![]() |
|
|
Vol. 15, Issue 9, 4278-4288, September 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









* Departments of Medicine and Molecular and Cellular Pharmacology, University of California, San Francisco, CA 94143;
Department of Physiology, University of Tubingen, Tubingen D72076, Germany; and
Department of Dermatology, University of California, San Francisco, CA 94143
Submitted January 14, 2004;
Revised June 10, 2004;
Accepted June 29, 2004
Monitoring Editor: Richard Assoian
| ABSTRACT |
|---|
|
|
|---|
-catenin in hair bulb keratinocytes. Furthermore, in cultured keratinocytes, heterologous expression of SGK3 potently modulates activation of
-catenin/Lef-1mediated gene transcription. These data establish a role for SGK3 in normal postnatal hair follicle development, possibly involving effects on
-catenin/Lef-1mediated gene transcription. | INTRODUCTION |
|---|
|
|
|---|
| MATERIALS AND METHODS |
|---|
|
|
|---|
PCR Analysis of Genotype and Sex
Genomic DNA was prepared from tail biopsies by overnight digestion in 500 µl of proteinase K/STE (1% SDS, 50 mM Tris-Cl, pH 8.0, 0.5M NaCl, 1 mM EDTA) (0.5 mg/ml). Digests were diluted 1:100 and used directly in PCR reactions with the forward primer 5'CTTCTTGCAAAACGGAAACTGGATG3' and the reverse primer 5'CCCCTCCATTAACAAAATCCAGAAC 3'. Reactions were performed using LA Taq (TaKaRa; Otsu, Shiga, Japan) with the conditions 94°C 1 min; 94°C 30 s, 62°C 45 s, 68°C 7 min for 14 cycles, and then increased extension by 15 s/cycle; final extension of 72°C for 15 min. PCR products were resolved on 1% agarose gels. The wild-type (WT) allele PCR product was 0.2 kb; that for the mutated allele was 1.9 kb. Sexing of newborn mice was performed by PCR as described previously (McClive and Sinclair, 2001
).
Northern Blot Analyses
Total RNA was isolated using STAT-60 reagent (Tel-Test Inc., Friendswood, TX). Eight micrograms of RNA was resolved by formaldehyde-agarose gel electrophoresis, transferred to Hybond-NX membrane (Amersham Biosciences, Piscataway, NJ) and probed with a fragment spanning the entire Sgk3 open reading frame. After autoradiographic exposure, the membrane was stripped and reprobed multiple times by using fragments corresponding to the Sgk1, Sgk2, Akt1, Akt2 (to assess compensatory induction), and cyclophilin (loading control) coding sequences.
Western Blot Analysis
Western blot analysis was performed as described previously (Chen et al., 1999
). Protein extracts from WT and Sgk3 KO mice were used for Western blot analysis by using an SGK antibody (gift from Dr. G. Firestone, University of California, Berkeley, CA) that cross-reacts with SGK1, SGK2, and SGK3. To distinguish between the three SGK isoforms, SGK1, SGK2, and SGK3 proteins synthesized in a coupled reticulocyte system (Promega, Madison, WI) were analyzed on the same blot; this also confirmed the expected size for the SGK3 protein (56.4 kDa).
Histological Studies
To analyze skin morphology, dorsal skin was biopsied and fixed overnight in 10% neutral buffered formalin (Fisher Scientific, Hampton, NH). Samples were dehydrated, paraffin-embedded, and sectioned (6 µm). For basic morphology, sections were deparaffinized and stained with hematoxylin and eosin; samples were taken from heterozygote and Sgk3 KO littermates to obtain sufficient numbers.
In Situ Hybridization
Localization of Sgk3 mRNA expression in dorsal skin was determined using 6-µm-longitudinal sections (paraffin-embedded) of skin from Sgk3+/ mice by in situ hybridization, as described previously (Etchevers et al., 2001
), except sections were not treated with proteinase K, and after hybridization, slides were washed twice in 50% formamide, 1 x SSC, 0.1% Tween 20. Postpartum day 1 (P1), P3, and P4 sections were exposed to substrate for 9 d; P5 sections were exposed for 6 d. Sections were counterstained with nuclear fast red (Sigma-Aldrich, St. Louis, MO), dehydrated and permanently mounted.
Proliferating Cell Nuclear Antigen (PCNA) and
-Catenin Immunohistochemistry, and Terminal Deoxynucleotidyl Transferase dUTP Nick-End Labeling (TUNEL)
Immunohistochemistry was performed on 6-µm-longitudinal sections (paraffin-embedded) from Sgk3 heterozygotye and KO mice by using the M.O.M. immunohistochemistry kit, and alkaline phosphatase detection system in conjunction with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) (all from Vector Laboratories, Burlingame, CA) according to the manufacturer's protocol, except with incubation times of 60 min for primary antibody, 20 min for secondary antibody, and 20 min for ABC. Dilutions of 1:100 of anti-mouse PCNA antibody (Novocastra Laboratories, Newcastle-On-Tyne, United Kingdom), 1:50 of anti-mouse
-catenin antibody (BD Transduction Laboratories, Lexington, KY) were used. BCIP/NBT detection substrate was incubated for 20 to 80 min, to achieve optimal staining. Sections were counterstained with Nuclear Fast Red, dehydrated, and permanently mounted. TUNEL was performed using the DeadEnd colorimetric TUNEL system (Promega, Madison, WI) according to the manufacturer's protocol; sections were dehydrated and permanently mounted.
Cell Culture and [3H]Thymidine Incorporation in Mouse Primary Keratinocytes
Primary mouse keratinocytes were prepared from P4 heterozygote and KO mice by using a protocol developed in our laboratory. Briefly, culture flasks or plates first were coated with a collagen/fibronectin mix containing 0.01 mg/ml fibronectin, 0.032 mg/ml type 1 collagen and 0.1 mg/ml bovine serum albumin dissolved in mouse keratinocyte media (EMEM with EBSS; Cambrex Bio Science Walkersville, Walkersville, MD). Dispersed keratinocytes were collected by centrifugation and the cells then were resuspended in mouse keratinocyte media (EMEM with EBSS; Cambrex Bio Science Walkersville) containing 10% chelexed fetal bovine serum (FBS), penicillin/streptomycin/amphotericin, and 0.025 mM Ca2+. EGF (50 ng/ml) was added 5 h after initial plating, to allow optimum keratinocyte attachment. Primary keratinocytes (2 x 105) from Sgk3 heterozygote or KO mice were seeded on six-well plates and incubated for 24 h, followed by pulsing for 8 h with [3H]thymidine (1 mCi/well). Cultures were washed twice with phosphate-buffered saline, and reactions were terminated using ice-cold 5% trichloroacetic acid (TCA).Cells were washed with an additional volume of 5% TCA and with distilled water and were solubilized in 0.3 M NaOH for 10 min at 50°C. The amount of [3H]thymidine incorporated into DNA was determined by liquid scintillation counting.
Transient Transfection Assays
HaCaT cells (generously provided by Dr. N. Fusenig, German Cancer Research Center, Heidelberg, Germany) were maintained in DMEM supplemented with 10% FBS. Newborn human primary keratinocytes were maintained in medium 154CF supplemented with human keratinocyte growth supplement and 70 µM CaCl2 (Cascade Biologics, Portland, OR). The mouse SGK3 open reading frame was subcloned into pCDNA3 (SGK3), and expression vectors for kinase-dead (K191M, which prevents ATP-binding to the SGK3 catalytic site) and constitutively active (S486D, which substitutes an acidic residue that mimics phosphorylation by PDK1) forms of SGK3 were generated by PCR-based mutagenesis. The FKHRL1-responsive promoter plasmid (FHRE) and FKHRL1 expression plasmids were provided by Dr. M. Greenberg (Harvard Medical School, Boston, MA). The reporter consisting of seven Lef-1 response elements driving luciferase (p7 Lef-fos Luc) and a Lef-1 expression vector were provided by Dr. R. Grosschedl (University of Munich, Munich, Germany). For transient transfections, low passage HaCaT cells or primary keratinocytes at passage 3 or 4 were seeded 24 h before transfection at a density of 2 x 105 cells/well in six-well plates. Transient transfections were performed using the TransIT reagent (Mirus, Madison, WI) according to the manufacturer's protocol. For Lef-1 experiments in HaCaT cells, 100 ng of reporter, 10 ng of Lef-1 and 5, and 10 or 25 ng of mutant SGK3 were used. Twenty-four hours after transfection, serum-free medium was added; after a further 18 h, fresh serum-free medium with 50 µM LY294002 or dimethyl sulfoxide (vehicle) was added. Cells were harvested after a further 6 h and freeze-thaw lysed in 100 µl of 0.25 M Tris, pH 7.6. For human foreskin keratinocyte (NHK) cells, 100 ng of reporter, 100 ng of Lef-1, and 100 ng of mutant SGK3 were used. For FHRE experiments, 100 ng of FHRE, 300 ng of FKHRL1, and 25 ng of WT or mutant SGKs were used. For EGF treatment, 24 h posttransfection, insulin-free medium lacking EGF, or with 50 ng/ml EGF or transforming growth factor (TGF)-
, were added and cells harvested 24 h later. Luciferase activity of 5 µl of lysate was assayed using Promega Luciferin Reagent and normalized to total protein levels, which were measured by adding 100 µl of Bio-Rad protein assay dye (Bio-Rad, Hercules, CA) to 5 µl of lysate and measuring in a plate reader. Transfections were performed at least three times.
Weight and Growth Analyses
To assess for disturbances of weight and growth, several analyses were performed. Newborn mice from 7 litters were weighed within 18 h of birth, sacrificed and tails harvested, and genotype and sex determined by PCR as described. 10 d old mice from 7 litters were categorized according to whether they displayed the hair phenotype, and weighed; WT and heterozygote mice were not distinguished, and sex was not determined. Despite not distinguishing between sexes, this analysis is valid, because male and female mice of the same genetic background, including the B6;129 background, do not differ significantly in body weight at P10; body weights of male and female mice only begin to diverge after weaning (P21) (Rhees and Atchley, 2000
; Lupu et al., 2001
). Thus, differences in the numbers of male or female mice between genotypes will not skew the data. To calculate the relative weight of Sgk3 KO mice, their weights were expressed relative to the mean weights of WT and heterozygote mice (set to 100%). The relative weights of Sgk3 KO mice were calculated for seven litters and meaned. For growth curves from 3 to 8 wk of age, mice from 15 litters (including those weighed at P10) were sexed, genotyped by PCR, and weaned at 3 wk of age. Weights were measured weekly from 3 to 8 wk of age.
Intraperitoneal Glucose Tolerance Test
WT and Sgk3 KO littermates of the same sex were fasted overnight (16 h) and then injected intraperitoneally with 1 mg/g of body weight D-glucose [10% (wt/vol) stock solution in phosphate-buffered saline]. Blood samples were collected from the transversely sectioned tip of the tail, and whole blood glucose was measured using a Glucometer Elite (Bayer, Leverkusen, Germany) at 0 min (just before glucose injection), and at 15-, 30-, 60-, 90-, 120-, 180-, and 240-min intervals after the glucose load.
Sodium Balance Studies
Six each of wild-type and SGK3/ mice (3 mo of age), were kept in metabolic cages for an acclimatization period of 4 d with free access to water and food (standard diet C1314, 0.2% Na; Altromin, Lage, Germany). Urine was collected every 24 h for 7 d and stored at 20°C. From the second day of urine collection, the standard diet was changed to a low sodium diet (C1036, 0.015% Na; Altromin). After 4 d, the mice were returned to the standard diet. Blood was drawn, from the orbital plexus before and after 4 d on the low sodium diet, and serum was separated by centrifugation and stored at 20°C. Serum aldosterone was measured with a commercial RIA-kit (Aldosterone RIA, Diagnostic Systems Laboratories, Webster, TX) according to the manufacturer's protocol. Urinary sodium concentration was determined using colorimetric analysis (Advia 1650; Bayer). Urinary 24-h excretion of sodium was calculated using the daily urine volume.
Statistical Analyses
All data were analyzed using the Statview 4.5 software package. For growth curves, glucose tolerance tests and sodium balance studies, a repeated measure analysis of variance (ANOVA) was performed.
| RESULTS |
|---|
|
|
|---|
|
Mice Lacking SGK3 Are Viable but Display a Defect in Postnatal Hair Follicle Development
Sgk3 KO mice seemed normal at birth, but by P10 clearly displayed sparse hair growth relative to WT littermates (Figure 2A); heterozygotes were indistinguishable from WT mice. This initial abnormality persisted for at least 4 wk (Figure 2B); however, as the Sgk3 KO mice increased in age, the hair became increasingly thick (Figure 2C). At all ages, Sgk3 KO mice displayed wavy coat fur and curly vibrissae that resembled those of mice with spontaneously or engineered mutations in the EGF/TGF-
and
-catenin signaling pathways (see below) (Luetteke et al., 1993
, 1994
; Mann et al., 1993
; Murillas et al., 1995
; Sibilia and Wagner, 1995
; Threadgill et al., 1995
; Hansen et al., 1997
; Gat et al., 1998
; DasGupta and Fuchs, 1999
; Fuchs et al., 2001
; Huelsken et al., 2001
; Andl et al., 2002
).
|
Hair growth in rodents and humans is cyclic and proceeds through proliferative (anagen), regressive (catagen), and quiescent (telogen) phases (Muller-Rover et al., 2001
). In mice, hair follicle development (also called morphogenesis) begins at embryonic day 14.5 (E14.5) with placode formation and is completed at P16 with termination of the first growth phase (first anagen), at which time large numbers of hair follicles reside deep in the subcutis (Muller-Rover et al., 2001
). By P19, catagen (characterized by hair bulb involution and a reduction in hair follicle length) is advanced, and by P22 the first hair cycle has finished and follicles are in telogen (characterized by thinning of the subcutis, and follicles which reside entirely in the dermis and lack an inner root sheath [IRS]). The second anagen phase begins at approximately P26: the dermal papilla becomes enlarged, the hair bulb and IRS reform and a new hair shaft begins to develop (Muller-Rover et al., 2001
). To determine at what stage hair follicle morphogenesis becomes abnormal in Sgk3 KO mice, dorsal skin was harvested at various time points between E15.5 and P30 from KO mice and heterozygous littermates, sectioned, and examined by light microscopy. At all time points examined, the hair follicles of heterozygous mice underwent appropriately-timed development (Muller-Rover et al., 2001
) and were indistinguishable from WT mice (Figure 3, AE; unpublished data). Sgk3 KO embryos displayed normal early hair follicle development, as indicated by the presence of placodes and germs at E15.5 (unpublished data), and nascent follicles at P1 (Figure 3A) and P3 (unpublished data) that morphologically resembled those of wild-type animals. By P4, a clear defect in morphogenesis was emerging, characterized by a failure of the hair bulb to enlarge and migrate deep into the subcutis (Figure 3B). This defect became more pronounced by P5 (Figure 3C) and persisted through follicle morphogenesis (i.e., at P7, P10, and P14; unpublished data), and beyond. At P19, when heterozygotes were in late catagen (Figure 3D) and at P22, when they had progressed fully into telogen, the Sgk3 KO animals were still consolidating their first anagen (Figure 3E). Morphologically, the developing hair follicles in knockout mice were disorganized, lacking the uniform orientation observed in WT and heterozygote mice. The cells of the outer root sheath (ORS) were disorganized (Figure 3F), and the layers of the inner root sheath were reduced, as was the hair shaft. These defects are the most likely cause of the wavy hair growth observed in Sgk3 KO mice. The early hair abnormality in Sgk3 KO mice thus seems to be a combination of impaired follicle progression through the first hair cycle and abnormal follicle organization. Although adult mice also display the hair follicle defect (i.e., wavy hair) observed in young mice (Figure 2C), further studies are required to determine whether this is also accompanied by defects in hair cycling. It is also notable that histological abnormalities were confined to the follicles themselves; interfollicular epidermis seemed normal, and the progressive thickening of the dermis and subcutaneous fat that accompanies entry into anagen in wild-type and heterozygous mice proceeded normally in Sgk3 KO mice (Figure 3). Together with the SGK3 expression pattern (described below), these observations suggest that the defect in Sgk3 KO animals is intrinsic to the follicular keratinocytes.
|
Sgk3 mRNA Is Discretely Expressed in the Hair Follicle
To begin to understand the cellular basis of the effect of SGK3 in regulating hair follicle morphogenesis, Sgk3 mRNA expression was localized by in situ hybridization in dorsal skin sections from early postnatal heterozygote animals. SGK3 showed a highly restricted pattern of expression in skin: At P1 and P3, SGK3 expression was relatively low, and only apparent in the root sheath of a small number of hair follicles (Figure 4; unpublished data). By P4, expression was increasing and becoming particularly intense in a subset of root sheath cells (possibly isolated to the basal layer of the ORS), with lower level expression in matrix cells (which give rise to the IRS and precursors of the hair shaft). At P5, intense expression was seen in root sheath (seeming to encompass both outer and inner root sheath) and in some matrix cells, with lower level expression seen in numerous matrix cells of the hair bulb (Figure 4). At no time point was Sgk3 mRNA expressed appreciably in interfollicular epidermis, nor was it expressed in nonepithelial cells of the skin or underlying subcutis.
|
Defective Proliferation and Normal Apoptotic Index in Sgk3 KO Hair Bulbs and Keratinocytes
To begin to dissect the mechanism underlying the hair follicle morphogenesis defect, PCNA immunolocalization was performed to assess follicular cell proliferation. In hair bulbs of heterozygotes, PCNA-positive keratinocytes progressively increased from P1 to P5 (Figure 5A). This increase was delayed and blunted in the Sgk3 KO mice. At P1, there was no apparent difference in PCNA staining between heterozygotes and KOs (Figure 5A), but at P3 a difference was beginning to emerge (Figure 5A). By P4, nuclear PCNA staining was strikingly lower in the hair bulbs of Sgk3 KOs (Figure 5A); in heterozygote hair bulbs, 57.4% of keratinocytes were PCNA positive compared with 10.9% in KO hair bulbs (p < 0.001; n = 10). At P5, this difference persisted, but it was less striking due to a late increase in PCNA-positive keratinocytes in the KOs (Figure 5A) (67.1% PCNA-positive nuclei in heterozygotes vs. 32.7% in KOs; p < 0.001; n = 10). At all ages, there was a high rate of proliferation in the interfollicular epidermis (unpublished data), and the ORS (Figure 5A), with no obvious differences between genotypes. In vitro proliferation assays performed on primary keratinocytes prepared from P4 Sgk3 heterozygote and KO mice revealed that Sgk3 KO keratinocytes display 39.1% less [3H]thymidine incorporation (16,295 ± 2657 [S.D.] vs. 26,748 ± 3078 cpm-incorporated [3H]thymidine after 8 h; p < 0.02; n = 4). TUNEL staining revealed no difference in apoptotic rates between heterozygote and Sgk3 KO hair follicles at P4 (unpublished data) or P5 (Figure 5B), suggesting that increased apoptosis is not a cause of the hair follicle defect. Together, these observations suggest that the hair growth defect in Sgk3 KO mice is due at least in part to a failure in induction of hair bulb keratinocyte proliferation.
|
Defective Nuclear Accumulation of
-Catenin in Sgk3 KO Hair Bulbs
Several previous observations have implicated the Wnt/
-catenin pathway in hair follicle development and cycling (Gat et al., 1998
; Fuchs et al., 2001
; Huelsken et al., 2001
; Andl et al., 2002
). Notably, selective expression of stabilized
-catenin in the ORS results in unchecked follicular proliferation (Gat et al., 1998
), whereas conditional timed disruption of
-catenin expression in hair follicles blocks further hair follicle development or cycling (Huelsken et al., 2001
). Furthermore, transgenic mice carrying a
-catenin/Lef-1-dependent reporter (TOPGAL) demonstrate reporter expression during hair follicle development that overlaps the Sgk3 expression found in the present study (Figure 4; DasGupta and Fuchs, 1999
). In view of these observations, we were interested in examining the timing and pattern of
-catenin expression in the follicles of Sgk3 null mice in the early postnatal period. Hence, we performed immunohistochemistry by using an anti-
-catenin antibody on skin sections from P1 to P5 in KO and heterozygous mice (Figure 5C). In interfollicular epidermis, most of the
-catenin was associated with the plasma membrane, and there was no difference between heterozygous and KO animals at any time point. In the follicular keratinocytes of P1 animals, most of the
-catenin staining was associated with plasma membrane or cytoplasm (Figure 5C), and although there was detectable nuclear accumulation of
-catenin in some cells, there was no clear difference between heterozygote and Sgk3 KO mice. By P3, however, nuclear
-catenin had begun to increase in root sheath and hair bulb keratinocytes of heterozygous but not in KO mice (Figure 5C). The difference increased progressively and by P5 there were substantially fewer
-cateninpositive nuclei in the lower root sheath and matrix cells of KO mice: 24.6% of the nuclei in the hair bulbs of Sgk3 KO mice displayed nuclear accumulation of
-catenin in contrast to 42.8% of nuclei in heterozygotes (p = 0.001; n = 10). It is notable that the proliferative defect and failure of
-catenin nuclear localization occurred at approximately the same stage of development (P3-P4) and hence temporal precedence could not be determined.
SGK3 Modulates
-Catenin/Lef-1 and FKHRL1-mediated Gene Transcription in Cultured Keratinocytes
Mutations in both growth factor-regulated PI3K-dependent pathways (Luetteke et al., 1993
, 1994
; Mann et al., 1993
; Murillas et al., 1995
; Sibilia and Wagner, 1995
; Threadgill et al., 1995
; Hansen et al., 1997
), and in the Wnt-
-catenin/Lef1 (Gat et al., 1998
; DasGupta and Fuchs, 1999
; Fuchs et al., 2001
; Huelsken et al., 2001
; Andl et al., 2002
) pathway have been associated with hair development abnormalities that resemble the SGK3 KO in many respects (see Discussion and below). Growth factors have well characterized inhibitory effects on forkhead-mediated gene transcription (Jackson et al., 2000
), and recent evidence has suggested that EGF in particular also may regulate
-catenin activities (Muller et al., 2002
; Lu et al., 2003
). To begin to define the potential signaling roles of SGK3 in these pathways, we examined the effects of transfected SGK3 on
-catenin/Lef-1 and forkhead reporters in transfected keratinocytes.
We looked first at SGK3 effects on the activity of a
-catenin/Lef-1 reporter (p7 Lef-fos Luc) (Giese and Grosschedl, 1993
) in HaCaT cells, an immortalized line derived from human keratinocytes (Boukamp et al., 1988
). As demonstrated in other cell lines (Giese and Grosschedl, 1993
), reporter activity was strongly Lef-1 dependent (Figure 6A). Interestingly, whereas a kinase-dead mutant of SGK3 (SGK3/K191M) inhibited reporter activity in a dose-dependent manner, a constitutively active mutant (SGK3/S486D) strongly stimulated reporter activity (Figure 6A). The inhibitory effect of the kinase-dead mutant is consistent with dominant-negative activity, which is not surprising in view of the fact that HaCaT cells express substantial levels of SGK3 (unpublished data). The PI3K inhibitor LY294002 also markedly blunted Lef-1dependent reporter activity, and this effect was completely reversed by coexpression of SGK3/S486D (Figure 6A), suggesting that SGK3 acts downstream of PI3K.
|
Although HaCaT cells demonstrated robust PI3K-dependent reporter activity, growth factors (EGF and TGF-
, in particular) had no effect. Unfortunately, repeated attempts to culture and transfect keratinocytes from Sgk3 KO mice were unsuccessful, possibly due to their low proliferative rate. We therefore next examined
-catenin/Lef-1 reporter activity in primary cultures of newborn NHK cells. In these cells, reporter activity was stimulated by EGF (Figure 6B), as well as by TGF-
, which also acts through the EGFR (unpublished data). Like HaCaT cells, NHK cells express endogenous SGK3 (unpublished data), and both basal and EFG-stimulated Lef-1 reporter activity was inhibited by SGK3/K191M (Figure 6B); SGK3/S486D stimulated reporter activity, mimicking the stimulatory effect of EGF. Furthermore, a reversal of LY294002 inhibition of reporter activity by SGK3/S486D also was seen in NHK cells (unpublished data). Together, these data suggest that SGK3 mediates EGF/TGF-
activation of
-catenin/Lef-1-dependent transcription in NHK cells.
Finally, we examined the response of a forkhead-dependent reporter gene in NHK cells cotransfected with SGK3 and an expression vector for the forkhead transcription factor FKHRL1. Consistent with previous results in 293T cells (Xu et al., 2001
), EGF inhibited FHRE activity, an effect that was mimicked by SGK3/S486D but not by wild-type SGK3, unless activated by EGF (Figure 6C).
Sgk3 KO Mice Display a Transient Growth Defect, Normal Glucose Disposal, and Normal Sodium Homeostasis
Although SGK3 is expressed in most if not all tissues, histological analysis revealed no gross abnormalities in tissues other than skin, possibly due to overlapping functions with other SGK/Akt family members. Akt1 KO mice weigh 2025% less than WT mice from birth to at least 14 mo of age (Chen et al., 2001
; Cho et al., 2001b
); Akt2 KO mice display insulin resistance, a diabetic phenotype, and a mild growth defect (Cho et al., 2001a
; Garofalo et al., 2003
), whereas Sgk1 KO mice display a sodium wasting phenotype (Wulff et al., 2002
). We therefore assessed birth weights and growth characteristics of Sgk3 KO mice and examined their response to a glucose challenge or sodium restriction.
Birth weights of Sgk3 KO mice did not significantly differ from WT or heterozygous littermate weights (Table 1). However, by P10, the relative weight of Sgk3 KO mice (identified by fur appearance, but not distinguished with respect to sex), was 10% less than WT/heterozygous littermates (t test; p < 0.001). From 3 to 6 wk of age, reduced body weight was discernible in male Sgk3 KO mice, but it had normalized by 7 wk of age (repeated measures ANOVA; p < 0.001) (Figure 7A). In contrast, female Sgk3 KO mice grew more rapidly than WT female mice over the same time course (repeated measures ANOVA; p = 0.02). Both of these effects were, however, mild. This mild transient growth abnormality of Sgk3 KO mice is statistically significant, but qualitatively different from that of Akt1 KO mice, which demonstrate substantial growth retardation throughout life. The subtle growth defect might reflect compensatory effects of Akt1. Furthermore, unlike Akt2 KO mice, glucose tolerance in 8- to 10-wk-old Sgk3 KO mice was indistinguishable from that of WT (Figure 7B). Sgk3 KO mice also exhibited normal sodium balance and aldosterone induction when placed on a low sodium diet (Figure 7, C and D), in contrast to Sgk1 KO mice. Hence, it seems that SGK3 is not required for normal glucose metabolism or renal sodium reabsorption or that its lack is compensated for by other SGK/Akt isoforms.
|
|
| DISCUSSION |
|---|
|
|
|---|
-catenin accumulation and a proliferative defect were apparent in P34 animals (Figure 5), both of which preceded gross histological changes (Figure 3). Thus, the hair follicle defect seems to be at least in part due to a failure of induction of proliferation in maturing hair follicles. The proximal cause of the proliferative defect cannot be discerned with certainty at this time because the abnormality in
-catenin localization did not clearly precede the proliferation defect. Furthermore, SGK3 seems to mediate effects on both
-catenin/Lef-1 and forkhead-dependent gene transcription (Figure 6). It also should be noted that in addition to proliferation, SGK3 might influence cell migration and differentiation.
It is notable that although no member of the SGK/Akt family has previously been identified as a primary mediator of hair follicle development, growth factor receptors that signal through PI3K have been strongly implicated in follicle development (Luetteke et al., 1994
; Murillas et al., 1995
; Sibilia and Wagner, 1995
; Threadgill et al., 1995
). Together, our present data suggest that SGK3 may play a role in linking PI3K signaling (possibly through EGFR-dependent activation of this pathway) to the regulation of both forkhead (traditional pathway) and
-catenin (alternate pathway). At this point, it is unclear whether defects in
-catenin nuclear localization precede defects in cellular proliferation in the follicles of Sgk3 KO mice, although
-catenin has been shown to have proliferative effects in other contexts (Giles et al., 2003
). Moreover, in cell culture experiments, a constitutively active mutant increased the activity of a
-catenin/Lef-1driven reporter in the absence of EGF or TGF-
(both of which act through EGFR), whereas a dominant negative SGK3 mutant inhibited basal and EGF-activated reporter activity (Figure 6, A and B). In contrast, constitutively active SGK3 inhibited FKHRL1-mediated gene transcription in the absence of the growth factors (Figure 6C). Because forkhead transcription factors are potent inhibitors of cell proliferation (Burgering and Medema, 2003
), their inhibition would be expected to contribute to a proliferative state.
The phenotypes of several mutant mouse models are also consistent with a role for SGK3 in mediating EGFR effects on keratinocytes through forkhead and
-catenin: between P2 and P5, EGFR expression in hair follicles increases dramatically (Hansen et al., 1997
), and Egfr KO mice display a hair growth phenotype with significant similarities to the Sgk3 KO described here (Sibilia and Wagner, 1995
; Threadgill et al., 1995
; Hansen et al., 1997
), as does the Wa-2 mouse, which is due to a spontaneously arising Egfr hypomorphic allele (Luetteke et al., 1994
). Similarly, both the TGF-
KO and spontaneously occurring Wa-1 mouse have hair growth abnormalities with features resembling the Sgk3 KO mice (Luetteke et al., 1993
; Mann et al., 1993
). Moreover, keratinocyte-specific deletion of phosphatase and tensin homolog on chromosome 10 results in acceleration of hair follicle morphogenesis (Suzuki et al., 2003
), and keratinocyte-specific overexpression of
-catenin causes de novo follicle development (Gat et al., 1998
).
Inhibition of glycogen synthase kinase (GSK)3-
through the Wnt pathway results in stabilization of free cytoplasmic
-catenin, which is subsequently translocated to the nucleus where it regulates gene transcription. Interestingly, although growth factors (acting through PI3K and SGK/Akt) also inhibit GSK3-
, it is widely believed that this inhibition is restricted from impacting on
-catenin stability (Biondi and Nebreda, 2003
). However, there is evidence to support the idea that in some contexts this is not the case. Thus, EGF induction of
-catenin signaling under conditions where it stimulates cell motility (Muller et al., 2002
), and Akt stabilization of
-catenin (Fukumoto et al., 2001
) have both been reported in vitro. Our data lend further in vivo support to this idea.
It should further be noted that the disorganized ORS, and reduced hair bulb, IRS, and hair shaft size observed in Sgk3 KO hair follicles suggest that SGK3 might play a role in mediating signals that control cell migration, which also plays an important role in hair follicle morphogenesis and adult hair cycling (Oshima et al., 2001
).
The precise substrates of SGK3 and its point of action in regulating
-catenin expression and nuclear accumulation remain to be resolved. Although it seems likely that effects on GSK3-
that influence
-catenin activation of gene transcription will be implicated, other components of the Wnt pathway and endosomal recycling pathways for activated EGFR also could be involved (Cozier et al., 2002
), as well as effects on forkhead family-regulated transcriptional events. Another intriguing possibility is that SGK3 alters cell proliferation by altering the activity of the epithelial sodium channel (ENaC) (Friedrich et al., 2003
). ENaC is expressed in keratinocytes (Mauro et al., 2002
) and can alter ionic milieu, cell volume, and proliferative state (Lang et al., 2003
).
Possible Redundancy between SGK3 and Other Members of the SGK/Akt Family
Given the widespread expression pattern of SGK3, it is worth noting the lack of gross abnormalities in tissues other than skin in Sgk3 KO mice. Similarly, Sgk1, Akt1, and Akt2 knockout mice have relatively mild phenotypes, which differ substantially from one another (Chen et al., 2001
; Cho et al., 2001a
,b
; Wulff et al., 2002
; Garofalo et al., 2003
). The phenotype of Akt1/Akt2 KO mice is distinct from and substantially more severe than either single gene deletion, suggesting partial redundancy between these two family members (Peng et al., 2003
). Thus, it seems likely that partial redundancy accounts for the relatively benign features of Sgk3 gene disruption, possibly due to overlap in substrate specificity (Kobayashi et al., 1999
; Liu et al., 2000
; Dai et al., 2002
) and phosphoinositide binding. Interestingly, the PX domain, present in SGK3 (Liu et al., 2000
) and possibly in SGK1 (Helms et al., 2003
), and the PH domain, present in Akt1 and Akt2 have partially overlapping phosphoinositide subtype binding (Virbasius et al., 2001
; Xu et al., 2001
). Full elucidation of the developmental and physiological roles of SGK3, as well as the mechanisms underlying its actions, will require characterization of animals with Sgk3 deletion in conjunction with deletion of other SGK/Akt genes.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Abbreviations used: E, embryonic day; ENaC, epithelial sodium channel; GSK, glycogen synthase kinase; IRS, inner root sheath; KO, knockout; NHK, newborn human keratinocyte; ORS, outer root sheath; P, postpartum day; PDK1, phosphoinositide-dependent kinase-1; PX, Phox homology; SGK, serum- and glucocorticoid-regulated kinase.
Corresponding author. E-mail address: pearced{at}medicine.ucsf.edu.
| REFERENCES |
|---|
|
|
|---|
Biondi, R.M., and Nebreda, A.R. ((2003). ). Signalling specificity of Ser/Thr protein kinases through docking-site-mediated interactions. Biochem. J. 372, , 113.[CrossRef][Medline]
Boukamp, P., Petrussevska, R.T., Breitkreutz, D., Hornung, J., Markham, A., and Fusenig, N.E. ((1988). ). Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 106, , 761771.
Burgering, B.M., and Medema, R.H. ((2003). ). Decisions on life and death: FOXO Forkhead transcription factors are in command when PKB/Akt is off duty. J. Leukoc. Biol. 73, , 689701.
Chen, S.Y., Bhargava, A., Mastroberardino, L., Meijer, O.C., Wang, J., Buse, P., Firestone, G.L., Verrey, F., and Pearce, D. ((1999). ). Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc. Natl. Acad. Sci. USA 96, , 25142519.
Chen, W.S., et al. ((2001). ). Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev. 15, , 22032208.
Cho, H., Mu, J., Kim, J.K., Thorvaldsen, J.L., Chu, Q., Crenshaw, E.B., 3rd, Kaestner, K.H., Bartolomei, M.S., Shulman, G.I., and Birnbaum, M.J. ((2001a). ). Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 292, , 17281731.
Cho, H., Thorvaldsen, J.L., Chu, Q., Feng, F., and Birnbaum, M.J. ((2001b). ). Akt1/PKBalpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J. Biol. Chem. 276, , 3834938352.
Cozier, G.E., Carlton, J., McGregor, A.H., Glesson, P.A., Teasdale, R.D., Mellor, H., and Cullen, P.J. ((2002). ). The PX domain-dependent, 3-phosphoinositide-mediated association of sorting nexin-1 with an early sorting endosomal compartment is required for its ability to regulate epidermal growth factor receptor degradation. J. Biol. Chem.
Dai, F., Yu, L., He, H., Chen, Y., Yu, J., Yang, Y., Xu, Y., Ling, W., and Zhao, S. ((2002). ). Human serum and glucocorticoid-inducible kinase-like kinase (SGKL) phosphorylates glycogen syntheses kinase 3 beta (GSK-3beta) at serine-9 through direct interaction. Biochem. Biophys. Res. Commun. 293, , 11911196.[CrossRef][Medline]
Dai, F., Yu, L., He, H., Zhao, Y., Yang, J., Zhang, X., and Zhao, S. ((1999). ). Cloning and mapping of a novel human serum/glucocorticoid regulated kinase-like gene, SGKL, to chromosome 8q12.3-q13.1. Genomics 62, , 9597.[CrossRef][Medline]
DasGupta, R., and Fuchs, E. ((1999). ). Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126, , 45574568.[Abstract]
Etchevers, H.C., Vincent, C., Le Douarin, N.M., and Couly, G.F. ((2001). ). The cephalic neural crest provides pericytes and smooth muscle cells to all blood vessels of the face and forebrain. Development 128, , 10591068.[Abstract]
Friedrich, B., Feng, Y., Cohen, P., Risler, T., Vandewalle, A., Broer, S., Wang, J., Pearce, D., and Lang, F. ((2003). ). The serine/threonine kinases SGK2 and SGK3 are potent stimulators of the epithelial Na(+) channel alpha,beta-,gamma-ENaC. Pflügers Arch. 445, , 693696.[Medline]
Fuchs, E., Merrill, B.J., Jamora, C., and DasGupta, R. ((2001). ). At the roots of a never-ending cycle. Dev Cell 1, , 1325.[CrossRef][Medline]
Fukumoto, S., et al. ((2001). ). Akt participation in the Wnt signaling pathway through Dishevelled. J. Biol. Chem. 276, , 1747917483.
Garofalo, R.S., et al. ((2003). ). Severe diabetes, age-dependent loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKB beta. J. Clin. Investig. 112, , 197208.[CrossRef][Medline]
Gat, U., DasGupta, R., Degenstein, L., and Fuchs, E. ((1998). ). De Novo hair follicle morphogenesis and hair tumors in mice expressing a truncated betacatenin in skin. Cell 95, , 605614.[CrossRef][Medline]
Giese, K., and Grosschedl, R. ((1993). ). LEF-1 contains an activation domain that stimulates transcription only in a specific context of factor-binding sites. EMBO J 12, , 46674676.[Medline]
Giles, R.H., van Es, J.H., and Clevers, H. ((2003). ). Caught up in a Wnt storm: Wnt signaling in cancer. Biochim. Biophys. Acta 1653, , 124.[Medline]
Hansen, L.A., Alexander, N., Hogan, M.E., Sundberg, J.P., Dlugosz, A., Threadgill, D.W., Magnuson, T., and Yuspa, S.H. ((1997). ). Genetically null mice reveal a central role for epidermal growth factor receptor in the differentiation of the hair follicle and normal hair development. Am. J. Pathol. 150, , 19591975.[Abstract]
Helms, M.N., Fejes-Toth, G., and Naray-Fejes-Toth, A. ((2003). ). Hormone-regulated transepithelial Na+ transport in mammalian CCD cells requires SGK1 expression. Am. J. Physiol. 284, , F480F487.
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G., and Birchmeier, W. ((2001). ). beta-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 105, , 533545.[CrossRef][Medline]
Jackson, J.G., Kreisberg, J.I., Koterba, A.P., Yee, D., and Brattain, M.G. ((2000). ). Phosphorylation and nuclear exclusion of the forkhead transcription factor FKHR after epidermal growth factor treatment in human breast cancer cells. Oncogene 19, , 45744581.[CrossRef][Medline]
Kobayashi, T., and Cohen, P. ((1999). ). Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem. J. 339, , 319328.
Kobayashi, T., Deak, M., Morrice, N., and Cohen, P. ((1999). ). Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem. J. 344, , 189197.
Lang, F., and Cohen, P. ((2001). ). Regulation and physiological roles of serum- and glucocorticoid-induced protein kinase isoforms. Sci STKE 2001, , RE17.
Lang, F., Henke, G., Embark, H.M., Waldegger, S., Palmada, M., Bohmer, C., and Vallon, V. ((2003). ). Regulation of channels by the serum and glucocorticoid-inducible kinase - implications for transport, excitability and cell proliferation. Cell Physiol. Biochem. 13, , 4150.[CrossRef][Medline]
Liu, D., Yang, X., and Songyang, Z. ((2000). ). Identification of CISK, a new member of the SGK kinase family that promotes IL-3-dependent survival. Curr. Biol. 10, , 12331236.[CrossRef][Medline]
Lu, Z., Ghosh, S., Wang, Z., and Hunter, T. ((2003). ). Downregulation of caveolin-1 function by EGF leads to the loss of E-cadherin, increased transcriptional activity of beta-catenin, and enhanced tumor cell invasion. Cancer Cell 4, , 499515.[CrossRef][Medline]
Luetteke, N.C., Phillips, H.K., Qiu, T.H., Copeland, N.G., Earp, H.S., Jenkins, N.A., and Lee, D.C. ((1994). ). The mouse waved-2 phenotype results from a point mutation in the EGF receptor tyrosine kinase. Genes Dev. 8, , 399413.
Luetteke, N.C., Qiu, T.H., Peiffer, R.L., Oliver, P., Smithies, O., and Lee, D.C. ((1993). ). TGF alpha deficiency results in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell 73, , 263278.[CrossRef][Medline]
Lupu, F., Terwilliger, J.D., Lee, K., Segre, G.V., and Efstratiadis, A. ((2001). ). Roles of growth hormone and insulin-like growth factor 1 in mouse postnatal growth. Dev. Biol. 229, , 141162.[CrossRef][Medline]
Mann, G.B., Fowler, K.J., Gabriel, A., Nice, E.C., Williams, R.L., and Dunn, A.R. ((1993). ). Mice with a null mutation of the TGF alpha gene have abnormal skin architecture, wavy hair, and curly whiskers and often develop corneal inflammation. Cell 73, , 249261.[CrossRef][Medline]
Mauro, T., Guitard, M., Behne, M., Oda, Y., Crumrine, D., Komuves, L., Rassner, U., Elias, P.M., and Hummler, E. ((2002). ). The ENaC channel is required for normal epidermal differentiation. J. Investig. Dermatol. 118, , 589594.[CrossRef][Medline]
McClive, P.J., and Sinclair, A.H. ((2001). ). Rapid DNA extraction and PCR-sexing of mouse embryos. Reprod. Dev. 60, , 225226.
Muller, T., Bain, G., Wang, X., and Papkoff, J. ((2002). ). Regulation of epithelial cell migration and tumor formation by beta-catenin signaling. Exp. Cell Res. 280, , 119133.[CrossRef][Medline]
Muller-Rover, S., Handjiski, B., van der Veen, C., Eichmuller, S., Foitzik, K., McKay, I.A., Stenn, K.S., and Paus, R. ((2001). ). A. comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J. Invest Dermatol 117, , 315.[CrossRef][Medline]
Murillas, R., Larcher, F., Conti, C.J., Santos, M., Ullrich, A., and Jorcano, J.L. ((1995). ). Expression of a dominant negative mutant of epidermal growth factor receptor in the epidermis of transgenic mice elicits striking alterations in hair follicle development and skin structure. EMBO J 14, , 52165223.[Medline]
Oshima, H., Rochat, A., Kedzia, C., Kobayashi, K., and Barrandon, Y. ((2001). ). Morphogenesis and renewal of hair follicles from adult multipotent stem cells. Cell 104, , 233245.[CrossRef][Medline]
Pearce, D. ((2001). ). The role of SGK1 in hormone-regulated sodium transport. Trends Endocrinol. Metab. 12, , 341347.[CrossRef][Medline]
Peng, X.D., et al. ((2003). ). Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev. 17, , 13521365.
Rhees, B.K., and Atchley, W.R. ((2000). ). Body weight and tail length divergence in mice selected for rate of development. J. Exp. Zool. 288, , 151164.[CrossRef][Medline]
Sibilia, M., and Wagner, E.F. ((1995). ). Strain-dependent epithelial defects in mice lacking the EGF receptor. Science 269, , 234238.
Suzuki, A., et al. ((2003). ). Keratinocyte-specific PTEN deficiency results in epidermal hyperplasia, accelerated hair follicle morphogenesis and tumor formation. Cancer Res. 63, , 674681.
Threadgill, D.W., et al. ((1995). ). Targeted disruption of mouse EGF receptor: effect of genetic background on mutant phenotype. Science 269, , 230234.
Virbasius, J.V., Song, X., Pomerleau, D.P., Zhan, Y., Zhou, G.W., and Czech, M.P. ((2001). ). Activation of the Akt-related cytokine-independent survival kinase requires interaction of its phox domain with endosomal phosphatidylinositol 3-phosphate. Proc. Natl. Acad. Sci. USA 98, , 1290812913.
Wulff, P., et al. ((2002). ). Impaired renal Na(+) retention in the sgk1-knockout mouse. J. Clin. Investig. 110, , 12631268.[CrossRef][Medline]
Xu, J., Liu, D., Gill, G., and Songyang, Z. ((2001). ). Regulation of cytokine-independent survival kinase (CISK) by the Phox homology domain and phosphoinositides. J. Cell Biol. 154, , 699705.
This article has been cited by other articles:
![]() |
J. Xu, L. Liao, J. Qin, J. Xu, D. Liu, and Z. Songyang Identification of Flightless-I as a Substrate of the Cytokine-independent Survival Kinase CISK J. Biol. Chem., May 22, 2009; 284(21): 14377 - 14385. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Soukas, E. A. Kane, C. E. Carr, J. A. Melo, and G. Ruvkun Rictor/TORC2 regulates fat metabolism, feeding, growth, and life span in Caenorhabditis elegans Genes & Dev., February 15, 2009; 23(4): 496 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E Hills, P. E Squires, and R. Bland Serum and glucocorticoid regulated kinase and disturbed renal sodium transport in diabetes J. Endocrinol., December 1, 2008; 199(3): 343 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Pao, J. A. McCormick, H. Li, J. Siu, C. Govaerts, V. Bhalla, R. Soundararajan, and D. Pearce NH2 terminus of serum and glucocorticoid-regulated kinase 1 binds to phosphoinositides and is essential for isoform-specific physiological functions Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1741 - F1750. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon (Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms. Physiol Rev, October 1, 2006; 86(4): 1151 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bhalla, R. Soundararajan, A. C. Pao, H. Li, and D. Pearce Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ Am J Physiol Renal Physiol, October 1, 2006; 291(4): F714 - F721. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Grahammer, F. Artunc, D. Sandulache, R. Rexhepaj, B. Friedrich, T. Risler, J. A. McCormick, K. Dawson, J. Wang, D. Pearce, et al. Renal function of gene-targeted mice lacking both SGK1 and SGK3 Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R945 - R950. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okada, Y. Ishii, K. Masujin, A. Yasoshima, J. Matsuda, A. Ogura, H. Nakayama, T. Kunieda, and K. Doi The Critical Roles of Serum/Glucocorticoid-Regulated Kinase 3 (SGK3) in the Hair Follicle Morphogenesis and Homeostasis: The Allelic Difference Provides Novel Insights into Hair Follicle Biology Am. J. Pathol., April 1, 2006; 168(4): 1119 - 1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Staub and F. Verrey Impact of Nedd4 Proteins and Serum and Glucocorticoid-Induced Kinases on Epithelial Na+ Transport in the Distal Nephron J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3167 - 3174. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Alonso, H. Okada, H. A. Pasolli, A. Wakeham, A. I. You-Ten, T. W. Mak, and E. Fuchs Sgk3 links growth factor signaling to maintenance of progenitor cells in the hair follicle J. Cell Biol., August 15, 2005; 170(4): 559 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Strutz-Seebohm, G. Seebohm, A. F. Mack, H.-J. Wagner, L. Just, T. Skutella, U. E. Lang, G. Henke, M. Striegel, M. Hollmann, et al. Regulation of GluR1 abundance in murine hippocampal neurones by serum- and glucocorticoid-inducible kinase 3 J. Physiol., June 1, 2005; 565(2): 381 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. McCormick, V. Bhalla, A. C. Pao, and D. Pearce SGK1: A Rapid Aldosterone-Induced Regulator of Renal Sodium Reabsorption Physiology, April 1, 2005; 20(2): 134 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Di-Poi, C. Y. Ng, N. S. Tan, Z. Yang, B. A. Hemmings, B. Desvergne, L. Michalik, and W. Wahli Epithelium-Mesenchyme Interactions Control the Activity of Peroxisome Proliferator-Activated Receptor {beta}/{delta} during Hair Follicle Development Mol. Cell. Biol., March 1, 2005; 25(5): 1696 - 1712. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||