|
|
|
|
Vol. 16, Issue 10, 4695-4704, October 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

* Department of Molecular, Cellular, and Developmental Biology and Howard Hughes Medical Institute, Boulder, CO 80303;
Boulder Laboratory for 3-D Electron Microscopy of Cells, University of Colorado, Boulder, CO 80303
Submitted March 14, 2005;
Revised July 12, 2005;
Accepted July 14, 2005
Monitoring Editor: Jean Schwarzbauer
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
ARX knockout mice exhibit defects similar to the clinical indications seen in XLAG individuals (Kitamura et al., 2002
). At the cellular level, ARX knockout mice have clear defects in proliferation, differentiation, and migration of neurons within specific areas of the forebrain (Kitamura et al., 2002
). These areas correlate well with the expression patterns for ARX in both mice and humans (Miura et al., 1997
; Bienvenu et al., 2002
; Ohira et al., 2002
; Poirier et al., 2004
). These observations support the conclusion that ARX plays a fundamental role in the development and function of the forebrain. An important step in understanding the mechanisms by which ARX mutations exert their deleterious effects will be the identification and analysis of subcellular processes controlled by ARX-related proteins.
ARX is orthologous to the paired class homeobox transcription factor aristaless of Drosophila (Galliot et al., 1999
). At the developmental level, Aristaless expression defines the presumptive tip within the larval imaginal disks (Campbell et al., 1993
; Schneitz et al., 1993
; Campbell and Tomlinson, 1998
). Loss of Aristaless function results in a failure to develop the distal-most leg segments, the pretarsus, and the distal-most antennal sensory structures, the arista (Schneitz et al., 1993
; Campbell and Tomlinson, 1998
). More specifically, Aristaless expression has been implicated in defining the distal-most segment boundary by controlling Fasciclin 2 expression (Tsuji et al., 2000
). Fasciclin 2 is an immunoglobulin superfamily protein implicated in cell adhesion, suggesting a direct role for Aristaless in demarcating cell adhesion properties for those cells specific to the distal regions of the developing appendages.
In this study, we examined the role of ALR-1, the C. elegans aristaless orthologue (Galliot et al., 1999
), in amphid organ function. The C. elegans chemotactic responses are primarily mediated by the amphid neurons (reviewed in Mori, 1999
). The amphids are bilateral chemosensory organs, located in the nose of the animal, that are composed of 12 sensory neurons and their associated glial-like support cells, the sheath and socket cells (Ward et al., 1975
). The sheath cell associates with all 12 neurons by surrounding their dendrite endings, isolating them from surrounding tissues. The amphid socket cell bridges the gap between the sheath cell and the external cuticle, creating a pore through which the exposed sensory cilia of six amphid neurons contact the environment. The intimate association between the sheath and socket cell serves to create an exclusive environment for the sensory cilia. An analogous structure in the tail of the animal, composed of one sheath and two socket cells, supports the two phasmid neurons on either side of the worm (Hall and Russell, 1991
). The integrity of these organ structures is required to mediate responses to a wide range of compounds and stimuli (Lewis and Hodgkin, 1977
; Albert et al., 1981
; Perkins et al., 1986
; Hilliard et al., 2002
). Our studies reveal that the alr-1 gene product is required to maintain the functional and structural integrity of the amphid organs during larval development. Furthermore, we demonstrate that expression of ALR-1 is specifically required in the amphid socket cells to maintain their unique cell shape and cellcell contacts. Finally, we also define a role for ALR-1 during embryogenesis involving morphogenesis of the hypodermal cells that enclose the anterior of the embryo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Characterization of alr-1(ok545) cDNA
The alr-1(ok545) lesion was sequenced directly from genomic DNA and was identical to that reported by the C. elegans Gene Knockout Consortium (http://celeganskoconsortium.omrf.org) for the corresponding gene, R08B4.2. To determine the nature of the mRNA produced from this allele, we generated cDNAs with alr-1 gene-specific primers (atgcccgagttgaagaaagaagac and gcatgaactttcttcttttggcttcac) and the SuperScript One-Step RT-PCR kit (Invitrogen, Carlsbad, CA). These PCR products were cloned and sequenced. A single class of alr-1 cDNA from the ok545 strain was identified, which revealed an aberrantly spliced transcript joining exons 3 and 5. This procedure would not identify mRNA products that arise from alternative splicing occurring outside of the primer sequences.
Expression Constructs
The alr-1p::GFP reporter construct was generated by inserting 1 kb of upstream regulatory sequence into the pPD95.75 vector (a gift from A. Fire), which contains the green fluorescent protein (GFP) coding sequence (Chalfie et al., 1994
) and the 3' untranslated region of unc-54 (Fire et al., 1990
) at the 3' end. This construct was injected into N2 worms at 10 ng/µl along with a PCR product corresponding to 6 kb of overlapping alr-1 upstream regulatory sequence and a dominant Roller marker, pRF4 containing rol-6 (su1006),at100 ng/µl to generate kuEx146. The itr-1pB::alr-1 rescuing construct was generated by inserting 2.2 kb of the itr-1 promoter B sequence (Gower et al., 2001
) upstream of the full-length alr-1 cDNA (yk391d5) in the pBS SK(-) vector. This construct was injected into N2 worms at 1 ng/µl along with a sur-5::GFP marker (pTG96.2) (Yochem et al., 1998
) at 50 ng/µl. This construct was integrated into the genome by using standard methods (Epstein, 1995) to generate kuIs67.
Analysis of alr-1 Mutant Phenotypes
Dye-filling assays were performed using 1,1-dioctadecyl-3,3,3,3-tetramethylindocarbocyanin (DiI), at 20 µm/ml as described previously (Perkins et al., 1986
; Starich et al., 1995
). Osmotic avoidance assays were performed on individual worms as described previously (Culotti and Russell, 1978
) with some modifications: Adult worms were encircled within a 1.6-mm barrier of 4 M NaCl, and L2 larval worms were encircled within a 0.8-mm barrier of 4 M NaCl. Assays were conducted over a period of 15 min.
Electron Micrographs
Samples were cryoimmobilized using a BAL-TEC HPM 010 high-pressure freezer, followed by freeze-substitution fixation and epoxy embedding as described previously (McDonald and Muller-Reichert, 2002
). Then, 100-nm serial sections (90 nm in L1 larva) were examined at 80 keV by using a Philips CM10 electron microscope.
Immunofluorescence
Images were collected using an Axioplan2 microscope (Carl Zeiss, Thorton, NY) and a Hamamatsu C4742-95 charge-coupled device camera (Hamamatsu Photonics, Bridgewater, NJ). Images were analyzed using Openlab 3.1.7 (Improvision, Lexington, MA) software, and figures were compiled using Photoshop 8.0 and Illustrator 11.0 (Adobe Systems, San Jose, CA).
| RESULTS |
|---|
|
|
|---|
6 kb of upstream promoter sequence driving the GFP open reading frame, this reporter allowed us to determine transcriptional expression at different times during developmental and adult stages. The GFP protein did not contain a nuclear localization signal, facilitating cell identification based on both cell location and cell morphology. Embryonic analysis indicated an early expression pattern just after the 28-cell stage. The strongest expression at this point was seen in descendants of the C linage as well as less prominent expression within a subset of the AB lineage (our unpublished data). By the comma stage (
400 cells), GFP expression was apparent in alternating dorsal hypodermal cells before the onset of cell fusions (Figure 1A, triangles). After the onset of the hypodermal cell fusions, GFP was apparent throughout the hyp7 hypodermal syncytium (our unpublished data). At the comma stage, GFP was also strongly expressed in the precursors to the PLM and ALN neurons, the T-cells (precursors to the phasmid socket cells), and the cells that would comprise the hyp4 anterior hypodermal syncytium (Figure 1A). These cells were tentatively identified based on cell position (Sulston et al., 1983
|
alr-1 Mutants Display a Progressive Dye-filling Defect in the Amphid and Phasmid Neurons
To determine the functional role of ALR-1, we obtained a deletion allele from the C. elegans Knockout Consortium corresponding to the alr-1 open reading frame. Sequence analysis indicated that this strain, alr-1(ok545), contained a 793-bp deletion resulting in the removal of the entire fourth exon of alr-1 (Figure 1G). Sequencing of alr-1 cDNAs isolated from this strain revealed an mRNA product with an aberrant splice pattern joining exons 3 and 5, thereby resulting in a frame shift within the homeodomain. The predicted encoded protein is truncated in the last 30 residues of the 61-amino acid homeodomain and also produces a novel 25 amino acid C terminus. Phenotypically, the alr-1(ok545) strain was superficially indistinguishable from wild type, displaying only an occasional (17% penetrance, n > 200) displaced mouth opening (see below). However, adult worms did show a tendency to crawl up the sides of the culture plate and desiccate. Greater than 15% of adult alr-1(ok545) worms demonstrate this behavior (n > 500), compared with <1% in wild type (n > 500). This behavior is reminiscent of that described previously for strains defective in chemotaxis mediated by the amphid neurons (Starich et al., 1995
).
Wild-type animals readily take up fluorescent dyes, such as DiI, into the exposed ciliated endings of the amphid (Figure 2A) and phasmid (Figure 2B) neurons (Perkins et al., 1986
; Starich et al., 1995
). We used this assay as a preliminary evaluation of amphid function in alr-1(ok545). In wild-type animals, six of the 12 amphid neurons and both phasmid neurons on each side of the animal characteristically stained with DiI throughout larval development and adulthood (Figure 2, AD). Mutations in genes that affect amphid structure, such as osm-3(p802), result in dye-filling defects (Perkins et al., 1986
; Starich et al., 1995
). The osm-3 gene encodes a kinesin-like protein required for the development of the distal-most segment of exposed ciliated sensory endings and subsequently has a strong defect in dye filling, as well as a defect in chemotaxis toward soluble compounds (Shakir et al., 1993
; Tabish et al., 1995
). Typical of other dye-filling mutants, osm-3(p802) showed a complete absence of dye-filled amphid and phasmid neurons throughout larval development and adulthood in our assays (Figure 2, C and D).
|
|
alr-1 Mutants Display Defects in Osmotic Avoidance
The ASH amphid neurons mediate avoidance of areas of high osmolarity (Bargmann et al., 1990
). Assays for defects in osmotic avoidance are performed by encircling individual worms with high concentrations of NaCl and then scoring whether the worm crosses this barrier within a defined time (Culotti and Russell, 1978
). We used these assays as a means of measuring amphid function in alr-1(ok545). In our assays, wild-type adult worms typically did not cross a barrier of 4M NaCl (97% avoidance; Figure 3). Adult alr-1(ok545) animals, in contrast, showed a very strong defect in osmotic avoidance, comparable with that of osm-3(p802) worms (18 and 16% avoidance, respectively; Figure 3). Consistent with our dye-filling assays, alr-1(ok545) adults harboring the itr-1pB::alr-1 construct showed a greater than threefold increase in their ability to avoid areas of high osmolarity compared with alr-1(ok545) alone (49 vs. 16% avoidance, respectively; Figure 3), thus suggesting that ALR-1function within the amphid socket cells likely underlies the osmotic avoidance defects of alr-1(ok545). Assaying worms in the absence of high osmolarity produced a similar result among the different strains (Figure 3), indicating that defects in motility were not responsible for the differences between these strains.
|
Ultrastructural Defects of the Amphid Organs in Adult alr-1 Mutants
To better determine the underlying cause of the dye filling and osmotic avoidance defects seen in alr-1(ok545) worms, we reconstructed the anterior-most portions of the amphid structures using serial section electron micrographs and compared both wild-type and mutant worms. In total, two adults and two L1 larvae were reconstructed for each strain. In wild-type adults, the amphid cilia passed through amphid pocket
4 µm from the tip of the nose (Figure 4A). The amphid pocket is a deep invagination of the sheath cell filled with a sheath cell-secreted matrix material (Ward et al., 1975
). The matrix material was contained within this exclusive extracellular space by the close association of the amphid sheath and socket cells. The cilia that were exposed to the environment passed from the amphid pocket into the socket cell (at 2.5 µm; Figure 4B) and were bundled tightly within the cuticle-lined pore at
1 µm (Figure 4C). The intersection between the sheath and socket cells as well as the socket cell self-junction were marked by the presence of electron-dense junctions (Figure 4, AC, arrows), consistent with previous findings (Ward et al., 1975
; Perkins et al., 1986
).
|
EM analysis of L1 larvae indicated that the amphid socket cell was initially formed and intact in alr-1(ok545). In wild-type L1 worms, the socket cell was apparent, forming a cylindrical-shaped pore at its most anterior end via self-junctions (Figure 5A, arrows). The socket cell in alr-1(ok545) was also apparent with the self-junctions and the sheathsocket cell junctions intact (Figure 5B, arrows; our unpublished data). However, the socket cell in alr-1(ok545) did seem significantly less substantial than that of wild type.
The Socket Cell Shape Is Changed in alr-1 Mutants
To determine the fate of the amphid socket cell, we used a GFP reporter driven by the unc-53pB promoter. The unc-53pB promoter has been shown previously to express very strongly throughout the larval and adult stages in a number of tissues, including the amphid socket cells (Stringham et al., 2002
). The unc-53pB::GFP reporter allowed us to accurately record the presence of the amphid socket cell as well as its cell morphology, from the earliest larval stages throughout adulthood.
In wild type, the amphid socket cell had a variable cell body position close to the anterior bulb of the pharynx with a single slender appendage extending toward the nose of the animal (Figure 6A). The distal end of the appendage formed a distinct cylindrical "socket" shape (Figure 6A, inset) that lay in close contact with the cuticle. This morphology is typically invariant and consistent throughout all stages. In contrast, the amphid socket cell morphology in alr-1(ok545) worms underwent significant changes toward the end of larval development. At the earliest larval stages, L1 through L3, the socket cell seemed typical of wild-type animals. However, beginning in the L4 larval stage and becoming predominant in adults, the distal end of the appendage began to look misshapen (Figure 6B). The cylindrical-shaped ending was typically no longer apparent, becoming amorphous with variable projections and membrane excrescences (Figure 6B, inset). The distal end also no longer made contact with the cuticle and often had retracted a significant distance (on average, >5 µm). Furthermore, the boundary defining the cell body was typically more disordered than wild type and was often seen to display numerous membrane projections (Figure 6B, triangles). The distal-most ending was also frequently deformed by large, intracellular vacuoles (Figure 6, C and D). These vacuoles were most prominent in older adults, perhaps implicating late-stage processes in the morphological changes at the distal end of the amphid socket cell.
|
-catenin, and
-catenin/Armadillo, respectively (Costa et al., 1998
To determine whether the cadherincatenin complex might enhance the dye-filling phenotype associated with alr-1(ok545), we took advantage of the hypomorphic alleles hmp-1(fe4) (Pettitt et al., 2003
) and hmp-2(qm39) (Costa, unpublished observations), previously known as mad-1(qm39) (Hekimi et al., 1995
). The hmp-1(fe4) and hmp-2(qm39) mutations alone had completely wild-type levels of amphid dye filling at all developmental stages (Figure 7). In contrast, the alr-1(ok545); hmp-1(fe4) and alr-1(ok545); hmp-2(qm39) double-mutants showed a significant and reproducible earlier onset of the dye-filling defect compared with alr-1(ok545) alone (Figure 7). Specifically, the number of amphid organs that dye filled in the L2, L3, and L4 larval stages decreased by 7, 17, and 21% (p < 0.005), respectively, in the alr-1(ok545); hmp-1(fe4) strain and by 17, 17, and 15% (p < 0.005), respectively, in the alr-1(ok545); hmp-1(qm39) strain compared with alr-1(ok545) alone. These observations indicated that impaired function of the cadherincatenin complex could enhance the dye-filling defect of alr-1(ok545).
|
alr-1 Mutants Display Defects in Anterior Hypodermal Morphogenesis
The body morphology of the alr-1(ok545) strain was superficially indistinguishable from wild type; however, worms did show an occasionally displaced mouth opening (Figure 8, A and B), typically to the ventral side of the worm. Aproximatly 17% of alr-1(ok545) worms (36 of 210 animals assayed) demonstrated this phenotype, compared with <1% in wild type (2 of 227 animals assayed). This phenotype is reminiscent of that described previously for strains defective in morphogenesis of the anterior hypodermis (Brenner, 1974
; Wang et al., 1999
; Ginzburg et al., 2002
). The morphogenesis of the C. elegans hypodermis occurs during embryogenesis (reviewed in Shemer and Podbilewicz, 2000
; Piekny and Mains, 2003
). The hypodermal precursors are initially positioned as a sheet of cells resting on the dorsal surface of the embryo. During morphogenesis of the head hypodermis, the lateral-most anterior cells of the hypodermal sheet migrate ventrally to meet at the ventral midline. These cells encircle the head of the embryo and subsequent cell fusion events produce the four toroidal-shaped cells, hyp36. The boundaries of these cells are easily observed in both larvae and adults using the apical junction marker ajm-1::GFP (Mohler et al., 1998
; Koppen et al., 2001
).
|
| DISCUSSION |
|---|
|
|
|---|
The progressive degeneration of the amphid organs observed in alr-1 mutants is precipitated by dramatic changes in the cell shape of the amphid socket cells. The most striking difference we observed in our ultrastructure analysis between wild-type and alr-1(ok545) adult worms was the apparent absence of the amphid socket cells (Figure 4). However, analysis using a socket-cell-specific GFP marker indicated that the socket cells were indeed present in adult alr-1 mutant worms but failed to maintain their unique cell shape and cell-cell contacts (Figure 6). Considering the specific expression of our alr-1p::GFP reporter construct in the amphid socket cells (Figure 1C) and the requirement for ALR-1 expression within the socket cells for proper amphid function (Figures 2C and 3), we propose that ALR-1 is intrinsically required for maintaining the shape of the socket cells throughout larval development.
The architecture of a cell is defined by the arrangement of its cytoskeleton and proper adhesion via cellcell and cellextracellular matrix interactions. However, the exact molecular mechanisms required for producing and maintaining specific cell morphologies is not well understood. The structure of the amphid socket cell is essential for amphid neuron function and may serve as a unique model for insight into morphogenesis of the amphid organ and the regulation of cell shape. Because cell adhesion complexes are often associated with the cytoskeleton, they represent a critical juncture for the determination of cell shape. Our genetic analysis revealed that reduction-of-function mutations in the C. elegans
-catenin and
-catenin homologues hmp-1 and hmp-2 were capable of exacerbating the dye-filling phenotype associated with alr-1(ok545) (Figure 7). Although the exact molecular basis of these genetic interactions is not clear, these data suggest that defects in ALR-1 and the cadherincatenin complex may affect related cellular processes.
Although ALR-1 is required to maintain the unique shape and integrity of the amphid socket cells, it is not apparent whether its function is required during larval development or, alternatively, whether it functions at an earlier stage to establish the proper structure of these cells, which may be required to tolerate the mechanical stresses generated during the growth of the organism. Although these models are not mutually exclusive, it is apparent in our ultrastructure analysis of alr-1(ok545) L1 larvae that the size of the socket cell is significantly diminished (Figure 5B), suggesting that the embryonic development of these cells may be impaired. Furthermore, we have observed that the sister cells of the amphid socket cells (CEM neurons), which undergo programmed cell death in hermaphrodites, fail to express the cell specific marker PKD-2::GFP (Barr et al., 2001
) in either alr-1(ok545) males or alr-1(ok545);ced-3(n717) hermaphrodites (Tucker and Han, unpublished observations). This suggests that the defects observed in these cells may be due to a partial cell fate transformation of this cell linage. Consistent with this idea, recent work has also implicated ALR-1 as being involved in cell fate specification of the AWA, ASG amphid neurons, and the VD motor neurons (Melkman and Sengupta, 2005
). Together, these results implicate ALR-1 as a key regulator of cell determination in multiple neuronal cell lineages.
In this article, we have also demonstrated that ALR-1 is required for proper morphogenesis of the anterior hypodermis and positioning of the mouth opening. The underlying defect in these instances seems to be improper formation of the hyp5 hypodermal syncytium (Figure 8). During morphogenesis of the anterior hypodermis (reviewed in Shemer and Podbilewicz, 2000
; Piekny and Mains, 2003
), cells from the dorsal side of the embryo extend to meet at the ventral midline. Subsequent fusion between specific cells produces the toroidal-shaped cells that enclose the head of the embryo. Failure of the hyp5 precursor cells to properly migrate and/or make proper contacts at the ventral midline is the most plausible explanation for the defects we have observed in alr-1(ok545) worms. Interestingly, expression of alr-1p::GFP was not observed in hyp5 but in the neighboring hyp4 and hyp6 cells (Figure 8, G and H). Although it is possible that endogenous ALR-1 is expressed in hyp5, the alr-1p::GFP expression pattern suggests that proper formation of hyp5 may require external cues originating from nearby cells. Alternatively, formation of hyp5 may be impaired by aberrant cell-cell contacts between hyp4 and hyp6 that may occur in alr-1(ok545) worms. Consistent with this hypothesis, in wild type, before ventral migration of the hypodermal precursors, it seems that the lateral-most hyp4 and hyp6 precursors share a cell border. In effect, this cell contact excludes the hyp5 precursors from the migrating edge. Consequently, for the hyp5 precursor cells to meet at the ventral midline, the contact between the hyp4 and hyp6 precursors must be disrupted. Failure to disrupt these contacts, possibly stabilized by ectopic fusions between hyp4 and hyp6 precursors, could lead to the phenotypes we have observed in alr-1(ok545) worms.
An important implication of the work presented here is that the aristaless orthologues in other organisms may regulate similar processes to that of ALR-1 in C. elegans. The migration of neurons during vertebrate development often uses cellular substrates, and the structural integrity of these support cells as well as their adhesive properties are fundamental to this process (reviewed in Marin and Rubenstein, 2003
). Considering the role of ALR-1 in maintaining the shape of the amphid socket cells and its role in hypodermal morphogenesis, it is conceivable that the neuronal cell migration defects seen in ARX-deficient mice may be a result of cell shape defects or a failure to regulate specific cellcell contacts during development of the forebrain. However, given the complex nature of the human disorders caused by mutations in ARX, it would not be surprising if the clinical indications were generated by alterations in multiple pathways at the cellular level. Future work identifying the gene products directly regulated by ALR-1 will improve our understanding of the mechanisms underlying the maintenance of cell shape and/or cell adhesion and may provide significant insight into the etiology of the varying disorders caused by mutations in ARX.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Address correspondence to: Min Han (mhan{at}colorado.edu).
| REFERENCES |
|---|
|
|
|---|
Bargmann, C. I., Thomas, J. H., and Horvitz, H. R. ((1990). ). Chemosensory cell function in the behavior and development of Caenorhabditis elegans. Cold Spring Harb. Symp. Quant. Biol. 55, , 529-538.[Medline]
Barr, M., DeModena, J., Braun, D., Nguyen, C., Hall, D. H., and Sternberg, P. ((2001). ). The Caenorhabditis elegans autosomal dominant polycystic kidney disease gene homologs lov-1 and pkd-2 act in the same pathway. Curr. Biol. 11, , 1341-1346.[CrossRef][Medline]
Bienvenu, T., et al. ((2002). ). ARX, a novel Prd-class-homeobox gene highly expressed in the telencephalon, is mutated in X-linked mental retardation. Human Molecular Genetics 11, , 981-991.
Brenner, S. ((1974). ). The genetics of Caenorhabditis elegans. Genetics 77, , 71-94.
Campbell, G., and Tomlinson, A. ((1998). ). The roles of the homeobox genes aristaless and Distal-less in patterning the legs and wings of Drosophila. Development 125, , 4483-4493.[Abstract]
Campbell, G., Weaver, T., and Tomlinson, A. ((1993). ). Axis specification in the developing Drosophila appendage: the role of wingless, decapentaplegic, and the homeobox gene aristaless. Cell 74, , 1113-1123.[CrossRef][Medline]
Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., and Prasher, D. C. ((1994). ). Green fluorescent protein as a marker for gene expression. Science 263, , 802-805.
Chen, Z., and Han, M. ((2001). ). Role of C. elegans lin-40 MTA in vulval fate specification and morphogenesis. Development 128, , 4911-4921.
Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J., and Priess, J. R. ((1998). ). A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J. Cell Biol. 141, , 297-308.
Culotti, J. G., and Russell, R. L. ((1978). ). Osmotic avoidance defective mutants of the nematode Caenorhabditis elegans. Genetics 90, , 243-256.
Epstein, H. F., and Shakes, D. C. (ed.) ((1995). ). Caenorhabditis elegans: Modern Biological Analysis of an Organism, San Diego: Academic Press.
Fire, A., Kondo, K., and Waterston, R. ((1990). ). Vectors for low copy transformation of C. elegans. Nucleic Acids Res. 18, , 4269-4270.
Galliot, B., de Vargas, C., and Miller, D. ((1999). ). Evolution of homeobox genes: Q50 paired-like genes founded the Paired class. Dev. Genes Evol. 209, , 186-197.[CrossRef][Medline]
Ginzburg, V. E., Roy, P. J., and Culotti, J. G. ((2002). ). Semaphorin 1a and semaphorin 1b are required for correct epidermal cell positioning and adhesion during morphogenesis in C. elegans. Development 129, , 2065-2078.
Gower, N. J., Temple, G. R., Schein, J. E., Marra, M., Walker, D. S., and Baylis, H. A. ((2001). ). Dissection of the promoter region of the inositol 1,4,5-trisphosphate receptor gene, itr-1, in C. elegans: a molecular basis for cell-specific expression of IP3R isoforms. J. Mol. Biol. 306, , 145-157.[CrossRef][Medline]
Hall, D. H., and Russell, R. L. ((1991). ). The posterior nervous system of the nematode Caenorhabditis elegans: serial reconstruction of identified neurons and complete pattern of synaptic interactions. J. Neurosci. 11, , 1-22.[Abstract]
Hekimi, S., Boutis, P., and Lakowski, B. ((1995). ). Viable maternal-effect mutations that affect the development of the nematode Caenorhabditis elegans. Genetics 141, , 1351-1364.[Abstract]
Hilliard, M. A., Bargmann, C. I., and Bazzicalupo, P. ((2002). ). C. elegans responds to chemical repellents by integrating sensory inputs from the head and the tail. Curr. Biol. 12, , 730-734.[CrossRef][Medline]
Kato, M., et al. ((2004). ). Mutations of ARX are associated with striking pleiotropy and consistent genotype-phenotype correlation. Hum. Mutat. 23, , 147-159.[CrossRef][Medline]
Kitamura, K., et al. ((2002). ). Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans. Nat. Genet. 32, , 359-369.[CrossRef][Medline]
Koppen, M., Simske, J. S., Sims, P. A., Firestein, B. L., Hall, D. H., Radice, A. D., Rongo, C., and Hardin, J. D. ((2001). ). Cooperative regulation of AJM-1 controls junctional integrity in Caenorhabditis elegans epithelia. Nat. Cell Biol. 3, , 983-991.[CrossRef][Medline]
Lewis, J. A., and Hodgkin, J. A. ((1977). ). Specific neuroanatomical changes in chemosensory mutants of the nematode Caenorhabditis elegans. J. Comp. Neurol. 172, , 489-510.[CrossRef][Medline]
Marin, O., and Rubenstein, J. L. ((2003). ). Cell migration in the forebrain. Annu. Rev. Neurosci. 26, , 441-483.[CrossRef][Medline]
McDonald, K., and Muller-Reichert, T. ((2002). ). Cryomethods for thin section electron microscopy. Methods Enzymol 351, , 96-123.[Medline]
Melkman, T., and Sengupta, P. ((2005). ). Regulation of chemosensory and GABAergic motoR neuron development by the C. elegans Aristaless/Arx homolog. arl-1. Development 132, , 1935-1949.
Miura, H., Yanazawa, M., Kato, K., and Kitamura, K. ((1997). ). Expression of a novel aristaless related homeobox gene `Arx' in the vertebrate telencephalon, diencephalon and floor plate. Mech. Dev. 65, , 99-109.[CrossRef][Medline]
Mohler, W. A., Simske, J. S., Williams-Masson, E. M., Hardin, J. D., and White, J. G. ((1998). ). Dynamics and ultrastructure of developmental cell fusions in the Caenorhabditis elegans hypodermis. Curr. Biol. 8, , 1087-1090.[CrossRef][Medline]
Mori, I. ((1999). ). Genetics of chemotaxis and thermotaxis in the nematode Caenorhabditis elegans. Annu. Rev. Genet. 33, , 399-422.[CrossRef][Medline]
Ohira, R., et al. ((2002). ). Human ARX gene: genomic characterization and expression. Molecular Genetics & Metabolism 77, , 179-188.
Perkins, L. A., Hedgecock, E. M., Thomson, J. N., and Culotti, J. G. ((1986). ). Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev. Biol. 117, , 456-487.[CrossRef][Medline]
Pettitt, J., Cox, E. A., Broadbent, I. D., Flett, A., and Hardin, J. ((2003). ). The Caenorhabditis elegans p120 catenin homologue, JAC-1, modulates cadherin-catenin function during epidermal morphogenesis. J. Cell Biol. 162, , 15-22.
Piekny, A. J., and Mains, P. E. ((2003). ). Squeezing an egg into a worm: C. elegans embryonic morphogenesis. Sci. World J. 3, , 1370-1381.
Poirier, K., et al. ((2004). ). Neuroanatomical distribution of ARX in brain and its localisation in GABAergic neurons. Brain Res. Mol. Brain Res. 122, , 35-46.[Medline]
Raich, W. B., Agbunag, C., and Hardin, J. ((1999). ). Rapid epithelial-sheet sealing in the Caenorhabditis elegans embryo requires cadherin-dependent filopodial priming. Curr. Biol. 9, , 1139-1146.[CrossRef][Medline]
Scheffer, I. E., Wallace, R. H., Phillips, F. L., Hewson, P., Reardon, K., Parasivam, G., Stromme, P., Berkovic, S. F., Gecz, J., and Mulley, J. C. ((2002). ). X-linked myoclonic epilepsy with spasticity and intellectual disability: mutation in the homeobox gene ARX. Neurology 59, , 348-356.
Schneitz, K., Spielmann, P., and Noll, M. ((1993). ). Molecular genetics of aristaless, a prd-type homeo box gene involved in the morphogenesis of proximal and distal pattern elements in a subset of appendages in Drosophila. Genes Dev. 7, , 114-129.
Shakir, M. A., Fukushige, T., Yasuda, H., Miwa, J., and Siddiqui, S. S. ((1993). ). C. elegans osm-3 gene mediating osmotic avoidance behaviour encodes a kinesin-like protein. Neuroreport 4, , 891-894.[Medline]
Shemer, G., and Podbilewicz, B. ((2000). ). Fusomorphogenesis: cell fusion in organ formation. Dev. Dyn. 218, , 30-51.[CrossRef][Medline]
Starich, T. A., Herman, R. K., Kari, C. K., Yeh, W. H., Schackwitz, W. S., Schuyler, M. W., Collet, J., Thomas, J. H., and Riddle, D. L. ((1995). ). Mutations affecting the chemosensory neurons of Caenorhabditis elegans. Genetics 139, , 171-188.[Abstract]
Stringham, E., Pujol, N., Vandekerckhove, J., and Bogaert, T. ((2002). ). unc-53 controls longitudinal migration in C. elegans. Development 129, , 3367-3379.
Stromme, P., Mangelsdorf, M. E., Scheffer, I. E., and Gecz, J. ((2002a). ). Infantile spasms, dystonia, and other X-linked phenotypes caused by mutations in Aristaless related homeobox gene, ARX. Brain Dev. 24, , 266-268.[CrossRef][Medline]
Stromme, P., et al. ((2002b). ). Mutations in the human ortholog of Aristaless cause X-linked mental retardation and epilepsy. Nature Genetics 30, , 441-445.[CrossRef][Medline]
Sulston, J. E., Schierenberg, E., White, J. G., and Thomson, J. N. ((1983). ). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100, , 64-119.[CrossRef][Medline]
Tabish, M., Siddiqui, Z. K., Nishikawa, K., and Siddiqui, S. S. ((1995). ). Exclusive expression of C. elegans osm-3 kinesin gene in chemosensory neurons open to the external environment. J. Mol. Biol. 247, , 377-389.[CrossRef][Medline]
Tepass, U. ((1999). ). Genetic analysis of cadherin function in animal morphogenesis. Curr. Opin. Cell Biol. 11, , 540-548.[CrossRef][Medline]
Tsuji, T., Sato, A., Hiratani, I., Taira, M., Saigo, K., and Kojima, T. ((2000). ). Requirements of Lim1, a Drosophila LIM-homeobox gene, for normal leg and antennal development. Development 127, , 4315-4323.[Abstract]
Wang, X., Roy, P. J., Holland, S. J., Zhang, L. W., Culotti, J. G., and Pawson, T. ((1999). ). Multiple ephrins control cell organization in C. elegans using kinase-dependent and -independent functions of the VAB-1 Eph receptor. Mol. Cell 4, , 903-913.[CrossRef][Medline]
Ward, S., Thomson, N., White, J. G., and Brenner, S. ((1975). ). Electron microscopical reconstruction of the anterior sensory anatomy of the nematode Caenorhabditis elegans.?2UU. J. Comp. Neurol. 160, , 313-337.[CrossRef][Medline]
Wheelock, M. J., and Johnson, K. R. ((2003). ). Cadherins as modulators of cellular phenotype. Annu. Rev. Cell Dev. Biol. 19, , 207-235.[CrossRef][Medline]
Yochem, J., Gu, T., and Han, M. ((1998). ). A new marker for mosaic analysis in Caenorhabditis elegans indicates a fusion between hyp6 and hyp7, two major components of the hypodermis. Genetics 149, , 1323-1334.
This article has been cited by other articles:
![]() |
V. Vermeirssen, M. I. Barrasa, C. A. Hidalgo, J. A. B. Babon, R. Sequerra, L. Doucette-Stamm, A.-L. Barabasi, and A. J.M. Walhout Transcription factor modularity in a gene-centered C. elegans core neuronal protein-DNA interaction network Genome Res., July 1, 2007; 17(7): 1061 - 1071. [Abstract] [Full Text] [PDF] |
||||