![]() |
|
|
Vol. 16, Issue 11, 5061-5069, November 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Immunology, Weizmann Institute of Science, 76100 Rehovot, Israel
Submitted April 20, 2005;
Revised August 9, 2005;
Accepted August 10, 2005
Monitoring Editor: Peter Walter
| ABSTRACT |
|---|
|
|
|---|
B p65/RelA homodimer and the B-cell-enriched coactivator, TAFII105. Here, we add CD74 to the growing family of RIP-processed proteins. Our studies show that CD74 ectodomain must be processed in the endocytic compartments to allow its intramembrane cleavage that liberates CD74 intracellular domain (CD74-ICD). We demonstrate that CD74-ICD translocates to the nucleus and induces the activation of the p65 member of NF-
B in this compartment. | INTRODUCTION |
|---|
|
|
|---|
In general, in most RIP cases reported, cleavage proceeds through a two-step sequential proteolytic process. The first step involves the cleavage of the extracytoplasmic segment to shorten the ectodomain to <30 aa. This seems to be a requirement for the second proteolytic event, which occurs at the transmembrane domain. The initial shedding prepares the substrate for the intramembrane proteolysis such that the transmembrane region becomes accessible to the second protease, which then releases the product from the lipid bilayer. The released cytosolic fragment then migrates into the nucleus. Intramembrane cleaving proteases (I-CLiPs) catalyze peptide bond hydrolysis in the plane of cellular membranes. These proteases are thought to mediate RIP (Brown et al., 2000
), and the reactions they catalyze are, in most cases, part of highly controlled processes. The family of I-CLiPs is growing, and at present, three distinct protease families have been shown to catalyze intramembrane proteolysis (Urban and Freeman, 2002
; Weihofen and Martoglio, 2003
; Lemberg and Martoglio, 2004
). This tightly regulated mechanism guarantees controlled proteolysis in the plane of the membrane and prevents random degradation of membrane proteins (Brown et al., 2000
; Hoppe et al., 2001
; Urban and Freeman, 2002
).
CD74 is a nonpolymorphic type II integral membrane protein; it has a short N-terminal cytoplasmic tail of 28 amino acids, followed by a single 24-aa transmembrane region. Alternative initiation of translation and differential splicing of the transcription products generate two different isoforms in mice (p31 and p41; Stumptner-Cuvelette and Benaroch, 2002
). The CD74 chain was thought to function mainly as an MHC class II chaperone, which promotes ER exit of MHC class II molecules, directs them to endocytic compartments, prevents peptide binding in the ER, and contributes to peptide editing in the MHC class II compartment (Stumptner-Cuvelette and Benaroch, 2002
). However, in addition to its function as a chaperone molecule, CD74 was recently shown to have a role as an accessory signaling molecule. An accessory role for CD74 was identified during T-cell responses through interactions with CD44 (Naujokas et al., 1993
). Recently, CD74 was reported to be a high-affinity binding protein for the proinflammatory cytokine, macrophage migration-inhibitory factor (MIF), providing further evidence for a role in signal transduction pathways. MIF binds to the extracellular domain of CD74, and CD74 is required for MIF-mediated phosphorylation of the extracellular signal-regulated kinase-1/2 (ERK-1/2), cell proliferation, and prostaglandin E2 (PGE2) production (Leng et al., 2003
). Besides its roles in inflammation and immunity, MIF is suggested to be involved in tumor cell growth and angiogenesis (Nishihira et al., 2003
). Moreover, CD74 was shown to be directly involved in the maturation of follicular B-cells (Shachar and Flavell, 1996
) and accumulation of marginal zone B-cells (Benlagha et al., 2004
). The role of CD74 in follicular B-cell differentiation involves induction of a pathway leading to the activation of transcription mediated by the NF-
B p65/RelA homodimer and its coactivator, TAFII105 (Matza et al., 2001
). NF-
B is activated by the intracellular domain of CD74 (CD74-ICD) that is liberated from the membrane. Amino acids 4244 were found to be essential for this cleavage event (Matza et al., 2002
).
The process of intramembrane cleavage followed by nuclear translocation and transcriptional activation is reminiscent of regulated intramembrane cleavage (RIP). Intramembrane cleavage of RIP-processed proteins is signal dependent; however, the natural ligand for CD74 in B-cells is still unknown.
To determine whether CD74 is processed by RIP, we followed the processing and cleavage of the CD74 extracellular domain, I-CLiP, the release of CD74-ICD, and its translocation to the nucleus. The results presented here show that arrival of CD74 to the endocytic compartments and the sequential proteolytic cleavages in these compartments are necessary for the intramembrane cleavage and for the release of CD74-ICD. CD74-ICD translocates to the nucleus to activate of NF-
B, allowing B-cell maturation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Constructs and Molecular Cloning
CD74 LI78AA-GFP was constructed in pEGFP-C1 (Clontech, Palo Alto, CA), CD74 LI7-8AA myc and 1-82 LI78AA myc were constructed in pEF4/Myc-HisA (Invitrogen, Carlsbad, CA) using QuikChange Site-Directed Mutagenesis Kit (catalogue no. 200518, Stratagene, La Jolla, CA), with the following primers: 5' GGATGACCAACGCGACGCCGCCTCTAACCATGAACAGTTGCCC 3'; 5' GGGCAACTGTTCATGGTTAGAGGCGGCGTCGCGTTGGTCATCC 3'; GFP 1-197 in pEGFP-C1 (Clontech) was constructed using QuikChange Site-Directed Mutagenesis Kit, with the following primers: 5' GCCACTGGATATGTAAGACGAAGCTTCTGGCCTGG 3'; 5' CCAGGCCAGAAGCTTCGTCTTACATATCCAGTGGC 3'.
CD74 1197 myc, CD74 1160 myc, CD74 1120 myc, and CD74 1100 myc were constructed in pEF4/Myc-HisA (Invitrogen) as described (Matza et al., 2002
) with the following primer sequences for cloning: 5' primer as described in Matza et al. (2002
); 3' primers: 5' TCTGCAGAATTCCATGTCCAGTGGCTCTTTAGGTGG 3' for CD74 1197 Myc; 5' TCTGCAGAATTCGTTCACGCCATCCATGGAGTTCTTAAG 3' for CD74 1160 Myc; 5'TCTGCAGAATTCCATGTTGCCGTACTTGGTAACGTT 3' for CD74 1120 Myc; 5' TCTGCAGAATTCTGGACGCATCAGCAAGGGAGTAGC 3' for CD74 1100 Myc.
GFP CD74 1100 were constructed in pEGFP-C1 (Clontech) plasmid as described in Matza et al. (2002
). The 5' primer was described in Matza et al. (2002
); 3' primer: 5' TCTGGTGGATCCTATGGACGCATCAGCAAGGGAGTAGC 3' for GFP CD74 1100.
The Xpress-CD74 construct was prepared by cloning to pEF4/Xpress-HisA (Invitrogen), using cloning primer sequences as follows: 5' primer at position 1 of CD74: 5'-CCTAGGATCCATGATGACCAACGCGACCTCATCTCT-3'; 3' primer at the last amino acid of CD74 (FL): 5'-TGCAGAATTCCTCACAGGGTGACTTGACCCAGTTC-3'.
CD74 142 nuc and CD74 142 mito constructs were prepared by cloning to pEF/myc/nuc and pRE/myc/mito plasmids (Invitrogen), using cloning primer sequences as follows: 5' primer at position 1 of CD74: 5'-CGCTGCAGGATGACCAACGCGACCTCATCTCT-3'; 3' primer at position 42 of CD74: 5'-CTGCGGCCGCCACCAGGACAGAGACACCGGTGT-3'.
For all the constructs, the PCR products were separated by agarose electrophoresis to ensure the correct size and purified from the gel using Wizard PCR Preps (Promega, Madison, WI). The products and the cloning plasmids were digested by PstI and NotI (NEB) for pEF/myc/nuc and pRE/myc/mito plasmids or by BamHI (New England Biolabs, Beverly, MA) followed by EcoRI (Amersham Pharmacia Biotech, Piscataway, NJ) for pEF4/Xpress-HisA, and the products were ligated into the appropriate plasmid vector. Clones were subjected to automated DNA sequencing by standard protocols using an ABI377 machine (PE Biosystems, Foster City, CA). The full sequence of all CD74 inserts was verified with no errors in the sequence.
Rous sarcoma virus (RSV)-Renilla luciferase plasmid was a generous gift from M. Walker (Weizmann Institute of Science, Rehovot, Israel).
Cell Transfection
HEK 293 cells were seeded in a 10-cm2 dish. Transfections were performed using the standard CaPO4 method as described previously (Matza et al., 2002
). A total of 5 µg DNA (FL CD74) or 1 µg (182 Myc) were used per 10-cm2 dish. At 24-h posttransfection, cells were treated with either BFA (2.5 µg/ml), NOC (2.5 µg/ml), Mon (10 µM), chloroquine (25 µM/100 µM), or LEU (1 mM) for 3 or 5 h.
Purified CD74/ B-cells were incubated with 50 µg/ml LPS from Salmonella typhosa (Sigma). After 48 h, the cells were washed with RPMI media and transfected with TransFast transfection reagent (Promega) using 12 µl/4 µg DNA (2 µg CD74 construct + 2 µg empty vector or 4 µg empty vector) according to the manufacturer's directions. The cells were collected after 48 h and analyzed for their cell surface marker expression by FACS analysis. The percentage increase of IgD+ cells was calculated by subtracting the X mean fluorescence value of IgD+ staining of empty expression plasmid and dividing it to the same X mean value multiplied by 100%.
Cell Fractionation
Full fractionation: The fractionation method was adopted from Wang et al. (1994
). Transfected 293 cells were disrupted by incubation in 5 vol of low-salt buffer supplemented with protease inhibitors (buffer C) for 30 min, followed by passage 10 times through a 25-gauge needle. The lysate was centrifuged at 1000 x g for 10 min to obtain the crude nuclei. The supernatant was further centrifuged at 100,000 x g for 1 h to obtain a cytosolic fraction and a crude membrane pellet. This pellet was washed in a 500 mM NaCl buffer with protease inhibitors (buffer D) to obtain a membrane fraction.
The low-centrifugation nuclear pellet was washed three times with buffer C and then incubated with buffer D for 30 min followed by 20,000 x g centrifugation for 20 min to obtain nuclear extract and nuclear debris fractions. Both pellet fractions were solubilized in 10 mM Tris-HCl (pH 6.8), 0.1 M NaCl, and 1% (vol/vol) SDS. All the fractions were supplemented with SDS loading buffer and boiled for 10 min.
Separation between membrane and supernatant fractions: HEK 293 cells were grown to confluency on 10-cm tissue culture dishes, rinsed once with cold phosphate-buffered saline (PBS) and once with cold 20 mM Tris-Cl (pH 7.4), 1 mM MgCl2, 2 mM EGTA, 0.1 mM sodium orthovanadate, 10 µg/ml aprotinin, and 10 µg/ml leupeptin (hypotonic lysis buffer; HLB), and lysed by Dounce homogenization after swelling in 700 µl of HLB per 10-cm dish. Lysates were centrifuged for 45 min at 10,000 rpm in an Eppendorf microcentrifuge at 4°C to separate the particulate and soluble fractions. Soluble fractions were lyophilized and resuspended in a small volume.
Luciferase Assay for Monitoring NF-
B Activation
Subconfluent 293 cells were transfected in a 24-well plate using a total of 1 µg plasmid; empty or CD74 expression vectors (25 ng) were added together with 20 ng of the Gal4 luciferase reporter, 0.5 ng of DBD fusion plasmids, and 1 ng of RSV-Renilla luciferase. The total amount of DNA was kept constant by adding pBabe vector. After transfection, cells were incubated 24 h and then harvested, and their luciferase and Renilla luciferase activities were measured.
Preparation of Cell Extracts and Western Blot Analysis
Cells were pelleted and incubated with 50 µg/ml digitonin (Sigma) and the pellet was then lysed as previously described (Shachar et al., 1995
). For hot SDS-cells were collected 48 h posttransfection and cell lysates were prepared as described previously (Erickson and Blobel, 1979
). Lysates were resolved by SDS-PAGE or Tricine gels and electroblotted onto nitrocellulose. Tricine-SDS-PAGE (16%, wt/vol) and transfer to membranes was performed as previously described (Schagger and von Jagow, 1987
). The blots were blocked with 10% (vol/vol) skim milk for 1 h and then probed for 1 h with IN1 (anti-CD74 cytoplasmic tail mAb) antibodies followed by washing and 1-h incubation with horseradish peroxidase-conjugated goat anti-rat IgG (Jackson ImmunoResearch Laboratories, West Grove, PA), and peroxidase visualization by enhanced chemiluminescence (Amersham).
Fluorescence Microscopy
HEK 293 cells were plated on a coverslip. After 24 h, the cells were transfected as described above. After an additional 48 h, the cells were fixed with 3% PFA and were mounted on glass coverslip with Mowiol 488 (Calbiochem, La Jolla, CA).
Staining of the endosomes was performed with LysoTracker Red (Molecular Probes, Leiden, The Netherlands) according to the manufacturer's directions.
|
Immunofluorescence Microscopy
Transfected cells seeded on coverslips were fixed with 3% PFA and permeabilized with 0.4% Triton in 3% PFA. The cells were blocked with 10% fetal calf serum and incubated 1 h with IN1 antibody, followed by washing and incubation with CY-conjugated anti-rat antibody and DAPI. Then the cells were mounted on slides and analyzed as above.
| RESULTS |
|---|
|
|
|---|
|
|
In the endocytic compartments, CD74 is processed by a series of enzymes to generate a fragment of
82 aa, lacking most of its lumenal sequence. To determine whether this processing is essential for the release of CD74-ICD, the proteolytic activity in these compartments was inhibited using Mon, which inhibits endosomal activity by blocking acidification of the lumenal compartments (Dinter and Berger, 1998
). HEK 293 cells transfected with the FL Myc construct (Figure 1) and primary B splenocytes were incubated in the presence or absence of Mon for 3 h before their harvest.
Lysates were separated on Tricine gel and the liberation of CD74-ICD was monitored by Western blotting. Treatment with Mon largely inhibited CD74-ICD cleavage in both 293 cells (Figure 3C) and in primary B-cells (Figure 2C), suggesting that exit from the TGN and the enzymatic activity in the endocytic compartments are essential for CD74 intramembrane cleavage. To specifically inhibit the activities of the endocytic compartments and the processing of CD74 in these compartments, we used an acidotropic agent, chloroquine, which blocks endosomal acidification (de Duve et al., 1974
). Primary B splenocytes were incubated in the presence or absence of chloroquine for 3 h before their harvest. Lysates were separated on Tricine gel and the formation of CD74-ICD was monitored. As shown in Figure 3D, treatment with chloroquine resulted in a dramatic inhibition of CD74 processing and the formation of CD74-ICD was largely blocked. Thus, processing of CD74 in the endocytic compartments is essential for its transmembrane cleavage and CD74-ICD release.
To further demonstrate the importance of CD74 lumenal domain processing in CD74-ICD release, we directly inactivated proteases involved in this process using LEU. LEU is an inhibitor with broad specificity for cysteine proteases and was previously shown to interfere with the processing of CD74, resulting in accumulation of the CD74 intermediate fragments (Villadangos et al., 1997
). Splenocytes were treated for 3 h in the presence or absence of LEU and the formation of CD74-ICD was followed by Western blot analysis. As seen in Figure 2C, treatment with LEU resulted in accumulation of the processing products, and inhibition of CD74-ICD release. Hence, processing of the CD74 lumenal domain is essential for the release of its cytosolic fragment to the cytoplasm.
CD74 Lumenal Domain Regulates Its Intramembrane Cleavage and NF-
B Activation
To further demonstrate that the processing of CD74 lumenal domain in the endocytic compartment is essential for its intramembrane cleavage, we followed the release of CD74-ICD in various constructs containing sequential deletions of CD74 sequences and analyzed the release of CD74 cytosolic domain in each truncated construct. Within the endosomes, CD74 lumenal domain undergoes a stepwise proteolytic cleavage that yields progressively smaller fragments. An initial cleavage event generates the LIP22 fragment (160 aa), which is then cleaved to generate the LIP10 fragment (100 aa) and to enable the liberation of CLIP. We generated CD74 constructs of different sizes, including several that mimic the natural cleavage products of the lumenal domain. CD74 FL, 1197, 1160, 1120, 1100, and 182, C-terminally fused to GFP or Myc epitopes (Figure 1) were transfected into HEK 293 cells. To determine the role of CD74 lumenal domain on its intramembrane cleavage, we followed the localization of CD74-ICD -GFP in cells transfected with CD74 truncated mutants fused to GFP (Figure 1). As can be seen in Figure 4 GFP-FL and GFP-1197 (Figure 4A) and FL-Myc and 1160-Myc (Figure 4B) were mostly localized in the endocytic compartments, as previously described (Pieters et al., 1993
). However, removal of the bulk of the lumenal domain, resulted in cytoplasmic localization of CD74 cytosolic domain (Figure 4, A and B) as was previously shown for the GFP 182 construct (Matza et al., 2002
). Thus, deletion of the lumenal domain allows a more efficient release of its cytosolic fragment to the cytoplasm.
|
To further establish the inhibitory role for CD74 lumenal domain, Myc-transfected cells were collected, their lysates were separated on Tricine gels, and the levels of CD74-ICD in transfected cells were analyzed by Western blot analysis with the IN1 antibody. Although the release of CD74-ICD from FL, 1197, 1160 Myc (Figure 5A), and 1120 Myc (Figure 5B) constructs was at barely detectable levels, a dramatic elevation in the liberation of this fragment was observed after transfection of the 1100 and 182 constructs (Figure 5, A and B). Together, these results indicate that the processing of CD74 in the endocytic compartments enables its intramembrane cleavage and the liberation of CD74-ICD.
|
Previously, we showed that CD74 induces B-cell maturation by activating the TAFII105NF-
B-dependent transcription program (Matza et al., 2001
). CD74 induces the activation domain of the p65/RelA protein, a process that is essential for maturation of B-cells. To determine whether processing of the CD74 lumenal domain, required for CD74-ICD release, is also essential for NF-
B activation, a fusion of the C-terminal transactivation domain of p65/RelA and the DNA-binding domain of the yeast transcription factor, Gal4, was transfected into 293 cells along with a luciferase reporter containing the Gal4-binding sites, in the presence of various CD74 truncated plasmids (Matza et al., 2001
) and the RSV promoter, which was used as a reference. As can be seen in Figure 5F, augmented NF-
B activation was detected in constructs lacking the bulk of the lumenal domain (CD74 1100myc 182myc). Thus, the natural processing of CD74 lumenal domain prepares the molecule for efficient intramembrane cleavage. The release of CD74-ICD induces NF-
B-mediated transcription.
The I-CLiP Involved in CD74 Intramembrane Cleavage
Intramembrane proteolysis is a widely conserved mechanism for controlling diverse biological processes (Brown et al., 2000
; Kopan and Goate, 2000
). Several protease families are currently known to catalyze intramembrane proteolysis: S2P, Rhomboid and the presenilins (PS), and SPP-type aspartic proteases (Weihofen and Martoglio, 2003
). Presenilins play a catalytic role in the
-secretase complex required for regulated intramembrane proteolysis (Haass and Steiner, 2002
). To determine which protease is involved in CD74 cleavage, we analyzed whether the intramembrane proteolytic processing of CD74 is dependent on
-secretase activity. HEK 293 cells express endogenous PS-dependent
-secretase activity and have been widely used to investigate PS-dependent processing of APP (De Strooper et al., 1998
; Naruse et al., 1998
), CD44 (Lammich et al., 2002
; Murakami et al., 2003
), ErbB-4 (Ni et al., 2001
), E-cadherin (Marambaud et al., 2002
), and Notch (Lammich et al., 2002
). HEK 293 cells were cotransfected with a FL CD74 construct and a dominant negative construct of presenilin (DN-PS1). Cells were then separated into membrane and soluble fractions. The soluble fraction was concentrated and analyzed for the presence of the cleaved cytoplasmic domain. As can be seen in Figure 6A, in the presence of DN-PS1, although, in accord with previous studies (Wilhelmsen and van der Geer, 2004
), we did not detect a massive accumulation of the uncleaved membranal protein, very little of the CD74-ICD was released into the cytosol. To further follow the involvement of presenilin in CD74 intramembrane cleavage, we used the
-secretase/PS1 specific inhibitor, DAPT (WO 9822494). HEK 293 cells were transfected with a FL CD74 construct and incubated in the presence or absence of DAPT for 3 h. Cells were then separated into membrane and soluble fractions and analyzed for the presence of the cytoplasmic domain. As can be seen in Figure 6B, although we did not detect a massive accumulation of the uncleaved membranal protein, a dramatic inhibition of CD74-ICD release was detected in DAPT-treated cells.
|
Recently, the presenilin-related aspartic protease, SPP, was described (Weihofen et al., 2002
). Like presenilins, SPP contains the aspartic protease motifs, YD and LGLGD. The striking difference between SPP and presenilins is the opposite topology of the transmembrane regions that they cleave. Therefore it was suggested that each particular I-CLiP only attacks substrates of one particular orientation, e.g., either type I or type II, but not both (Weihofen and Martoglio, 2003
; Nyborg et al., 2004
). Because CD74 is a type II protein, the involvement of SPP and not presenilin in its intramembrane cleavage was expected. We therefore attempted to inhibit CD74 cleavage using the specific SPP inhibitor, (Z-LL)2 ketone (Weihofen et al., 2000
; Weihofen and Martoglio, 2003
). It was previously shown that the (Z-LL)2 ketone can also inhibit cathepsin S (Weihofen et al., 2000
), an enzyme that is involved in CD74 processing in the endocytic compartment. Our studies show here that processing in the endocytic compartments regulates CD74-ICD release; therefore, the effect of (Z-LL)2 ketone was studied on the truncated CD74 amino acid 182 fragment, which is the final product of CD74 processing in the endocytic compartments and not a substrate for cathepsin S. HEK 293 cells were transfected with the 182 myc construct and incubated in the presence or absence of DAPT or (Z-LL)2 ketone. Cells were then separated into membrane and soluble fractions and analyzed for the presence of the cytoplasmic domain. As shown in Figure 6C, although DAPT dramatically downregulated CD74-ICD release, (Z-LL)2 ketone did not inhibit the release of this fragment. Thus, these data suggest that the cleavage reaction is apparently mediated by the
-secretase/presenilin complex.
|
-secretase/presenilin complex but rather by enzymes that cleave type II-oriented membrane-spanning segments. However, although we cannot detect accumulation of the uncleaved membrane protein, we do observe a dramatic inhibition in the release of CD74-ICD in the presence of DAPT. We believe that future experiments, possibly in the presence of even more specific inhibitors will clarify this issue.
CD74-ICD Translocates to the Nucleus
CD74-ICD activates NF-
B-mediated transcription via its effect on the transactivation domain of p65/RelA, while having no effect on the nuclear translocation of p65 (Matza et al., 2001
). To determine whether CD74-ICD translocates to the nucleus, we searched for the presence of CD74-ICD in this compartment.
We have previously shown that CD74 cleavage occurs at amino acids 4244. Moreover, the 142 truncated construct (tagged with Myc epitope, 142 myc, Figure 1) was shown to induce NF-
B activation and B-cell maturation (Matza et al., 2002
). Thus, to determine whether CD74-ICD translocates to the nucleus, we followed the subcellular localization of the 142 construct. To this end, we analyzed the localization of 142 myc construct (Figure 1) in HEK 293-transfected cells by indirect immunofluorescent staining with IN1 antibody (which recognizes the cytosolic domain of CD74). As can be seen in Figure 7A, although the 182 molecule is mostly detected in the cytosol, the 142 fragment, in contrast, exhibited apparent nuclear staining, along with cytosolic staining, suggesting that at least a portion of the CD74 ICD enters the nuclear compartment. To confirm this result, we performed a full biochemical fractionation of 293 cells, transfected with the 142 construct. In this procedure, the nuclei are precipitated from the disrupted cells by low-speed centrifugation and proteins are extracted from them by high-salt treatment, and the supernatant is separated into membrane and cytosol fractions by 100,000 x g centrifugation. As seen in Figure 7B, the 142 fragment was dispersed in the membrane, nuclear debris, cytosolic and nuclear fractions, indicating that CD74-ICD translocates to the nucleus.
To determine whether this nuclear import is essential for the functionality of CD74-ICD, a nuclear localization signal was conjugated to the 142 fragment, creating the 142 nuc construct (Figure 8A). As a control, an additional construct was generated, CD74 142 linked to a mitochondrial targeting signal (142 mito; Figure 8A). The predicted localization of each construct was verified by immunofluorescence of transfected cells using IN1 antibody (Figure 8B). Indeed, 142 nuc was found almost totally in the nucleus, whereas the staining of 142 mito-transfected cells showed mitochondrial-like appearance.
|
B activity we cotransfected the luciferase reporter plasmid described above. As can be seen in Figure 8C, the mitochondrial construct was unable to induce NF-
B activity. Moreover, both 142 and 142 nuc constructs increased the activity of the reported gene, with the 142 nuc construct much more active than unmodified 142. Thus, targeting of the 142 fragment to the nucleus brings the released fragment to its site of function, resulting in the elevated induction of NF-
B activity. | DISCUSSION |
|---|
|
|
|---|
In general, in most of RIP cases reported, cleavage proceeds in a two-step sequential proteolytic process. The first step involves the cleavage of the extracytoplasmic segment to shorten the ectodomain to <30 aa. This seems to be a requirement for the second proteolytic event, which occurs at the transmembrane domain. It appears that the initial shedding prepares the substrate for the intramembrane proteolysis such that the transmembrane region becomes accessible to the second protease, which releases the product from the lipid bilayer toward the cytosol. This mechanism, when regulated, guarantees controlled proteolysis in the plane of the membrane and prevents random degradation of membrane proteins (Brown et al., 2000
; Hoppe et al., 2001
; Urban and Freeman, 2002
).
Some common features of RIP have shown remarkable similarities to the behavior of CD74. CD74 undergoes several proteolytic events in the endocytic compartments, resulting in the removal of the bulk of the lumenal domain and formation of a membrane-bound 182 truncated protein (Stumptner-Cuvelette and Benaroch, 2002
). Here, we show that arrival to the endocytic compartments and a series of proteolytic cleavages in these compartments are necessary for the release of CD74-ICD from the membrane. Thus, blocking the arrival to the endocytic compartments and inhibitors that block the proteolytic events there arrest the cleavage event. Moreover, analysis of CD74 truncated constructs that represent various proteolytic products of the CD74 lumenal domain, including naturally processed CD74 fragments, indicate that the shedding of the lumenal domain in the endocytic compartments prepares the molecule for its transmembrane cleavage, which is essential for the activation of NF-
B. Once the CD74 lumenal domain has been removed, CD74 can serve as a substrate for I-CLiP cleavage, a process that occurs exclusively in the endocytic compartments. Thus, transport to the endocytic compartment is essential for both CD74 processing and for its intramembrane cleavage. The removal of the CD74 lumenal domain therefore appears to be the first step required for the release of the N-terminal cytosolic fragment, leading to NF-
B activation. To further understand the transcriptional function of CD74, it will be essential to determine whether the ectodomain shedding of CD74, like other RIP proteins, is signal dependent.
In most RIP proteins, the released cytosolic fragments translocate to the nucleus to elicit their biological responses. We therefore searched for the presence of CD74-ICD in the nucleus, by following the cellular localization of the aa 142 fragment. The immunostaining and biochemical fractionation of cells transfected with the 142 construct have revealed that this fragment can be detected in the various fractions, membrane, cytosolic and nuclear, confirming that CD74-ICD is released from the membrane to the cytosol and that a portion of this proteolytic product translocates to the nucleus.
Finally, to determine whether nuclear translocation is essential for the functionality of CD74 in NF-
B activation, we followed the activity of NLS-tagged CD74-ICD. Although amino acids 142 were distributed in the cytosol and the nucleus, NLS-tagged CD74-ICD was found mostly in the nucleus. This peptide was found to be far more active in elevation of NF-
B-mediated transcription than the naturally distributed 142. This effect on NF-
B activity was directed to the transactivation domain of p65, as was previously shown for CD74 and CD74-ICD (Matza et al., 2001
, 2002
). Taken together, these results show that translocation of CD74-ICD to the nucleus is essential for its modulation of p65 transactivation function, suggesting that CD74-ICD indeed acts in the nucleus.
To conclude, our studies add CD74 to the growing family of RIP proteins and show that the roles of CD74 as a chaperone and as a signaling molecule are intertwined in a tightly regulated chain of command.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
* These authors contributed equally to this work. ![]()
Address correspondence to: Idit Shachar (idit.shachar{at}weizmann.ac.il).
| REFERENCES |
|---|
|
|
|---|
Benlagha, K., Park, S. H., Guinamard, R., Forestier, C., Karlsson, L., Chang, C. H., and Bendelac, A. ((2004). ). Mechanisms governing B cell developmental defects in invariant chain-deficient mice. J. Immunol. 172, , 20762083.
Brown, M. S., Ye, J., Rawson, R. B., and Goldstein, J. L. ((2000). ). Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans. Cell 100, , 391398.[CrossRef][Medline]
de Duve, C., de Barsy, T., Poole, B., Trouet, A., Tulkens, P., and Van Hoof, F. ((1974). ). Lysosomotropic agents. Biochem. Pharmacol. 23, , 24952531.[CrossRef][Medline]
de Melker, A. A., van der Horst, G., Calafat, J., Jansen, H., and Borst, J. ((2001). ). c-Cbl ubiquitinates the EGF receptor at the plasma membrane and remains receptor associated throughout the endocytic route. J. Cell Sci. 114, , 21672178.
De Strooper, B., Saftig, P., Craessaerts, K., Vanderstichele, H., Guhde, G., Annaert, W., Von Figura, K., and Van Leuven, F. ((1998). ). Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature 391, , 387390.[CrossRef][Medline]
Dinter, A., and Berger, E. G. ((1998). ). Golgi-disturbing agents. Histochem. Cell Biol. 109, , 571590.[CrossRef][Medline]
Erickson, A. H., and Blobel, G. ((1979). ). Early events in the biosynthesis of the lysosomal enzyme cathepsin D. J. Biol. Chem. 254, , 1177111774.
Flaishon, L., Hershkovitz, R., Lantner, F., Lider, O., Alon, R., Levo, Y., Flavell, R. A., and Shachar, I. ((2000). ). Autocrine secretion of interferon g negatively regulates homing of immature B cells. J. Exp. Med. 192, , 13811387.
Gur, G. et al. ((2004). ). LRIG1 restricts growth factor signaling by enhancing receptor ubiquitylation and degradation. EMBO J. 23, , 32703281.[CrossRef][Medline]
Haass, C., and Steiner, H. ((2002). ). Alzheimer disease gamma-secretase: a complex story of GxGD-type presenilin proteases. Trends Cell Biol. 12, , 556562.[CrossRef][Medline]
Hoppe, T., Rape, M., and Jentsch, S. ((2001). ). Membrane-bound transcription factors: regulated release by RIP or RUP. Curr. Opin. Cell Biol. 13, , 344348.[CrossRef][Medline]
Klausner, R. D., Donaldson, J. G., and Lippincott-Schwartz, J. ((1992). ). Brefeldin A: insights into the control of membrane traffic and organelle structure. J. Cell Biol. 116, , 10711080.
Kopan, R., and Goate, A. ((2000). ). A common enzyme connects notch signaling and Alzheimer's disease. Genes Dev. 14, , 27992806.
Lammich, S., Okochi, M., Takeda, M., Kaether, C., Capell, A., Zimmer, A. K., Edbauer, D., Walter, J., Steiner, H., and Haass, C. ((2002). ). Presenilin-dependent intramembrane proteolysis of CD44 leads to the liberation of its intracellular domain and the secretion of an Abeta-like peptide. J. Biol. Chem. 277, , 4475444759.
Lemberg, M. K., and Martoglio, B. ((2004). ). On the mechanism of SPP-catalysed intramembrane proteolysis; conformational control of peptide bond hydrolysis in the plane of the membrane. FEBS Lett. 564, , 213218.[CrossRef][Medline]
Leng, L., Metz, C. N., Fang, Y., Xu, J., Donnelly, S., Baugh, J., Delohery, T., Chen, Y., Mitchell, R. A., and Bucala, R. ((2003). ). MIF signal transduction initiated by binding to CD74. J. Exp. Med. 197, , 14671476.
Levkowitz, G., Waterman, H., Zamir, E., Kam, Z., Oved, S., Langdon, W. Y., Beguinot, L., Geiger, B., and Yarden, Y. ((1998). ). c-Cbl/Sli-1 regulates endocytic sorting and ubiquitination of the epidermal growth factor receptor. Genes Dev. 12, , 36633674.
Lotteau, V., Teyton, L., Peleraux, A., Nilsson, T., Karlsson, L., Schmid, S. L., Quaranta, V., and Peterson, P. A. ((1990). ). Intracellular transport of class II MHC molecules directed by invariant chain. Nature 348, , 600605.[CrossRef][Medline]
Marambaud, P. et al. ((2002). ). A presenilin-1/gamma-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions. EMBO J. 21, , 19481956.[CrossRef][Medline]
Matza, D., Kerem, A., Lantner, F., and Shachar, I. ((2002). ). Invariant chain induced B cell differentiation requires intramembraneproteolytic release of the cytosolic domain. Immunity 17, , 549560.[CrossRef][Medline]
Matza, D., Wolstein, O., Dikstein, R., and Shachar, I. ((2001). ). Invariant chain induces B cell maturation by activating TAFII105-NF-kB dependent transcription program. J. Biol. Chem. 276, , 2720327206.
Murakami, D., Okamoto, I., Nagano, O., Kawano, Y., Tomita, T., Iwatsubo, T., De Strooper, B., Yumoto, E., and Saya, H. ((2003). ). Presenilin-dependent gamma-secretase activity mediates the intramembranous cleavage of CD44. Oncogene 22, , 15111516.[CrossRef][Medline]
Naruse, S. et al. ((1998). ). Effects of PS1 deficiency on membrane protein trafficking in neurons. Neuron 21, , 12131221.[CrossRef][Medline]
Naujokas, M. F., Morin, M., Anderson, M. S., Peterson, M., and Miller, J. ((1993). ). The chondroitin sulfate form of invariant chain can enhance stimulation of T cell responses through interaction with CD44. Cell 74, , 257268.[CrossRef][Medline]
Ni, C. Y., Murphy, M. P., Golde, T. E., and Carpenter, G. ((2001). ). gamma-Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294, , 21792181.
Nishihira, J., Ishibashi, T., Fukushima, T., Sun, B., Sato, Y., and Todo, S. ((2003). ). Macrophage migration inhibitory factor (MIF): its potential role in tumor growth and tumor-associated angiogenesis. Ann. NY Acad. Sci. 995, , 171182.[CrossRef][Medline]
Nyborg, A. C., Jansen, K., Ladd, T. B., Fauq, A., and Golde, T. E. ((2004). ). A signal peptide peptidase (SPP) reporter activity assay based on the cleavage of type II membrane protein substrates provides further evidence for an inverted orientation of the SPP active site relative to presenilin. J. Biol. Chem. 279, , 4314843156.
Odorizzi, C. G., Trowbridge, I. S., Xue, L., Hopkins, C. R., Davis, C. D., and Collawn, J. F. ((1994). ). Sorting signals in the MHC class II invariant chain cytoplasmic tail and transmembrane region determine trafficking to an endocytic processing compartment. J. Cell Biol. 126, , 317330.
Pieters, J., Bakke, O., and Dobberstein, B. ((1993). ). The MHC class II-associated invariant chain contains two endosomal targeting signals within its cytoplasmic tail. J. Cell Sci. 106, , 831846.[Abstract]
Pond, L., Kuhn, L. A., Teyton, L., Schutze, M. P., Tainer, J. A., Jackson, M. R., and Peterson, P. A. ((1995). ). A role for acidic residues in di-leucine motif-based targeting to the endocytic pathway. J. Biol. Chem. 270, , 1998919997.
Schagger, H., and von Jagow, G. ((1987). ). Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, , 368379.[CrossRef][Medline]
Shachar, I., Elliot, E. A., Chasnoff, B., Grewal, I. S., and Flavell, R. A. ((1995). ). Reconstitution of invariant chain function in transgenic mice in vivo by individual p31 and p41 isoforms. Immunity 3, , 373383.[CrossRef][Medline]
Shachar, I., and Flavell, R. A. ((1996). ). Requirement for invariant chain in B cell maturation and function. Science 274, , 106108.
Stumptner-Cuvelette, P., and Benaroch, P. ((2002). ). Multiple roles of the invariant chain in MHC class II function. Biochim. Biophys. Acta 1542, , 113.[Medline]
Urban, S., and Freeman, M. ((2002). ). Intramembrane proteolysis controls diverse signaling pathways throughout evolution. Curr. Opin. Genet. Dev. 12, , 512518.[CrossRef][Medline]
Villadangos, J. A., Riese, R. J., Peters, C., Chapman, H. A., and Ploegh, H. L. ((1997). ). Degradation of mouse invariant chain: roles of cathepsins S and D and the influence of major histocompatibility complex polymorphism. J. Exp. Med. 186, , 549560.
Wang, X., Sato, R., Brown, M. S., Hua, X., and Goldstein, J. L. ((1994). ). SREBP-1, a membrane-bound transcription factor released by sterol-regulated proteolysis. Cell 77, , 5362.[CrossRef][Medline]
Weihofen, A., Binns, K., Lemberg, M. K., Ashman, K., and Martoglio, B. ((2002). ). Identification of signal peptide peptidase, a presenilin-type aspartic protease. Science 296, , 22152218.
Weihofen, A., Lemberg, M. K., Friedmann, E., Rueeger, H., Schmitz, A., Paganetti, P., Rovelli, G., and Martoglio, B. ((2003). ). Targeting presenilin-type aspartic protease signal peptide peptidase with gamma-secretase inhibitors. J. Biol. Chem. 278, , 1652816533.
Weihofen, A., Lemberg, M. K., Ploegh, H. L., Bogyo, M., and Martoglio, B. ((2000). ). Release of signal peptide fragments into the cytosol requires cleavage in the transmembrane region by a protease activity that is specifically blocked by a novel cysteine protease inhibitor. J. Biol. Chem. 275, , 3095130956.
Weihofen, A., and Martoglio, B. ((2003). ). Intramembrane-cleaving proteases: controlled liberation of proteins and bioactive peptides. Trends Cell Biol. 13, , 7178.[CrossRef][Medline]
Wilhelmsen, K., and van der Geer, P. ((2004). ). Phorbol 12-myristate 13-acetate-induced release of the colony-stimulating factor 1 receptor cytoplasmic domain into the cytosol involves two separate cleavage events. Mol. Cell. Biol. 24, , 454464.
This article has been cited by other articles:
![]() |
J. L. Martin-Ventura, J. Madrigal-Matute, B. Munoz-Garcia, L. M. Blanco-Colio, M. Van Oostrom, G. Zalba, A. Fortuno, C. Gomez-Guerrero, L. Ortega, A. Ortiz, et al. Increased CD74 expression in human atherosclerotic plaques: contribution to inflammatory responses in vascular cells Cardiovasc Res, June 4, 2009; (2009) cvp141v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Stein, M. R. Smith, S. Chen, M. Zalath, and D. M. Goldenberg Combining Milatuzumab with Bortezomib, Doxorubicin, or Dexamethasone Improves Responses in Multiple Myeloma Cell Lines Clin. Cancer Res., April 15, 2009; 15(8): 2808 - 2817. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gelin, I. Sloma, D. Charron, and N. Mooney Regulation of MHC II and CD1 antigen presentation: from ubiquity to security J. Leukoc. Biol., February 1, 2009; 85(2): 215 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Sanchez-Nino, A. B. Sanz, P. Ihalmo, M. Lassila, H. Holthofer, S. Mezzano, C. Aros, P.-H. Groop, M. A. Saleem, P. W. Mathieson, et al. The MIF Receptor CD74 in Diabetic Podocyte Injury J. Am. Soc. Nephrol., February 1, 2009; 20(2): 353 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Elzinga, C. Twomey, J. C. Powell, F. Harte, and J. V. McCarthy Interleukin-1 Receptor Type 1 Is a Substrate for {gamma}-Secretase-dependent Regulated Intramembrane Proteolysis J. Biol. Chem., January 16, 2009; 284(3): 1394 - 1409. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Szaszak, H.-D. Chen, H.-C. Chen, A. Baukal, L. Hunyady, and K. J Catt Identification of the invariant chain (CD74) as an angiotensin AGTR1-interacting protein J. Endocrinol., November 1, 2008; 199(2): 165 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ye, X. Liu, S. N. Rout, Z. Li, Y. Yan, L. Lu, T. Kamala, N. K. Nanda, W. Song, S. K. Samal, et al. The MHC Class II-Associated Invariant Chain Interacts with the Neonatal Fc{gamma} Receptor and Modulates Its Trafficking to Endosomal/Lysosomal Compartments J. Immunol., August 15, 2008; 181(4): 2572 - 2585. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gore, D. Starlets, N. Maharshak, S. Becker-Herman, U. Kaneyuki, L. Leng, R. Bucala, and I. Shachar Macrophage Migration Inhibitory Factor Induces B Cell Survival by Activation of a CD74-CD44 Receptor Complex J. Biol. Chem., February 1, 2008; 283(5): 2784 - 2792. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Huang, D. T. Cai, R. Y. R. Chua, D. M. Kemeny, and S. H. Wong Nitric-oxide Synthase 2 Interacts with CD74 and Inhibits Its Cleavage by Caspase during Dendritic Cell Development J. Biol. Chem., January 18, 2008; 283(3): 1713 - 1722. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hussain, C. Wesley, M. Khalid, A. Chaudhry, and S. Jameel Human Immunodeficiency Virus Type 1 Vpu Protein Interacts with CD74 and Modulates Major Histocompatibility Complex Class II Presentation J. Virol., January 15, 2008; 82(2): 893 - 902. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lantner, D. Starlets, Y. Gore, L. Flaishon, A. Yamit-Hezi, R. Dikstein, L. Leng, R. Bucala, Y. Machluf, M. Oren, et al. CD74 induces TAp63 expression leading to B-cell survival Blood, December 15, 2007; 110(13): 4303 - 4311. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Stein, M. J. Mattes, T. M. Cardillo, H. J. Hansen, C.-H. Chang, J. Burton, S. Govindan, and D. M. Goldenberg CD74: A New Candidate Target for the Immunotherapy of B-Cell Neoplasms Clin. Cancer Res., September 15, 2007; 13(18): 5556s - 5563s. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Binsky, M. Haran, D. Starlets, Y. Gore, F. Lantner, N. Harpaz, L. Leng, D. M. Goldenberg, L. Shvidel, A. Berrebi, et al. IL-8 secreted in a macrophage migration-inhibitory factor- and CD74-dependent manner regulates B cell chronic lymphocytic leukemia survival PNAS, August 14, 2007; 104(33): 13408 - 13413. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Starlets, Y. Gore, I. Binsky, M. Haran, N. Harpaz, L. Shvidel, S. Becker-Herman, A. Berrebi, and I. Shachar Cell-surface CD74 initiates a signaling cascade leading to cell proliferation and survival Blood, June 15, 2006; 107(12): 4807 - 4816. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||