilization J. Cell Sci., June 15, 2007; 120(12): 2106 - 2116. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Robert, G. Margall-Ducos, J.-E. Guidotti, O. Bregerie, C. Celati, C. Brechot, and C. Desdouets The intraflagellar transport component IFT88/polaris is a centrosomal protein regulating G1-S transition in non-ciliated cells J. Cell Sci., February 15, 2007; 120(4): 628 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Golubkov, A. V. Chekanov, A. Y. Savinov, D. V. Rozanov, N. V. Golubkova, and A. Y. Strongin Membrane Type-1 Matrix Metalloproteinase Confers Aneuploidy and Tumorigenicity on Mammary Epithelial Cells Cancer Res., November 1, 2006; 66(21): 10460 - 10465. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wang, X. Du, J. Meinkoth, Y. Hirohashi, H. Zhang, Q. Liu, M. Richter, and M. I. Greene Characterization of Su48, a centrosome protein essential for cell division PNAS, April 25, 2006; 103(17): 6512 - 6517. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Haren, M.-H. Remy, I. Bazin, I. Callebaut, M. Wright, and A. Merdes NEDD1-dependent recruitment of the {gamma}-tubulin ring complex to the centrosome is necessary for centriole duplication and spindle assembly J. Cell Biol., February 13, 2006; 172(4): 505 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Verollet, N. Colombie, T. Daubon, H.-M. Bourbon, M. Wright, and B. Raynaud-Messina Drosophila melanogaster {gamma}-TuRC is dispensable for targeting {gamma}-tubulin to the centrosome and microtubule nucleation J. Cell Biol., February 13, 2006; 172(4): 517 - 528. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zhao, S. Maruo, A. Cooper, M. R. Chase, E. Johannsen, E. Kieff, and E. Cahir-McFarland RNAs induced by Epstein-Barr virus nuclear antigen 2 in lymphoblastoid cell lines PNAS, February 7, 2006; 103(6): 1900 - 1905. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Guo, Z. Yang, W. Song, Q. Chen, F. Wang, Q. Zhang, and X. Zhu Nudel Contributes to Microtubule Anchoring at the Mother Centriole and Is Involved in Both Dynein-dependent and -independent Centrosomal Protein Assembly Mol. Biol. Cell, February 1, 2006; 17(2): 680 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Colombie, C. Verollet, P. Sampaio, A. Moisand, C. Sunkel, H.-M. Bourbon, M. Wright, and B. Raynaud-Messina The Drosophila {gamma}-Tubulin Small Complex Subunit Dgrip84 Is Required for Structural and Functional Integrity of the Spindle Apparatus Mol. Biol. Cell, January 1, 2006; 17(1): 272 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hanisch, A. Wehner, E. A. Nigg, and H. H.W. Sillje Different Plk1 Functions Show Distinct Dependencies on Polo-Box Domain-mediated Targeting Mol. Biol. Cell, January 1, 2006; 17(1): 448 - 459. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Golubkov, A. V. Chekanov, S. J. Doxsey, and A. Y. Strongin Centrosomal Pericentrin Is a Direct Cleavage Target of Membrane Type-1 Matrix Metalloproteinase in Humans but Not in Mice: POTENTIAL IMPLICATIONS FOR TUMORIGENESIS J. Biol. Chem., December 23, 2005; 280(51): 42237 - 42241. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Golubkov, S. Boyd, A. Y. Savinov, A. V. Chekanov, A. L. Osterman, A. Remacle, D. V. Rozanov, S. J. Doxsey, and A. Y. Strongin Membrane Type-1 Matrix Metalloproteinase (MT1-MMP) Exhibits an Important Intracellular Cleavage Function and Causes Chromosome Instability J. Biol. Chem., July 1, 2005; 280(26): 25079 - 25086. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sutterlin, R. Polishchuk, M. Pecot, and V. Malhotra The Golgi-associated Protein GRASP65 Regulates Spindle Dynamics and Is Essential for Cell Division Mol. Biol. Cell, July 1, 2005; 16(7): 3211 - 3222. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Samejima, P. C. C. Lourenco, H. A. Snaith, and K. E. Sawin Fission Yeast mto2p Regulates Microtubule Nucleation by the Centrosomin-related Protein mto1p Mol. Biol. Cell, June 1, 2005; 16(6): 3040 - 3051. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jurczyk, A. Gromley, S. Redick, J. S. Agustin, G. Witman, G. J. Pazour, D. J.M. Peters, and S. Doxsey Pericentrin forms a complex with intraflagellar transport proteins and polycystin-2 and is required for primary cilia assembly J. Cell Biol., August 30, 2004; 166(5): 637 - 643. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||