![]() |
|
|
Vol. 16, Issue 10, 4572-4583, October 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





* Section of Cell and Developmental Biology, Division of Biological Sciences and Center for Molecular Genetics, University of California, San Diego, La Jolla, CA 92093-0380;
Laboratory of Cellular and Molecular Biology, Division of Basic Sciences, NCI/National Institutes of Health, Bethesda, MD 20892-4256;
Department of Cell Biology, Scripps Research Institute, La Jolla, CA 92037; and
Ludwig Institute for Cancer Research, School of Medicine, University of California, San Diego, La Jolla, CA 92093-0660
Submitted April 25, 2005;
Revised July 8, 2005;
Accepted July 21, 2005
Monitoring Editor: Anne Ridley
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In Dictyostelium, the activation of ACA and chemotaxis are closely integrated responses, although they have been thought to be independently regulated (Comer et al., 2005
). On starvation, Dictyostelium cells initiate a developmental program that requires chemotaxis toward extracellular cAMP emitted by neighboring cells, which leads to the formation of multicellular aggregates (Parent and Devreotes, 1996
; Aubry and Firtel, 1999
; Kimmel and Parent, 2003
). The chemoattractant cAMP binds to the heterotrimeric G-protein-coupled cAMP receptor cAR1, which activates multiple intracellular signaling events that control chemotaxis, the activation of adenylyl cyclase A (ACA), and gene expression required for aggregation (Aubry and Firtel, 1999
; Kimmel and Parent, 2003
). The activation of ACA produces more cAMP, which acts both intracellularly to activate protein kinase A (PKA) and mediated downstream effectors and extracellularly to initiate chemotaxis and to relay the chemoattractant signal to distal cells (signal relay). The concerted regulation of chemotaxis and signal relay comprises a system that efficiently culminates with the development of a true, differentiated multicellular organism. In this article, we demonstrate that Dictyostelium TORC2 functions as an integrator of multiple distinct signaling pathways to control aggregation and the formation of the multicellular organism. Cells lacking any of the TORC2 proteins LST8, RIP3 (AVO1), and Pia (AVO3, mAVO3, Rictor) exhibit strong chemotaxis defects including loss of speed, cell polarity, and directionality, and are unable to fully activate Akt/PKB and the related kinase PKBR1, both of which are required for cell polarity and chemotaxis and are defective in their capacity to activate adenylyl cyclase in response to chemoattractant stimulation. Further, we demonstrate that RIP3 carrying a point mutation that abrogates Ras-GTP binding is unable to fully complement the null mutation, suggesting that Ras plays a role in mediating TORC2 function.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The chemoattractant receptor-mediated activation of adenylyl cyclase was carried out as previously described (Parent and Devreotes, 1995
). Briefly, differentiated cells were stimulated with 50 µM cAMP and filter lysed at the indicated time points into Tris buffer containing 32P-
ATP diluted with unlabeled ATP to a final concentration of
150 Ci/mol. The reaction was allowed to proceed for 1 min, stopped with SDS/ATP, and the radiolabeled cAMP was purified by column chromatography. Adenylyl cyclase assays exhibit considerable variability between experiments. Although the relative extent of activation of different cell lines or treatment conditions is highly reproducible between experiments, the absolute activity can vary significantly (23-fold at times) from day to day. Therefore we, and others in the field, have chosen to present adenylyl cyclase activation data as representative of results from at least 35 independent experiments, each performed in duplicate on a given day. Furthermore, comparisons between different cell lines or treatment conditions are made on samples assayed on the same day.
For direct G-protein stimulation of adenylyl cyclase, differentiated cells were filter lysed with GTP
S (50 µM final concentration) and, after 5 min, adenylyl cyclase activity was assayed for 2 min. To prepare cytosolic extracts for the in vitro complementation experiments, cells were suspended at 8 x 107 cells/ml in simple lysis buffer (SLB, 10 mM Tris, pH 7.5, 0.2 mM EGTA, 200 mM sucrose), filter lysed, and centrifuged at 9500 x g for 20 min. The in vitro complementation was performed in essentially the same manner as the direct GTP-
-S-stimulated adenylyl cyclase activation assay, except that cells were lysed directly into cytosolic extract.
The PKB and PKBR1 kinase activities were assayed as described previously (Meili et al., 1999
, 2000
). Briefly, unstimulated differentiated cells (0 time point) and differentiated cells stimulated with cAMP for various times were lysed with an equal volume of 2x NP-40 lysis buffer (2x phosphate-buffered saline, 100 mM NaF, 2% NP-40, 4 mM EDTA, 2 mM pyrophosphate, 2 mM Na3VO4, and protease inhibitors leupeptin and aprotinin) on ice for 10 min. The lysate was precleared by centrifugation for 10 min. To immunoprecipitate PKB or PKBR1, the anti-PKB or anti-PKBR1 antibody and 30 µl of slurry of protein A-Sepharose were added into the supernatant. The beads were washed twice with lysis buffer and twice with kinase buffer (25 mM MOPS, pH 7.4, 25 mM
-glycerophosphate, 20 mM MgCl2, and 1 mM dithiothreitol [DTT]). We incubated beads with 75 µl of kinase buffer containing 5 µM cold ATP, 10 µCi of
-32P-ATP, and 5 µg of H2B as substrate at room temperature for 15 min. The reaction was stopped by the addition of 25 µl of 5x sample buffer (250 mM Tris, 500 mM DTT, 10% SDS, 50% glycerol, and 0.5% bromophenol blue) and boiled for 2 min. Samples were separated by 12% SDS-PAGE, blotted onto a polyvinylidene difluoride (PVDF) membrane, and exposed to film. After the autoradiography, the lower part of the membrane containing the phosphorylated H2B was cut off and the upper portion with the Akt/PKB or PKBR1 was subjected to Western blot analysis to quantify the level of Akt/PKB or PKBR1 in each lane. Experiments were repeated independently at least three times, always assaying wild-type cells as a control for comparison in each experiment. The wild-type samples were run on the same gel as one of the experimental strains, and all gels and membranes were coprocessed together.
Ras activation was performed as previously described (Sasaki et al., 2004
). F-actin polymerization and myosin II assembly were assayed as described previously (Lee et al., 2004
; Park et al., 2004
). Experiments were repeated independently at least three times, always including a wild-type control for comparison.
Chemotaxis analysis was performed as described previously (Park et al., 2004
; Sasaki et al., 2004
) and analyzed using DIAS software (Wessels et al., 1998
). Differentiated cells were plated in Na+/K+ phosphate buffer at a density of 6 x 104 cells/cm2 onto a plate with a hole covered by a 0.17-mm glass coverslip. An Eppendorf Patchman micromanipulator with a glass capillary filled with 150 µM cAMP solution was brought into the field of view of an inverted microscope. The response of the cells was recorded by time-lapse video. Experiments were performed at least three times on different days, always including a wild-type control strain in the analyses.
Cell Growth in the Presence of Rapamycin
Cells growing in log phase (
34 x 106 cells/ml) were diluted to 4 x 105 cells/ml in HL5 medium. Rapamycin (Sigma Chemical Co, St. Louis, MO) was dissolved in dimethyl sulfoxide as a 1 mM stock and added to the cultures to the indicated concentration. Cell number in the suspension cultures was monitored over 4 d, with no further addition of the drug.
Translocation Assays
The chemoattractant-mediated recruitment of the CRAC PH domain (PHCRAC-GFP) to the plasma membrane was measured biochemically as previously described in response to 20 µM cAMP (Parent et al., 1998
), except that protein samples were subjected to PAGE analysis using NuPage 412% Bis-Tris protein electrophoresis gradient gels, according to the manufacturer-recommended protocol (Invitrogen, Carlsbad, CA). For microscopic observation of translocation, cells expressing PHCRAC-GFP were stimulated with 20 µM cAMP and fixed (1% formaldehyde, 0.125% glutaraldehyde, 0.01% Triton X-100 in PB) after5sof stimulation. Cells were viewed with an inverted Zeiss Axiovert S100 microscope (Thornwood, NY) equipped with automated filter wheels (Ludl Electronic Products, Hawthorne, NJ). Images were recorded with a CoolSnap HQ CCD camera (Roper Scientific, Trenton, NJ) operated by IPLab software (Scanalytics, Fairfax, VA). GFP-PhdA translocation was examined by real-time fluorescent video microscopy as described previously (Funamoto et al., 2001
).
Detection of the Dd-TOR Complex
Aggregation-competent cells were washed with Na/K phosphate buffer and resuspended at a density of 1 x 108 cells/ml in Na/K phosphate buffer containing 20 mM MOPS (pH 7.0) and 1 mM phenylmethylsulphonyl fluoride. Cells were mechanically lysed by filtration (Nuclepore Track Etch membrane, 3 µm; Whatman, Clifton, NJ). Subsequently, cell lysates were incubated in 2.5 mg/ml DSP (ditho-bis-succinimidylpropionate, Calbiochem, La Jolla, CA) for 5 min. The cross-linking reactions were quenched with 200 mM Tris-HCl (pH 7.4). A sample was mixed with an equal volume of 2x lysis buffer A (1% NP-40, 300 mM NaCl, 40 mM MOPS, pH 7.0, 20% glycerol, 2 mM Na3VO4, 2 µg/ml leupeptin, 5 µg/ml aprotinin) and centrifuged. Total cell extracts and immunoprecipitates with 25 µl resin of anti-V5 (V510) antibody agarose conjugate (Sigma) were analyzed by silver staining or immunoblotting with anti-T7 (Novagen, Madison, WI) and anti-V5 antibodies. For identifying the Dd-TOR complex, the anti-V5 antibody immunoprecipitated products were eluted with the buffer containing 4% SDS and 0.1 M glycine (pH 2.5). The protein complex was incubated with 100 mM DTT and then precipitated with methanol/chloroform.
Mass Spectrometry
The samples were washed with acetone, resuspended in Tris buffer, 8 M urea, pH 8.6, reduced with 100 mM TCEP, and alkylated with 55 mM iodoacetamide. Trypsin digest was done in the presence of 1 mM CaCl2 for tryptic specificity. Peptide mixtures were loaded onto a triphasic LC/LC column with the following steps of 500 mM ammonium acetate bumps: 25, 35, 50, 80, and 100%. Tandem mass spectra were analyzed using DTA Select and the Dictyostelium sequence database with the following filtering parameters for cross correlation scores 1.8 (+1), 2.8 (+2), and 3.5 (+3) (Washburn et al., 2001
). Identities of specific bands were confirmed by sequence analysis.
Constructs
The LST8 knockout construct was made by inserting the blasticidin resistance (Sutoh, 1993
) cassette into a BamHI site created at nucleotide 500 of the LST8 genomic DNA sequence. A 5'-fragment was amplified from genomic DNA by PCR by using the primers GTTTTTGAATTCAGTTTTGATGGTCATAAAGGTAATG and GTTTTTGGATCCGGTCAATGATGTTATACC and subsequently digested with enzymes EcoRI and BamHI. A 3' fragment was amplified by using the primers GTTTTTGGATCCTCAAGTGATGGTGGTTTAG and GTTTTTCTCGAGTTTTTATCTTGGTAAATCATTTAAAGCAAC subsequently digested with BamHI and XhoI. The vector was digested with EcoRI and XhoI and the DNA was transformed into Dictyostelium cells. The knockout clones were confirmed by Southern and Northern blot analysis. Two independent clones were picked and examined. Both showed the same chemotaxis defects described in the results.
A T7-tagged full length LST8 ORF (open reading frame) clone was amplified from genomic DNA by PCR using primers 5'-GTTTTTGAATTCAAAAAAATGGCTTCAATGACTGGTGGTCAACAAATGGGTCCAGGTATTATATTGGCAACAGCATC and GTTTTTCTCGAGTTTTTATCTTGGTAAATCATTTAAAGCAAC-3' subsequently digested with EcoRI and XhoI and subcloned to expression vector Exp4(+).
A 3' V5-tagged, full-length Pia clone was amplified from genomic DNA by PCR using primers GTTTTTGATATCAAAAAAATGACAAGTTCTGATAGTAGTG and GTTTTTCTCGAGTTTTTAAGTTGAATCTAAACCTAATAATGGATTTGGAATTGGTTTACCATTTAAATCATGATATGGATCAGATG and subsequently digested by EcoRV and XhoI and subcloned into the expression vector Exp4(+).
A5' T7-tagged clone of RIP3 from ATG to internal BamHI site at nucleotide 1490 was amplified by PCR from the full-length RIP3 (Lee et al., 1999
) by using primers GTTTTTGAATTCAAAAAAATGGCTTCAATGACTGGTGGTCAACAAATGGGTTCAGTTTATTGTGAATTAGTTGATG and ATTTGGACAAAGTACCAATACTTC. The full length of 5' T7-tagged RIP3 clone was obtained by digesting the PCR product with EcoRI and BamHI and the full-length RIP3 with BamHI and XhoI and the fragments cloned into the expression vector Exp4(+).
All constructs were sequenced.
|
| RESULTS |
|---|
|
|
|---|
When plated for development on nonnutrient agar in the absence of exogenous pulses of cAMP, we found that, similar to rip3 and pia cells, lst8 cells do not spontaneously aggregate, but remain as a smooth monolayer of cells (Figure 2A; Chen et al., 1997
; Lee et al., 1999
). When provided with exogenous pulses of cAMP, which mimic the endogenous cAMP signaling of wild-type cells, and then plated for development, lst8 and pia cells still do not develop. In contrast, rip3 cells form mounds, although very inefficiently (Figure 2A; Lee et al., 1999
), suggesting that the rip3 defect can be partially overridden, a phenotype that is also shared with the Ras GEF (guanine nucleotide exchange factor) Aimless (Insall et al., 1996
; Lee et al., 1999
). Defects in the ability to aggregate can result in an inability to induce the genes required for this process.
|
To assess whether LST8, Pia, or RIP3 regulates the expression of early genes required for development, we performed an RNA blot analysis examining the expression of the cAMP receptor cAR1 and csA (gp80), a cell adhesion molecule, both of which are required for aggregation. We find that cAR1 and csA transcripts are normally induced in response to exogenous cAMP in lst8, pia, and rip3 cells (Figure 2B). These data suggest that the developmental defects of lst8 cells, like rip3 and pia cells, may arise from deficiencies in chemotaxis and/or chemoattractant signal relay.
Dictyostelium TORC2 Exists in a Preformed Complex That Regulates Adenylyl Cyclase Activation
To investigate the underlying developmental defect of lst8 cells, we measured their capacity to activate ACA in response to chemoattractant stimulation. In this activation trap assay (Parent and Devreotes, 1995
; Lee et al., 1999
), chemoattractant receptor-mediated ACA activation is measured by stimulating cells with a saturating dose of cAMP, rapidly lysing aliquots at specific time points, and determining the amount of new cAMP synthesis. Wild-type cells display a rapid rise in enzyme activity, peaking
1 min after addition of chemoattractant, followed by a return to basal levels within 710 min. A representative experiment (see Materials and Methods) is shown in Figure 3A. Cells lacking LST8 are defective in this response, showing dramatically reduced ACA activation (Figure 3A). Parallel experiments on rip3 and pia cells reveal a similar loss of receptor-stimulated ACA activity, consistent with previous findings (Figure 4A; Chen et al., 1997
; Lee et al., 1999
). We also found a similar defect in ACA activation in response to GTP-
-S, which directly and constitutively activates G proteins downstream of chemoattractant receptors (Figure 3B). From these results, we conclude that LST8 must act downstream of G protein activation and that the developmental defect of lst8 cells is at least partially due to defective chemoattractant signal relay through ACA.
|
|
To gain more insight into the mechanisms by which components of TORC2 regulate ACA activity, we performed a series of in vitro reconstitution experiments. Previous work indicated that, in addition to receptor linked heterotrimeric G proteins, chemoattractant-mediated activation of ACA requires multiple cytosolic factors, including CRAC (cytosolic regulator of adenylyl cyclase), Pia, and RIP3 (Insall et al., 1994
; Chen et al., 1997
; Lee et al., 1999
). One can achieve in vitro complementation of CRAC null (crac) cells, thus restoring GTP
S-stimulated ACA activity, by combining a crac cell lysate with cytosol derived from wild-type cells (Lilly and Devreotes, 1995
). We have utilized this approach to further examine the activation of adenylyl cyclase in rip3, pia, and lst8 cells. We hypothesized that if these components exist in a stable, preformed complex, one may be able to reconstitute GTP
S-stimulated ACA activity with wild-type cytosol, but may not be able to cross-complement between different mutant strains. As depicted in Figure 3B, addition of wild-type cytosol to lysates from any of the putative TORC2 mutant or crac cell lines results in strong reconstitution of GTP
S-stimulated ACA activity. Likewise, we found significant reconstitution of crac cell lysates with cytosolic fractions from any of the TORC2-deficient cell lines, although the rescue is more modest with cytosol from rip3 cells than with cytosol from pia or lst8 cells. In contrast, addition of cytosol from any of the TORC2 mutants to lysates from any of the other TORC2 mutants reconstitutes little or no GTP
S-stimulated ACA activity. These data support the hypothesis that RIP3, LST8, and Pia all function together in a preformed complex to promote ACA activation. Furthermore, our observations suggest that these preformed TORC2 complexes either cannot exchange components rapidly or are unstable in the absence of all of the subunits.
Dictyostelium TORC2 Components Form a Complex
Our data suggest that RIP3, Pia, and LST8 regulate common biochemical pathways. To examine whether these proteins are found in a complex, we coexpressed two different pair-wise combinations of RIP3, LST8, and Pia harboring different epitope tags in wild-type cells and performed coimmunoprecipation experiments. Figure 4, A and B, show that T7-tagged RIP3 coimmunoprecipitates with V5-tagged Pia (V5-Pia) and that T7-tagged LST8 (T7-LST8) immunoprecipitates with V5-Pia, suggesting that they can form a TORC2-like complex in vivo.
To further characterize the components of such complexes, we used anti-V5 antibody cross-linked to Sepharose beads to purify Pia and associated proteins from cytosolic extracts of Dictyostelium. This purified sample was subjected to mass spectrometric (MS) analysis. Cytosolic extracts from untransformed cells were used as a control. The MS analysis showed that LST8 and TOR associate with V5-Pia (Figure 3C). 14-3-3, and heat shock proteins were preferentially found in the experimental but not the control sample. Although Dictyostelium encodes a Raptor/KOG1 ortholog (GenBank accession no. DDB0191024), it is not present in these immunoprecipitates, suggesting that Dictyostelium forms a separate TORC1. Interestingly, we did not observe RIP3 in the complex, although it coimmunoprecipitates with Pia. These differences between the coimmunopreciptation data and the MS analysis could be due to instability of the complex and differential loss of some components during the purification and/or differences in the efficiency of peptide ionization in the MS, leading to different efficiencies of peptide recovery in the analysis, although this is unlikely given the dynamic range and sensitivity of the MS. Nevertheless, these findings indicate that, similar to the yeast and mammalian counterparts, Dictyostelium LST8, RIP3, and Pia form one or more TORC2 complexes (Loewith et al., 2002
; Jacinto et al., 2004
). We did not identify any orthologues to yeast AVO2 and no clear ortholog is found in the Dictyostelium genome database.
Dictyostelium TORC2 Regulates Cell Movement during Chemotaxis
An aggregation-deficient developmental phenotype can arise from defects in either ACA activation or chemotaxis, which are functionally independent (Comer et al., 2005
). Previous studies suggested that pia cells exhibit chemotaxis defects (Chen et al., 1997
) and demonstrated that rip3 cells have reduced cell polarity and a lower chemotaxis index (Lee et al., 1999
). To assess the ability of the lst8 cells to chemotax, we examined their chemotaxis toward a micropipette filled with cAMP. We quantified their behavior using DIAS computer software (Wessels et al., 1988
, 1998
) and compared this strain to wild-type cells and pia and rip3 cells, whose chemotaxis parameters had not been previously measured. We found that, although the lst8 cells can migrate toward the micropipette, they do so with reduced speed and directionality and with significant loss in polarity compared with wild-type cells (Figure 5, A and B; Table 1). rip3 cells showed similar defects, consistent with previous findings (Lee et al., 1999
). The chemotaxis defects of pia cells were not as strong as those for lst8 and rip3 cells. To further characterize the chemotaxis defects of rip3, pia, and lst8 cells, we analyzed the mutants using the under-agarose assay (Laevsky and Knecht, 2001
; Comer et al., 2005
), in which cells migrate under a layer of agarose in a gradient of chemoattractant. Under these conditions, the lst8 cells, as well as the rip3 and pia cells, do not migrate as far toward the cAMP source as wild-type cells and, most notably, do not organize into streams, a process that requires ACA activation (Kriebel et al., 2003
; unpublished data). These data are consistent with the notion that LST8, RIP3, and Pia function together in a complex that regulates both ACA activation/signal relay and chemotaxis.
|
|
Proper chemotaxis requires the concerted regulation of anterior F-actin extension and posterior myosin II contraction (Ridley et al., 2003
). We therefore examined whether deficiencies in LST8, RIP3, or Pia result in defective chemoattractant-mediated F-actin polymerization or myosin II assembly. The lst8 cells exhibit a nominal but reproducible reduction in the extent of chemoattractant-stimulated F-actin polymerization in both the first (
5-s) and second (
45-s) peaks of activation, which correlate with the initial cringe response and the subsequent pseudopod extension, respectively, observed after uniform chemoattractant stimulation (Hall et al., 1988
; Figure 5C). The rip3 and pia cells experience a similar modest decrease in the first peak, but the level of the second F-actin peak is indistinguishable from that of wild-type cells. We do not think that any change in the first F-actin peak that is observed is at all responsible for the null polarity and chemotaxis defects. All three mutant strains exhibit moderately altered patterns of chemoattractant-mediated myosin II assembly. In wild-type cells, the levels of myosin II associated with the cytoskeleton undergo an initial slight decrease 510 s after uniform chemoattractant stimulation and then increase about twofold, peaking at
30 s, before decreasing to basal levels (Steimle et al., 2001
; Park et al., 2004
). The rip3 cells exhibit the strongest phenotype, with a significantly reduced peak of myosin II assembly upon chemoattractant stimulation (Figure 5C). The essentially wild-type F-actin response and moderate defects in myosin II assembly suggest that these cells do not have a fundamental inability to undergo cytoskeletal changes in response to chemoattractant. However, all three null strains simultaneously extend random pseudopodia from multiple points around the entire periphery of the cell, in contrast to wild-type cells, which predominantly extend pseudopodia in the direction of the chemoattractant gradient. The poor directionality of chemotaxing of the rip3, pia, and lst8 cells supports the hypothesis that at least part of the loss of directionality results from more random movement inherent in cells that form multiple lateral pseudopodia. Our data, however, do not exclude the possibility that these cells show a defect in gradient interpretation or spatial-temporal signaling to the cytoskeleton. This possibility is strongest for lst8 cells as some of these cells exhibit directionality defects that are stronger than those exhibited by the other strains and for other apolar mutants such as myoII or pakB/pakC/ cells (Wessels et al., 1988
; Lee et al., 2004
).
|
Dictyostelium TORC2 Acts Downstream of Ras and PI3K
Numerous studies have shown that PI3 kinases (PI3Ks) play multiple roles in chemoattractant signaling in Dictyostelium and mammalian leukocytes (Funamoto et al., 2001
; Stephens et al., 2002
; Merlot and Firtel, 2003
; Van Haastert and Devreotes, 2004
). Cells lacking PI3K function exhibit chemotaxis defects similar to those of the rip3, pia, and lst8 cells (Funamoto et al., 2001
, 2002
; Sasaki et al., 2004
). In Dictyostelium, PI3K1 and PI3K2 translocate from the cytosol to the leading edge membrane during chemotaxis and removal of the membrane-targeting domain impairs chemoattractant signaling through PI3K (Funamoto et al., 2002
). Ras-mediated activation of PI3K is thought to preferentially promote localized activation of the chemotactic machinery, thus sharply amplifying chemoattractant signaling at the leading edge of chemotaxing cells (Sasaki et al., 2004
). To gain insight into the mechanism by which TORC2 regulates chemotaxis and signal relay, we studied the impact of TORC2 on PI3K signaling pathways. We first assessed the extent of chemoattractant-stimulated Ras activation in the TORC2 mutants using a pulldown assay in which GTP-bound Ras is isolated through its binding to the RBD of human Raf1 and then quantified using a Western blot assay (Sasaki et al., 2004
). This assay examines the activation of RasG, RasD, and RasB with the majority of the Ras-GTP bound to the Raf1-RBD in aggregation-competent cells attributed to RasG (Sasaki et al., 2004
). As depicted in Figure 7A, all strains exhibited kinetics and extent of Ras activation similar to those of wild-type cells. We next assessed the role of the TORC2 components RIP3, Pia, and LST8 in the cellular distribution of PI3K. We transformed wild-type, rip3, pia, and lst8 cells with GFP-N-PI3K1, which is necessary and sufficient for PI3K1 cortical localization, and studied its distribution in chemotaxing cells. As previously reported, we observed that the majority of the cortically localized GFP-N-PI3K1 is found at the leading edge of wild-type chemotaxing cells. Because of improved imaging technology, we now also find that a smaller fraction of GFP-N-PI3K1 localizes at the cell posterior (Figure 8). Both localizations are sites of enriched F-actin polymerization, consistent with our demonstration that enhanced GFP-N-PI3K cortical localization is dependent on new F-actin (Sasaki et al., 2004
). As expected, wild-type cells have a ruffled leading edge with numerous protrusions. In contrast, rip3, pia, and lst8 cells have broader GFP-N-PI3K1-containing domains with multiple lateral pseudopodia and broader posteriors, illustrating their loss-of-polarity phenotype (Figures 5, A and B, and 8; data for pia cells are not published). Nevertheless, we find that GFP-N-PI3K1 is targeted to the cortex in the mutants. Furthermore, we observed that the mutant cell lines have normal kinetics of GFP-N-PI3K1 translocation to the cortex in response to uniform chemoattractant stimulation (unpublished data). These data demonstrate that the TORC2 components are not required for Ras activation or for the spatial targeting of PI3K.
|
|
To gain further insight into the impact of TORC2 on PI3K signaling pathways, we examined activation of the PI3K-regulated effector PKB in rip3, pia, and lst8 cells by directly measuring the chemoattractant-mediated activation of PKB. Surprisingly, we found that in rip3 and pia cells exhibit a significant impairment in PKB activation compared with wild-type cells (Figure 7D). PKB activation was less impaired in lst8 cells, although the activation was still reproducibly lower than that of wild-type cells (Figure 7D). Combined with our observation that CRAC and PhdA translocation/PI3K activation is not impaired in the TORC2 mutants, these data are consistent with a model in which TORC2 acts either downstream or parallel to PI3K in the chemoattractant-mediated activation of PKB.
Dictyostelium cells express two distinct PKB-related kinases, PKB (the ortholog of mammalian PKB) and PKBR1. PKBR1 is required for morphogenesis during the multicellular stages of Dictyostelium development (Meili et al., 2000
). It harbors highly conserved kinase and C-terminal hydrophobic domains that include conserved sites of phosphorylation equivalent to T308 and S473 in human PKB. However, in contrast to PKB, PKBR1 lacks a true PH domain (it has an N-terminal, PH-like domain) and localizes constitutively to the plasma membrane via an N-terminal myristoylation modification. PKBR1 is activated by chemoattractants in a PI3K-independent manner, presumably because PKBR1 is constitutively associated with the plasma membrane and does not require de novo PtdIns(3,4,5)P3 synthesis for its membrane localization. pkbr1 cells exhibit very weak chemotaxis phenotypes but a double PKB/PKBR1 null strain has strong growth and chemotaxis defects, indicating that both kinases control chemotaxis pathways. These phenotypes are more severe than those of rip3, pia, and lst8 cells and significantly more severe than those of pkb cells. We therefore examined the extent of chemoattractant-induced PKBR1 phosphorylation in rip3, pia, and lst8 cells. Remarkably, as with PKB, PKBR1 phosphorylation is impaired in rip3 and pia cells and less affected in lst8 cells (Figure 6E), further indicating that the defect in PKB phosphorylation is not a result of improper targeting to the plasma membrane or defects in PI3K activation. Rather, these results are consistent with the Dictyostelium TORC2 regulating the phosphorylation of PKB and PKBR1. Although the effects on cell movement are strongest in lst8 cells, these cells exhibit the weakest effect on PKB and PKBR1 activation. These observations suggest that different components of the TORC2 complex have different effects on TOR activity in different pathway. Our data do not exclude the possibility of multiple TORC2 complexes with different or overlapping functions or activities.
| DISCUSSION |
|---|
|
|
|---|
Our attempts to purify Dictyostelium TORC2 suggest that the complex is not very stable, and we obtained the best coimmunoprecipitation results using chemical cross-linking. Our biochemical findings, combined with the common phenotypes of rip3, pia, and lst8 cells, provide strong indications of a Dictyostelium TORC2 that minimally contains TOR, LST8, RIP3, and Pia. Intriguingly, our MS analyses revealed that 14-3-3 and several heat-shock proteins are associated with Pia, the latter of which we assume function as molecular chaperones, possibly to help form or stabilize TORC2. 14-3-3 may further stabilize the complex or TOR by bridging phosphoserine residues.
TORC2 Integrates Signaling Pathways Regulating Aggregation
Previous studies and those presented here show that rip3, pia, and lst8 null strains all share common phenotypes: the inability to activate adenylyl cyclase in response to chemoattractant signaling; and a severe loss of cell polarization, directionality in movement, and chemotaxis speed (Chen et al., 1997
; Lee et al., 1999
). Using reconstitution of these null cell lines, we provide strong evidence that Pia, RIP3, and LST8 function together in a preformed complex to regulate ACA. The mechanism by which this occurs remains to be determined. Our reconstitution experiments demonstrate that TORC2 is formed in the absence of CRAC, a PI3K effector required for the activation of adenylyl cyclase. It was previously established that ACA activity can be reconstituted in lysates derived from cells lacking both Pia and CRAC only when both proteins are added back (Chen et al., 1997
), suggesting that ACA activation requires an input from both TORC2 and CRAC.
We also demonstrate that rip3, pia, and lst8 cells exhibit a reduction in chemoattractant-mediated activation of Akt/PKB and PKBR1, a PKB-related kinase that is also activated by phosphorylation of a conserved site in the activation loop and C-terminal hydrophobic residues corresponding to T308 and S473, respectively, in human PKB (Alessi et al., 1996
, 1997
; Williams et al., 2000
). It was recently shown that TORC2 directly phosphorylates PKB on S473 in Drosophila Kc167 cells as well as in a variety of human cell lines (Sarbassov et al., 2005
). Our data strongly suggest that TORC2 acts in a similar manner in Dictyostelium, in which the reduced chemoattractant-mediated phosphorylation of PKB and PKBR1 could due to the specific loss of phosphorylation in the C-terminal domain. Consistent with this model, we find that although Akt/PKB activation in Dictyostelium is PI3K-dependent (Meili et al., 1999
), as it is in mammalian cells, the PI3K pathway and the activation of Ras, which lies upstream of PI3K, is not detectably affected in lst8, pia, and rip3 cells. A complete loss of both Akt/PKB and PKBR1 in Dictyostelium results in chemotaxis phenotypes significantly more severe than those of rip3, pia, and lst8 cells (Meili et al., 1999
, 2000
). It is currently difficult to determine if the observed partial loss of PKB and PKBR1 phosphorylation is responsible for the chemotaxis and polarity defects of the rip3, pia, and lst8 cells, as we expect the TORC2 pathway to control other chemoattractant signals. Furthermore, we do not know whether TORC2 activity is constitutive or stimulated in response to chemoattractant. Although we expect the latter, presently we have no way of directly assaying this.
A commonality of the yeast, mammalian cell, and Dictyostelium TORC2 pathways is a loss of cell polarity (Schmidt et al., 1996
; Chen et al., 1997
; Lee et al., 1999
; Jacinto et al., 2004
; Sarbassov dos et al., 2004
). Dictyostelium TORC2 mutants produce multiple pseudopodia simultaneously along the cell's cortex when placed in a chemoattractant gradient. We find that lst8, rip3, and pia cells have reduced chemoattractant-mediated F-actin polymerization and myosin II assembly, with the strongest defect in myosin II assembly observed in rip3 cells. The reduced myosin II assembly may be due to the reduction in Akt/PKB activity, which is required for maximal myosin II assembly in Dictyostelium (Chung et al., 2001
). In yeast and mammalian cells, TORC2 functions, at least in part, by controlling protein kinase C and/or Rho GEF activity, although a direct link between these signaling pathways, TORC2, and polarity has yet to be established (Schmidt et al., 1997
; Jacinto and Hall, 2003
; Jacinto et al., 2004
; Lorberg and Hall, 2004
). In Dictyostelium, loss of cell polarity during chemotaxis is at least partially due to reduced Akt/PKB and PKBR1 activation.
|
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Address correspondence to: Richard A. Firtel (rafirtel{at}ucsd.edu).
| REFERENCES |
|---|
|
|
|---|
Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. ((1997). ). Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr. Biol. 7, , 261269.[CrossRef][Medline]
Aubry, L., and Firtel, R. ((1999). ). Integration of signaling networks that regulate Dictyostelium differentiation. Annu. Rev. Cell Dev. Biol. 15, , 469517.[CrossRef][Medline]
Chen, M. Y., Long, Y., and Devreotes, P. N. ((1997). ). A novel cytosolic regulator, pianissimo, is required for chemoattractant receptor and G protein-mediated activation of the 12 transmembrane domain adenylyl cyclase in Dictyostelium. Genes Dev. 11, , 32183231.
Chung, C. Y., Potikyan, G., and Firtel, R. A. ((2001). ). Control of cell polarity and chemotaxis by Akt/PKB and PI3 kinase through the regulation of PAKa. Mol. Cell 7, , 937947.[CrossRef][Medline]
Comer, F. I., Lippincott, C. K., Masbad, J. J., and Parent, C. A. ((2005). ). The PI3K-mediated activation of CRAC independently regulates adenylyl cyclase activation and chemotaxis. Curr. Biol. 15, , 134139.[CrossRef][Medline]
Funamoto, S., Meili, R., Lee, S., Parry, L., and Firtel, R. A. ((2002). ). Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell 109, , 611623.[CrossRef][Medline]
Funamoto, S., Milan, K., Meili, R., and Firtel, R. A. ((2001). ). Role of phosphatidylinositol 3' kinase and a downstream pleckstrin homology domain-containing protein in controlling chemotaxis in Dictyostelium. J. Cell Biol. 153, , 795809.
Hall, A. L., Schlein, A., and Condeelis, J. ((1988). ). Relationship of pseudopod extension to chemotactic hormone-induced actin polymerization in amoeboid cells. J. Cell. Biochem. 37, , 285299.[CrossRef][Medline]
Hay, N., and Sonenberg, N. ((2004). ). Upstream and downstream of mTOR. Genes Dev. 18, , 19261945.
Insall, R., Kuspa, A., Lilly, P. J., Shaulsky, G., Levin, L. R., Loomis, W. F., and Devreotes, P. ((1994). ). CRAC, a cytosolic protein containing a pleckstrin homology domain, is required for receptor and G protein-mediated activation of adenylyl cyclase in Dictyostelium. J. Cell Biol. 126, , 15371545.
Insall, R. H., Borleis, J., and Devreotes, P. N. ((1996). ). The aimless RasGEF is required for processing of chemotactic signals through G-protein-coupled receptors in Dictyostelium. Curr. Biol. 6, , 719729.[CrossRef][Medline]
Jacinto, E., and Hall, M. N. ((2003). ). Tor signalling in bugs, brain and brawn. Nat. Rev. Mol. Cell. Biol. 4, , 117126.[CrossRef][Medline]
Jacinto, E., Loewith, R., Schmidt, A., Lin, S., Ruegg, M. A., Hall, A., and Hall, M. N. ((2004). ). Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat. Cell Biol. 6, , 11221128.[CrossRef][Medline]
Kimmel, A. R., and Parent, C. A. (2003). Dictyostelium discoideum cAMP chemotaxis pathway. In: http://stke.sciencemag.org/cgi/cm/CMP_7918.
Kriebel, P. W., Barr, V. A., and Parent, C. A. ((2003). ). Adenylyl cyclase localization regulates streaming during chemotaxis. Cell 112, , 549560.[CrossRef][Medline]
Laevsky, G., and Knecht, D. A. ((2001). ). Under-agarose folate chemotaxis of Dictyostelium discoideum amoebae in permissive and mechanically inhibited conditions. Biotechniques 31, , 11401149.[Medline]
Lee, S., Parent, C. A., Insall, R., and Firtel, R. A. ((1999). ). A novel Ras-interacting protein required for chemotaxis and cyclic adenosine monophosphate signal relay in Dictyostelium. Mol. Biol. Cell 10, , 28292845.
Lee, S., Rivero, F., Park, K. C., Huang, E., Funamoto, S., and Firtel, R. A. ((2004). ). Dictyostelium PAKc is required for proper chemotaxis. Mol. Biol. Cell 15, , 54565469.
Lilly, P. J., and Devreotes, P. N. ((1995). ). Chemoattractant and GTP gamma S-mediated stimulation of adenylyl cyclase in Dictyostelium requires translocation of CRAC to membranes. J. Cell Biol. 129, , 16591665.
Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J. L., Bonenfant, D., Oppliger, W., Jenoe, P., and Hall, M. N. ((2002). ). Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol. Cell 10, , 457468.[CrossRef][Medline]
Lorberg, A., and Hall, M. N. ((2004). ). TOR: the first 10 years. Curr. Top. Microbiol. Immunol. 279, , 118.[Medline]
Meili, R., Ellsworth, C., and Firtel, R. A. ((2000). ). A novel Akt/PKB-related kinase is essential for morphogenesis in Dictyostelium. Curr. Biol. 10, , 708717.[CrossRef][Medline]
Meili, R., Ellsworth, C., Lee, S., Reddy, T., Ma, H., and Firtel, R. ((1999). ). Chemoattractant-mediated transient activation and membrane localization of Akt/PKB is required for efficient chemotaxis to cAMP in Dictyostelium. EMBO J. 18, , 20922105.[CrossRef][Medline]
Merlot, S., and Firtel, R. A. ((2003). ). Leading the way: directional sensing through phosphatidylinositol 3-kinase and other signaling pathways. J. Cell Sci. 116, , 34713478.
Parent, C., Blacklock, B., Froehlich, W., Murphy, D., and Devreotes, P. ((1998). ). G protein signaling events are activated at the leading edge of chemotactic cells. Cell 95, , 8191.[CrossRef][Medline]
Parent, C. A., and Devreotes, P. N. ((1995). ). Isolation of inactive and G protein-resistant adenylyl cyclase mutants using random mutagenesis. J. Biol. Chem. 270, , 2269322696.
Parent, C. A., and Devreotes, P. N. ((1996). ). Molecular genetics of signal transduction in Dictyostelium. Annu. Rev. Biochem. 65, , 411440.[CrossRef][Medline]
Park, K. C., Rivero, F., Meili, R., Lee, S., Apone, F., and Firtel, R. A. ((2004). ). Rac regulation of chemotaxis and morphogenesis in Dictyostelium. EMBO J. 23, , 41774189.[CrossRef][Medline]
Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., Parsons, J. T., and Horwitz, A. R. ((2003). ). Cell migration: integrating signals from front to back. Science 302, , 17041709.
Sarbassov, D. D., Guertin, D. A., Ali, S. M., and Sabatini, D. M. ((2005). ). Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, , 10981101.
Sarbassov dos, D., Ali, S. M., Kim, D. H., Guertin, D. A., Latek, R. R., Erdjument-Bromage, H., Tempst, P., and Sabatini, D. M. ((2004). ). Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr. Biol. 14, , 12961302.[CrossRef][Medline]
Sasaki, A. T., Chun, C., Takeda, K., and Firtel, R. A. ((2004). ). Localized Ras signaling at the leading edge regulates PI3K, cell polarity, and directional cell movement. J. Cell Biol. 167, , 505518.
Schmidt, A., Bickle, M., Beck, T., and Hall, M. N. ((1997). ). The yeast phosphatidylinositol kinase homolog TOR2 activates RHO1 and RHO2 via the exchange factor ROM2. Cell 88, , 531542.[CrossRef][Medline]
Schmidt, A., Kunz, J., and Hall, M. N. ((1996). ). TOR2 is required for organization of the actin cytoskeleton in yeast. Proc. Natl. Acad. Sci. USA 93, , 1378013785.
Steimle, P. A., Yumura, S., Cote, G. P., Medley, Q. G., Polyakov, M. V., Leppert, B., and Egelhoff, T. T. ((2001). ). Recruitment of a myosin heavy chain kinase to actin-rich protrusions in Dictyostelium. Curr. Biol. 11, , 708713.[CrossRef][Medline]
Stephens, L., Ellson, C., and Hawkins, P. ((2002). ). Roles of PI3Ks in leukocyte chemotaxis and phagocytosis. Curr. Opin. Cell Biol. 14, , 203213.[CrossRef][Medline]
Sutoh, K. ((1993). ). A transformation vector for Dictyostelium discoideum with a new selectable marker bsr. Plasmid 30, , 150154.[CrossRef][Medline]
Tuxworth, R. I., Cheetham, J. L., Machesky, L. M., Spiegelmann, G. B., Weeks, G., and Insall, R. H. ((1997). ). Dictyostelium RasG is required for normal motility and cytokinesis, but not growth. J. Cell Biol. 138, , 605614.
Van Haastert, P. J., and Devreotes, P. N. ((2004). ). Chemotaxis: signalling the way forward. Nat. Rev. Mol. Cell. Biol. 5, , 626634.[CrossRef][Medline]
Washburn, M. P., Wolters, D., and Yates, J. R., III ((2001). ). Large-scale analysis of the yeast proteome by multidimensional protein identification technology. Nat. Biotechnol. 19, , 242247.[CrossRef][Medline]
Weiner, O. D., Neilsen, P. O., Prestwich, G. D., Kirschner, M. W., Cantley, L. C., and Bourne, H. R. ((2002). ). A PtdInsP(3)- and Rho GTPase-mediated positive feedback loop regulates neutrophil polarity. Nat. Cell Biol. 4, , 509513.[CrossRef][Medline]
Wessels, D., Soll, D. R., Knecht, D., Loomis, W. F., De Lozanne, A., and Spudich, J. ((1988). ). Cell motility and chemotaxis in Dictyostelium amebae lacking myosin heavy chain. Dev. Biol. 128, , 164177.[CrossRef][Medline]
Wessels, D., Voss, E., Von Bergen, N., Burns, R., Stites, J., and Soll, D. R. ((1998). ). A computer-assisted system for reconstructing and interpreting the dynamic three-dimensional relationships of the outer surface, nucleus and pseudopods of crawling cells. Cell Motil. Cytoskelet. 41, , 225246.[CrossRef][Medline]
Williams, M. R., Arthur, J. S., Balendran, A., van der Kaay, J., Poli, V., Cohen, P., and Alessi, D. R. ((2000). ). The role of 3-phosphoinositide-dependent protein kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr. Biol. 10, , 439448.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C. J P Alvarez, M. Lodeiro, M. Theodoropoulou, J. P Camina, F. F Casanueva, and Y. Pazos Obestatin stimulates Akt signalling in gastric cancer cells through {beta}-arrestin-mediated epidermal growth factor receptor transactivation Endocr. Relat. Cancer, June 1, 2009; 16(2): 599 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kawabe, T. Morio, J. L. James, A. R. Prescott, Y. Tanaka, and P. Schaap Activated cAMP receptors switch encystation into sporulation PNAS, April 28, 2009; 106(17): 7089 - 7094. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Berchtold and T. C. Walther TORC2 Plasma Membrane Localization Is Essential for Cell Viability and Restricted to a Distinct Domain Mol. Biol. Cell, March 1, 2009; 20(5): 1565 - 1575. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Berkowitz, R. Jost, S. Pollmann, and J. Masle Characterization of TCTP, the Translationally Controlled Tumor Protein, from Arabidopsis thaliana PLANT CELL, December 1, 2008; 20(12): 3430 - 3447. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bosgraaf, I. Keizer-Gunnink, and P. J. M. Van Haastert PI3-kinase signaling contributes to orientation in shallow gradients and enhances speed in steep chemoattractant gradients J. Cell Sci., November 1, 2008; 121(21): 3589 - 3597. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Veeranki, B. Kim, and L. Kim The GPI-anchored superoxide dismutase SodC is essential for regulating basal Ras activity and for chemotaxis of Dictyostelium discoideum J. Cell Sci., September 15, 2008; 121(18): 3099 - 3108. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ghosh, G. P. Srivastava, D. Xu, L. C. Schulz, and R. M. Roberts A link between SIN1 (MAPKAP1) and poly(rC) binding protein 2 (PCBP2) in counteracting environmental stress PNAS, August 19, 2008; 105(33): 11673 - 11678. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bolourani, G. B. Spiegelman, and G. Weeks Rap1 Activation in Response to cAMP Occurs Downstream of Ras Activation during Dictyostelium Aggregation J. Biol. Chem., April 18, 2008; 283(16): 10232 - 10240. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kolsch, P. G. Charest, and R. A. Firtel The regulation of cell motility and chemotaxis by phospholipid signaling J. Cell Sci., March 1, 2008; 121(5): 551 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Veltman, I. Keizer-Gunnik, and P. J.M. Van Haastert Four key signaling pathways mediating chemotaxis in Dictyostelium discoideum J. Cell Biol., February 25, 2008; 180(4): 747 - 753. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hernandez-Negrete, J. Carretero-Ortega, H. Rosenfeldt, R. Hernandez-Garcia, J. V. Calderon-Salinas, G. Reyes-Cruz, J. S. Gutkind, and J. Vazquez-Prado P-Rex1 Links Mammalian Target of Rapamycin Signaling to Rac Activation and Cell Migration J. Biol. Chem., August 10, 2007; 282(32): 23708 - 23715. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Sasaki, C. Janetopoulos, S. Lee, P. G. Charest, K. Takeda, L. W. Sundheimer, R. Meili, P. N. Devreotes, and R. A. Firtel G protein-independent Ras/PI3K/F-actin circuit regulates basic cell motility J. Cell Biol., July 10, 2007; 178(2): 185 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Qiao, J. D. Iglehart, and A. B. Pardee Metastatic Potential of 21T Human Breast Cancer Cells Depends on Akt/Protein Kinase B Activation Cancer Res., June 1, 2007; 67(11): 5293 - 5299. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takeda, A. T. Sasaki, H. Ha, H.-A Seung, and R. A. Firtel Role of Phosphatidylinositol 3-Kinases in Chemotaxis in Dictyostelium J. Biol. Chem., April 20, 2007; 282(16): 11874 - 11884. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Mahadeo, M. Janka-Junttila, R. L. Smoot, P. Roselova, and C. A. Parent A Chemoattractant-mediated Gi-coupled Pathway Activates Adenylyl Cyclase in Human Neutrophils Mol. Biol. Cell, February 1, 2007; 18(2): 512 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yang, K. Inoki, T. Ikenoue, and K.-L. Guan Identification of Sin1 as an essential TORC2 component required for complex formation and kinase activity. Genes & Dev., October 15, 2006; 20(20): 2820 - 2832. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Loovers, M. Postma, I. Keizer-Gunnink, Y. E. Huang, P. N. Devreotes, and P. J.M. van Haastert Distinct Roles of PI(3,4,5)P3 during Chemoattractant Signaling in Dictyostelium: A Quantitative In Vivo Analysis by Inhibition of PI3-Kinase Mol. Biol. Cell, April 1, 2006; 17(4): 1503 - 1513. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. I. Comer and C. A. Parent Phosphoinositide 3-Kinase Activity Controls the Chemoattractant-mediated Activation and Adaptation of Adenylyl Cyclase Mol. Biol. Cell, January 1, 2006; 17(1): 357 - 366. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||