![]() |
|
|
Vol. 16, Issue 11, 5269-5282, November 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


* Division of Biology, California Institute of Technology, Pasadena, CA 91125;
Max Planck Institute of Molecular Cell Biology and Genetics, 01307 Dresden, Germany
Submitted July 25, 2005;
Revised August 25, 2005;
Accepted August 29, 2005
Monitoring Editor: Mark Solomon
| ABSTRACT |
|---|
|
|
|---|
, replication protein A, and two replication factor C complexes on chromatin. The RFID contains two basic patches (BP1 and BP2) at amino acids 265331 and 470600, respectively. Deletion of either BP1 or BP2 compromises optimal binding of Claspin to chromatin. Absence of BP1 has no effect on the ability of Claspin to mediate activation of Chk1. By contrast, removal of BP2 causes a large reduction in the Chk1-activating potency of Claspin. We also find that Claspin contains a small Chk1-activating domain (residues 776905) that does not bind stably to chromatin, but it is fully effective at high concentrations for mediating activation of Chk1. These results indicate that stable retention of Claspin on chromatin is not necessary for activation of Chk1. Instead, our findings suggest that only transient interaction of Claspin with replication forks potentiates its Chk1-activating function. Another implication of this work is that stable binding of Claspin to chromatin may play a role in other functions besides the activation of Chk1. | INTRODUCTION |
|---|
|
|
|---|
Checkpoint pathways contain a variety of regulatory proteins that detect the status of the genome and that relay this information to effector enzymes that regulate downstream processes (Melo and Toczyski, 2002
; Osborn et al., 2002
; Sancar et al., 2004
). In the DNA replication checkpoint, ATR functions at or near the top of this regulatory hierarchy (Abraham, 2001
). ATR is a member of the phosphoinositide kinase-related family of protein kinases that also includes ATM. One key function of ATR involves activation of the checkpoint effector kinase Chk1 (Guo et al., 2000
; Hekmat-Nejad et al., 2000
; Liu et al., 2000
). Significantly, ATR cannot carry out this function alone but must cooperate with numerous other proteins. For example, ATR possesses a conserved binding partner called ATRIP (Cortez et al., 2001
). Other collaborating factors include the checkpoint clamp assembly of Rad9, Rad1, and Hus1 (the 9-1-1 complex) (Sancar et al., 2004
). A checkpoint clamp loader consisting of Rad17 and the four small subunits of replication factor C (RFC) is responsible for deposition of the 9-1-1 complex onto DNA. The checkpoint clamp loader and clamp proteins most likely interact with boundaries between single-stranded and double-stranded regions of DNA that would be present in incompletely replicated or damaged DNA (You et al., 2002
; Ellison and Stillman, 2003
; Lee et al., 2003
; Zou et al., 2003
).
ATR as well as ATM also work together with a class of proteins known as mediators (McGowan and Russell, 2004
; O'Connell and Cimprich, 2005
). In vertebrates, these proteins consist of Claspin and various BRCA1 C-terminal repeat (BRCT)-containing proteins, including TopBP1, 53BP1, Mdc1, and BRCA1 itself (Kumagai and Dunphy, 2000
; Canman, 2003
; Chini and Chen, 2003
). These mediators either have been shown to or are thought to serve as adaptors between ATR/ATM and the downstream kinases Chk1 and Chk2. In addition, accumulating evidence has indicated that mediator proteins may function as sensors of chromatin structures. For example, in response to double-stranded DNA breaks, mammalian 53BP1 and its fission yeast relative Crb2 recognize methylated forms of lysine 79 in histone H3 and lysine 20 in histone H4, respectively (Huyen et al., 2004
; Sanders et al., 2004
). These histone methylations do not vary in response to DNA damage. Instead, modified histones may become inappropriately exposed at sites of damage. Furthermore, 53BP1, Crb2, and other BRCT-containing proteins respond to the phosphorylation of histone H2AX and H2A in mammals and fission yeast, respectively (Celeste et al., 2003
; Nakamura et al., 2004
). This type of histone phosphorylation is not required for initial recruitment of mediator proteins to sites of damage, but it is necessary for their stable incorporation into damage-induced foci. These observations suggest that the interaction of mediator proteins with chromatin is multifaceted and may fulfill multiple functions.
We have been studying the DNA replication checkpoint in Xenopus egg extracts. In this system, the DNA replication inhibitor aphidicolin elicits the formation of stalled replication forks, which in turn trigger the activation of Xenopus Chk1 (Xchk1) (Kumagai et al., 1998
; Michael et al., 2000
). The Xenopus homologue of ATR (Xatr) is responsible for the phosphorylation-dependent activation of Xchk1 (Guo et al., 2000
; Hekmat-Nejad et al., 2000
). This process also requires the mediator protein Claspin in Xenopus egg extracts and human cells (Kumagai and Dunphy, 2000
; Chini and Chen, 2003
; Lin et al., 2004
). Claspin associates directly with Xchk1 and thereupon strongly enhances the ability of Xatr to phosphorylate Xchk1 (Kumagai and Dunphy, 2003
; Kumagai et al., 2004
). In addition, Claspin displays dynamic spatial localization by associating with replication forks during S phase (Lee et al., 2003
). This binding requires Xcdc45 and Cdk2 but not replication protein A (RPA), suggesting that Claspin associates with incipient replication forks at around the time of DNA unwinding (Lee et al., 2003
). The initial binding of Claspin occurs before Xatr-Xatrip and the replication factor C (RFC) proteins and therefore must involve, at least in part, chromatin structures that are distinct from those recognized by these proteins. The budding yeast homologue of Claspin called Mrc1 likewise associates specifically with replication forks (Katou et al., 2003
; Osborn and Elledge, 2003
). These observations imply that Claspin and its homologues may also function as checkpoint sensor proteins.
In this study, we have explored the mechanism by which Claspin associates with the DNA replication apparatus to understand the purpose of this interaction. Our results indicate that Claspin uses a conserved domain to interact with key replication and checkpoint proteins, including Cdc45, DNA polymerase
(Pol
), RPA, and both the replicative and Rad17-containing RFC complexes. Interestingly, although a portion of this domain is required for optimal activation of Chk1, stable retention of Claspin on chromatin is not essential for its Chk1-activating function.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
Antibodies against Xenopus Claspin, RPA70, Xorc2, phospho-Ser864 of Claspin, Xatr, Xatrip, Xchk1, Xrad17, and Xhus1 were described previously (Kumagai and Dunphy, 2003
; Lee et al., 2003
; Kumagai et al., 2004
). Antibodies against Xenopus RFC40 and proliferating cell nuclear antigen (PCNA) were raised against bacterially expressed His6-tagged proteins containing either residues 1320 of RFC40 or full-length PCNA, respectively. The sequence of Xenopus RFC40 (expressed sequence tag database XGI TC34364) showed 89.6% identity at the amino acid level with human RFC40. Anti-Xcdc45 and anti-p60 of Pol
antibodies were raised as described previously (Mimura and Takisawa, 1998
; Waga et al., 2001
). These antibodies were all affinity-purified with their antigens. Antisera against Xenopus importin
, Xenopus Pol
(p125 subunit), Xsld5, Xenopus cyclin E, and Xmcm7 were generously supplied by D. Görlich (Universität Heidelberg, Heidelberg, Germany), S. Waga (Osaka University, Osaka, Japan), H. Takisawa (Osaka University, Osaka, Japan), P. Jackson (Stanford University, Stanford, CA), and J. Blow (University of Dundee, Dundee, Scotland, United Kingdom), respectively. Antisera against human RFC37 and Xenopus RFC140 were the kind gifts of J. Hurwitz (Memorial Sloan-Kettering Cancer Center, New York, NY) and S. Waga, respectively. Anti-human Chk1 phospho-Ser345 antibody was purchased from Cell Signaling Technology (Beverly, MA). Purified control rabbit IgG and anti-FLAG monoclonal antibodies were obtained from Zymed Laboratories (South San Francisco, CA) and Sigma-Aldrich (St. Louis, MO), respectively. Immunodepletion procedures for Claspin, Xcdc45, and RPA were described previously (Lee et al., 2003
).
Recombinant Proteins
The pBluescript vector was engineered to encode a nuclear localization signal (NLS) (TPPKKKRKVEDP) (Moore et al., 2002
) fused upstream of Claspin fragments for in vitro protein synthesis. The same NLS was inserted into pGEX-4T-3 (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) to make glutathione S-transferase (GST)-NLS fusion constructs of Claspin. Baculoviruses encoding full-length or truncated His6-Claspin-FLAG proteins were generated with the Bac-to-Bac system with a His6 tag and FLAG epitope (DYKDDDDK) at the N-terminal and C-terminal ends, respectively. Various Claspin mutants (internal deletions or amino acid substitutions) were produced through PCR-based mutagenesis by standard methods. Recombinant Claspin proteins were expressed and purified from baculovirus-infected insect cells or bacteria as described previously (Kumagai and Dunphy, 2003
). 35S-labeled proteins were synthesized in vitro with the TnT system (Promega, Madison, WI). Human GST-p27 (gift from T. Hunter, Salk Institute, La Jolla, CA) was expressed in bacteria and purified with glutathione agarose.
Identification of Claspin-binding Proteins from Egg Extracts
Claspin was immunoprecipitated from 5 ml of interphase egg extract with 200 µg of anti-Claspin antibodies cross-linked to Affiprep protein-A beads (Bio-Rad, Hercules, CA). The beads were washed four times with immunoprecipitation (IP) buffer B (10 mM HEPES-KOH, pH 7.6, 0.5 M NaCl, 0.1% NP-40, and 20 mM
-glycerolphosphate). Samples were boiled in SDS buffer, concentrated, separated by SDS-PAGE, transferred to nitrocellulose, and stained with Ponceau S. Protein bands containing p55 and p90 were excised and subjected to chemical sequencing and nanoelectrospray tandem mass spectrometry in the Howard Hughes Medical Institute protein sequencing facility at University of California (Berkeley, CA). Sequences from p55 (KXTQH/AP and KYFXGEEA) and p90 (KFYAK and KTLATWATK) corresponded to importin
and
, respectively.
Identification of Claspin-binding Proteins in Chromatin Eluates
For analytical experiments, sperm nuclei reconstituted in interphase egg extract (1 ml) were collected through a sucrose cushion (Lee et al., 2003
). Nuclei were resuspended in 100 µl of HEPES-buffered saline (10 mM HEPES-KOH, pH 7.6, and 150 mM NaCl) supplemented with 10% dimethyl sulfoxide and 5 mM caffeine, incubated at room temperature for 30 min, and cooled on ice for 20 min. An equal volume of elution buffer (10 mM HEPES-KOH, pH 7.6, 1 M NaCl, and 1% NP-40) was added, and the incubation was continued on ice for 20 min. After dilution with 200 µl of 10 mM HEPES-KOH, pH 7.6, soluble proteins were recovered by centrifugation at 14,000 rpm in an Eppendorf centrifuge for 10 min. Antibodies (2.5 µg) cross-linked to protein A beads were incubated with these preparations for 1 h at 4°C, washed twice with IP buffer C (10 mM HEPES-KOH, pH 7.6, 150 mM NaCl, 0.1% CHAPS, 2.5 mM EGTA, and 20 mM
-glycerolphosphate), and subjected to SDS-PAGE.
For identification by protein sequencing, four batches of egg extract totaling 50 ml were used to reconstitute nuclei (3000/µl) in the presence of aphidicolin and caffeine. Proteins were removed from chromatin by elution with 0.5 M NaCl and immunoprecipitated with anti-Claspin antibodies as described above. Bound proteins were concentrated, separated by SDS-PAGE, stained with Coomassie Blue, and subjected to in-gel trypsin digestion as described previously (Shevchenko et al., 1996
). Methods for nanoelectrospray tandem mass spectrometry of tryptic peptides and analysis of the sequencing data were carried out exactly as described previously (Shevchenko et al., 2001
, 2003
; Yoo et al., 2004
). The following protein identifications were obtained: p180 (Claspin, 10 peptides), p150 (RFC140, 3 peptides), and p65 (RPA70, 3 peptides). p36-40 contained RFC36 (2 peptides), RFC37 (5 peptides), RFC38 (2 peptides), and RFC40 (5 peptides).
Oligonucleotide Binding Assay
Preparation of magnetic beads coated with DNA oligonucleotides and assay conditions for binding of proteins in egg extracts to these beads were described previously (Lee et al., 2003
). For the double-stranded template, annealed (dA)70-(dT)70 was prepared as described previously (Kumagai and Dunphy, 2000
). For the 30d-40s branched DNA, the following oligonucleotides were annealed: 5'-ACTGATTACGGTGCTGCTTATCGATGGTTTGCAGTGCTCGCATGGAGCTGGTTTCCGGCCTTGCTAATGG and 5'-biotin-CCATTAGCAAGGCCGGAAACCAGCTCCATGATCATTGGCAATCATTGGCACAACGATCAGCCAACTAAAC. Oligonucleotides were added to egg extracts at a final concentration of 5.5 nM.
| RESULTS |
|---|
|
|
|---|
and
, respectively (see Materials and Methods). The binding of importin
was verified by immunoblotting with anti-importin
antibodies (Figure 1A). These proteins could not be found in anti-Claspin immunoprecipitates from nuclear extracts (see below), which is consistent with the fact that importins dissociate from their cargo upon nuclear entry. In further studies, we found that importin
binds well to a GST peptide containing the C-terminal 56 amino acids of Claspin (residues 12301285), which contains sequences that closely resemble a NLS (our unpublished data).
|
Next, we assessed different methods for immunoprecipitation of the chromatin-derived form of Claspin. Some commonly used techniques, such as nuclease digestion or sonication of the chromatin before immunoprecipitation, resulted in anti-Claspin immunoprecipitates that were contaminated by general DNA binding proteins. We concluded that these methods yielded chromatin fragments that were large enough to bridge Claspin nonspecifically with other proteins during immunoprecipitation. As an alternative, we attempted to extract Claspin from chromatin by mild salt treatment under conditions that would maintain certain proteinprotein interactions that had initially formed on the DNA. For this purpose, we exposed chromatin to increasing concentrations of NaCl (i.e., 0.25, 0.5, 0.75, and 1 M). As shown in Figure 1B, treatment with 0.25 M NaCl led to a substantial decrease in chromatin-bound Claspin, and 0.5 M NaCl removed Claspin almost completely. Various replication and checkpoint regulatory proteins, including Xorc2, Xmcm7, Xcdc45, RPA70, RFC40, PCNA, Xatr, and Xhus1, each displayed their own characteristic salt elution profile.
We immunoprecipitated Claspin from the salt eluates and immunoblotted for various key replication and checkpoint proteins. We could readily detect Xcdc45, RPA70, and RFC40 in the anti-Claspin immunoprecipitates from the 0.5 M NaCl eluate, and, to a lesser extent, in the 0.75 M eluate (Figure 1B). The interaction between Claspin and RFC40 was very strong, remaining even in the presence of 1 M NaCl. It has been established that Xcdc45, Claspin, and Pol
load onto replication origins around the same time (Mimura et al., 2000
; Lee et al., 2003
). Therefore, we also immunoblotted the anti-Claspin immunoprecipitates with anti-Pol
antibodies, but we could detect only a very faint signal for Pol
in the 0.5 and 0.75 M NaCl eluates (our unpublished data). However, we were able to demonstrate an interaction between Claspin and Pol
by a different method (see below). We could not detect the specific presence of Pol
or Pol
in anti-Claspin immunoprecipitates by immunoblotting with anti-Pol
or anti-Pol
antibodies (our unpublished data). Finally, we could not find Xatr, Xhus1, Xorc2, Xmcm7, or PCNA in anti-Claspin immunoprecipitates from any of the salt eluates. These observations argue that our procedure detects specific proteinprotein interactions that become established on chromatin. Furthermore, the absence of abundant DNA binding proteins such as Xorc2 indicates that these immunoprecipitates do not contain DNA fragments with contaminating proteins.
To identify Claspin-binding proteins in a more general manner, we analyzed anti-Claspin immunoprecipitates by silver staining (Figure 1C). We observed specifically associated bands at 150, 140, and 65 kDa as well as a cluster of bands at 3640 kDa. Analysis by nanoelectrospray tandem mass spectrometry indicated that p150 and p65 correspond to the largest subunits of RFC (RFC140) and RPA (RPA70), respectively. In addition, p36-40 contained all four small subunits of RFC (e.g., RFC36, RFC37, RFC38, and RFC40). p140 is still under investigation. We verified these associations by immunoblotting anti-Claspin immunoprecipitates with specific antibodies that recognize the Xenopus versions of RFC140 and RPA70 (Figure 1D). We could also detect the presence of RFC37 and RFC40 by immunoblotting with antibodies against these proteins. Because the small RFC subunits are also present in other clamp loader complexes, such as the one containing Rad17, we asked whether Claspin could also associate with Rad17. As shown in Figure 1D, Xrad17 could also be found in anti-Claspin immunoprecipitates from chromatin by immunoblotting with anti-Xrad17 antibodies.
Claspin Interacts Successively with Xcdc45 and RFC Complexes
To corroborate these results, we carried out various reciprocal immunoprecipitation experiments. First, we asked whether complexes containing Xcdc45 and Claspin could also be identified by immunoprecipitation with anti-Xcdc45 antibodies. As shown in Figure 2A, we could clearly detect Claspin as well as RPA70, RFC40, and Xrad17 in anti-Xcdc45 immunoprecipitates from 0.5 M NaCl eluates of chromatin. In addition, we could find Xmcm7 and Xsld5, components of the MCM and GINS complexes, respectively, in anti-Xcdc45 immunoprecipitates of both 0.5 and 1 M NaCl chromatin eluates. Consistent with the results described above, we found Xcdc45, RPA70, RFC40, and Xrad17 in anti-Claspin immunoprecipitates that were prepared in parallel. However, we could not find either Xmcm7 or Xsld5 in anti-Claspin immunoprecipitates. Therefore, Claspin does not associate with Xcdc45 indirectly through either the MCM or GINS complexes.
|
Next, we carried out immunoprecipitations with anti-RPA70, anti-RFC40, and anti-Xrad17 antibodies. We could find Claspin in anti-RFC40 and anti-Xrad17, but not in anti-RPA70 immunoprecipitates (Figure 2B). We also performed immunoprecipitations of the chromatin eluates with antibodies against Xhus1, a component of the 9-1-1 complex. Consistent with the results obtained in the anti-Claspin immunoprecipitation studies, we could not detect any Claspin in anti-Xhus1 immunoprecipitates from chromatin eluates (Figure 2B). On the other hand, we could observe RPA70, RFC40, and Xrad17 in these immunoprecipitates. It should be noted that these results do not rule out an interaction of Claspin with the 9-1-1 complex, because it is possible that the chromatin elution procedure could disrupt such an association.
Previously, we reported that binding of Claspin to chromatin requires Xcdc45 but not RPA (Lee et al., 2003
). Moreover, it is well established that the replicative and Rad17-containing RFC complexes associate with replication forks after RPA-stabilized unwinding of the DNA (You et al., 2002
; Ellison and Stillman, 2003
; Lee et al., 2003
; Zou et al., 2003
). Therefore, we examined whether the association of Claspin with RFC proteins also requires RPA. We immunodepleted RPA from egg extracts, prepared salt eluates of chromatin fractions from these extracts, and then immunoprecipitated Claspin from these eluates. As depicted in Figure 2C, we could detect Xcdc45 but not RFC40 or Xrad17 in anti-Claspin immunoprecipitates from RPA-depleted chromatin.
To characterize these interactions further, we analyzed the binding partners of Xcdc45 in the absence of Claspin. As shown in Figure 2D, Xcdc45 could bind well to RFC40 and Xrad17 even in Claspin-depleted extracts. From these results, we conclude that Claspin interacts first with Xcdc45 at replication forks and later associates with RFC complexes after RPA-stabilized unwinding of the DNA. At this juncture, Xcdc45 also forms connections with RFC proteins, but these interactions do not require the presence of Claspin. These results, along with the fact that the interactions of Claspin with Xcdc45 versus RFC40 display different salt sensitivities, imply that Xcdc45 and RFC complexes associate with Claspin independently.
A Conserved N-Terminal Domain Mediates Interaction of Claspin with Chromatin
To assess the functional significance of the interactions with other proteins on chromatin, we attempted to map the chromatin-binding region of Claspin. Because in vitro translated 35S-Claspin bound to chromatin as efficiently as endogenous Claspin, we used 35S-labeled fragments of Claspin for the initial phase of these experiments. We incubated various truncated forms of Claspin in extracts containing aphidicolin and caffeine and compared their ability to associate with chromatin. For any fragment that did not contain the last 56 amino acids of Claspin, which are essential for nuclear uptake, we incorporated an ectopic NLS into the polypeptide chain. Because expression of individual fragments was variable, we normalized the data by examining what percentage of each fragment in nuclear fractions from the extracts could associate with chromatin.
These studies indicated that a fragment containing residues 1605 of Claspin binds exceptionally well to chromatin (Figure 3A). By contrast, various fragments from the C-terminal end of Claspin (e.g., 606-1285) showed little, if any, stable interaction with chromatin. The binding of the 1605 fragment to chromatin was sensitive to the Cdk inhibitor p27, which inhibits firing of replication origins and thus prevents binding of full-length Claspin to replication forks. Furthermore, the interaction of this fragment with chromatin depended on Xcdc45 but not on RPA (Figure 3B), as for full-length Claspin.
|
, Pol
, and Pol
. We could observe strong interaction of the 1605 fragment with Pol
, but no binding to either Pol
or Pol
. Finally, we could detect little or no binding of this fragment to Xorc2, Xcut5, Xmcm7, PCNA, and Xhus1 in immunoprecipitations with antibodies against these respective proteins. From these observations, we conclude that the ability of Claspin to interact stably with chromatin resides in the 1605 fragment. In further mapping studies, we found that removal of the N-terminal 264 residues from the 1605 fragment had no effect on chromatin-binding efficiency (Figure 3A). However, additional deletion of residues 265331 abrogated binding. Similarly, removal of residues 566605 from the opposite C-terminal end of this fragment also abolished interaction with chromatin. From these studies, we conclude that a region of Claspin stretching from residues 265605 is involved in the interaction with chromatin. To corroborate these findings, we prepared a GST fusion protein containing residues 265605 of Claspin as well as an ectopic NLS. The resulting GST-NLS-Claspin(265-605) protein could bind well to chromatin (Figure 3D). The binding was much higher in Claspin-depleted extracts. However, binding also occurred in mock-depleted extracts, where inclusion of the fragment also reduced the binding of endogenous Claspin to chromatin. Therefore, the isolated 265605 fragment of Claspin fragment seems to compete with endogenous Claspin for a finite number of binding sites in chromatin.
We named the 265605 region of Claspin the replication fork-interacting domain (RFID). Two recent studies have shown that human Claspin and its fission yeast homologue Mrc1 possess an in vitro DNA binding activity that is mediated by a DNA binding domain (DBD) (Sar et al., 2004
; Zhao and Russell, 2004
). The DBD in human Claspin (residues 149340) corresponds closely to residues 150331 of Xenopus Claspin, which overlap partially with the RFID. During our studies, we noticed an interesting structural feature of Claspin. Overall, Claspin is a very acidic protein (pI = 4.5), but it does contain four patches of basic amino acids (residues 265331, 470600, 721783, and 11571285) with a pI value >10 (Figure 3A and Supplemental Figure S1). These segments, which we denoted BP1, BP2, BP3, and BP4, are highly conserved in metazoan Claspin, and the yeast Mrc1 proteins also possess similar basic segments. Notably, BP1 and BP2 define the boundaries of the RFID.
To evaluate directly whether the RFID can account for the chromatin-binding ability of full-length Claspin, we prepared various forms of full-length 35S-labeled Claspin with mutations in this domain. We first examined relatively large deletions in the protein. Initially, we deleted BP1 (
BP1, residues 265331) and 40 amino acids encompassing the C-terminal end of BP2 (
BP2', residues 566605). Moreover, we also produced a mutant (6A) in which six residues within BP1 that are highly conserved in metazoan Claspin proteins and conserved to some extent in the yeast Mrc1 proteins were changed to alanine. As shown in Figure 3E, when we added 35S-labeled forms of the
BP1,
BP2', and 6A mutants to undepleted egg extracts that contain their full complement of endogenous Claspin, binding to chromatin was abrogated or greatly reduced. By contrast, deletion of a poorly conserved segment (residues 376425) from the center of the RFID, which we named the linker region (LK), had negligible effect on binding to chromatin (Figure 3E). Consistent with this observation, a bacterially expressed form of GST-NLS-Claspin(265-605)
LK bound well to chromatin (our unpublished data) and associated specifically with Xcdc45, Pol
, RPA, and RFC40 in chromatin immunoprecipitation experiments (Figure 3F).
The BP1 Region of Claspin Is Not Required for Activation of Chk1
Next, we sought to replace endogenous Claspin in egg extracts with various RFID mutants to assess their abilities to function in checkpoint regulation. Toward this end, we created mutations in a baculovirus-expressed version of Claspin that contains His6 and FLAG tags at the N- and C-terminal ends, respectively (His6-Claspin-FLAG). First, we focused on the BP1 region. We produced
BP1 and 6A mutants of the baculovirus-expressed protein. We also prepared a larger deletion (residues 150331) that removes all of BP1 and a block of upstream conserved sequences. The deleted region in this latter mutant corresponds to the whole DBD that was identified in human Claspin (Sar et al., 2004
). When we examined binding to chromatin in undepleted egg extracts, we observed that none of the
BP1, 6A, and
(150-331) mutants of baculovirus-expressed His6-Claspin-FLAG could bind to chromatin (Figure 4A).
|
BP1 mutant to chromatin displayed the same sensitivity to p27 as wild type Claspin (Figure 4C), which argues this mutant binds specifically to replication forks. We next examined the ability of these mutants to mediate the activation of Xchk1 in response to treatment with aphidicolin. As shown in Figure 4B, all three mutants did not show any obvious difference from wild-type Claspin in the ability to promote the phosphorylation of Xchk1. Together, these results indicate that neither BP1 nor the whole DBD region is required for activation of Xchk1. Deletion of BP1 or the DBD region does weaken the interaction of Claspin with chromatin. However, without competition from endogenous full-length Claspin, mutants lacking these sequences bind very well to chromatin, which implies that the remaining sequences of Claspin are sufficient for chromatin binding.
We have previously shown that Claspin does not bind detectably to either single-stranded or double-stranded DNA in egg extracts (Lee et al., 2003
; Kumagai et al., 2004
). More recently, it was reported that recombinant human Claspin seems to have a stronger in vitro binding activity toward branched DNA than single-stranded or double-stranded DNA (Sar et al., 2004
). Therefore, we tested directly whether endogenous Claspin in egg extracts can associate stably with branched DNA. As the template (30d-40s DNA), we annealed two 70-mers that are complementary for 30 nucleotides at one end. As shown in Figure 4D, we could not detect any binding of Claspin to either the branched 30d-40s DNA or double-stranded (dA)70-(dT)70. On the other hand, we could readily observe binding of RPA, Xatr, and Xatrip to both templates. Furthermore, addition of caffeine or immunodepletion of RPA, both of which greatly increase the binding of Claspin to chromatin in aphidicolin-containing egg extracts (Lee et al., 2003
), did not result in any binding of Claspin to either template. The concentration of Claspin in egg extracts (240 nM) (Kumagai and Dunphy, 2000
) is well over the observed Kd for in vitro binding of recombinant human Claspin to branched DNA and thus should not be a limiting factor. Together, these results suggest that endogenous Claspin in egg extracts cannot bind stably to DNA alone in egg extracts and that interaction with proteins at the replication fork is necessary for stable association with chromatin.
The BP2 Region of Claspin Potentiates Its Chk1-activating Function
To study the role of the RFID more systematically, we prepared various mutant versions of Claspin containing serial N-terminal deletions and compared their chromatin binding properties in the absence of endogenous Claspin. We performed these experiments in the presence of aphidicolin and caffeine to maximize binding, but we obtained qualitatively similar binding in the presence of aphidicolin alone (our unpublished data). As shown in Figure 5A, both Claspin(265-1285) and Claspin(332-1285), which lack part of or the entire DBD region, bind as well as full-length Claspin to chromatin. On the other hand, further deletions from the N-terminal end resulted in a dramatic drop in association with chromatin. In particular, binding of the Claspin(470-1285), Claspin(606-1285), and Claspin(774-1285) fragments was markedly reduced, although the 470-1285 fragment did reproducibly bind somewhat better than the 606-1285 and 774-1285 fragments.
|
These observations suggested that all or part of the BP2 region in Claspin (residues 470600) might be important for checkpoint signaling. To pursue this possibility, we prepared a mutant of full-length His6-Claspin-FLAG with a deletion of residues 470605 (
BP2). Consistent with the results observed for the smaller deletion of residues 566605, the
BP2 mutant could bind to chromatin in Claspin-depleted extracts but not in undepleted extracts containing endogenous Claspin (Figure 5, C and D). When we examined checkpoint regulation, we observed that aphidicolin-treated extracts containing a fivefold dilution of the
BP2 mutant showed significantly reduced phosphorylation of Xchk1 (Figure 5E). Therefore, deletion of BP2 seems to compromise the checkpoint-signaling potency of Claspin.
|
0.055x the level of endogenous Claspin (Figure 6B). By contrast, a molar concentration of the 774-1285 fragment
1.8-fold greater than that of endogenous full-length Claspin was required to elicit a similar extent of phosphorylation. Therefore, the 774-1285 fragment seems to be
33-fold less potent than full-length Claspin. To evaluate whether the 774-1285 fragment acts by a similar mechanism as full-length Claspin, we examined phosphorylation of Claspin on Ser864, which is required for phosphorylation of Xchk1 (Kumagai and Dunphy, 2003
These results imply that the C-terminal region of Claspin should contain the minimal sequences necessary to carry out the biochemical process required for the ATR-dependent phosphorylation of Xchk1. To identify these sequences, we prepared various C-terminal fragments of Claspin as fusion proteins containing GST and an ectopic NLS. The fusion constructs were designed to contain the previously identified Chk1-binding domain of Claspin (CKBD, residues 847903), in which serines 864 and 895 must be phosphorylated for binding to Xchk1 (Kumagai and Dunphy, 2003
). We could observe phosphorylation of Xchk1 in the presence of a fragment from Claspin containing residues 776956 but not an overlapping fragment containing residues 844-1170 (Figure 6D). Further analysis indicated that a 130-amino acid fragment containing amino acids 776905 is sufficient for restoring phosphorylation of Xchk1 to Claspin-depleted extracts (Figure 6, E and F). We named this fragment the Chk1-activating domain (CKAD). The CKAD, as well as the longer 776956 and 774-1285 fragments, displayed little or no binding to chromatin (Figure 6G). Importantly, however, the CKAD is considerably less potent than full-length Claspin. For example, in Figure 6E, we needed to add the CKAD fragment at a sixfold molar excess over the amount of endogenous Claspin, which is already in surplus, to observe a similar extent of Xchk1 phosphorylation.
Overall, these findings indicate that the capacity of Claspin to mediate the activation of Xchk1 resides in a small C-terminal region containing no more than 130 amino acids. However, sequences from the BP2 region greatly increase the overall potency of Claspin for activation of Xchk1. Deletion of BP2 weakens the interaction of Claspin with chromatin. On the other hand, a truncated form of Claspin (residues 470-1285) that contains BP2 does not bind stably to chromatin and nonetheless induces phosphorylation of Xchk1 as efficiently as full-length Claspin. These observations indicate that stable retention of Claspin on chromatin is not necessary for activation of Xchk1.
| DISCUSSION |
|---|
|
|
|---|
. Therefore, Claspin interacts with both essential replication proteins and a key checkpoint regulator on chromatin. Consistent with these observations, it has been reported that budding yeast Mrc1 and Cdc45 can be coimmunoprecipitated from nuclease digests of chromatin (Katou et al., 2003
|
Role of Claspin as a Checkpoint Sensor Protein
One important question in the cell cycle checkpoint field involves the issue of how cells detect the presence of incompletely replicated or damaged DNA. Numerous studies in recent years have suggested that cells use a combinatorial mechanism to detect and discriminate between arrays of checkpoint-triggering signals (Sancar et al., 2004
). Mediator proteins such as Claspin and the BRCT-containing proteins can provide additional modes of discrimination to checkpoint-sensing mechanisms, and indeed they may be crucial for cells to distinguish between different checkpoint-inducing signals. The fact that Claspin associates strongly with replication forks raised the possibility that this binding would be closely related with the ability of Claspin to mediate the activation of Xchk1. Interestingly, however, we find that certain fragments of Claspin retain the ability to mediate the activation of Xchk1 without being able to associate stably with chromatin. These fragments fall into two classes. Fragments from the C-terminal half of Claspin retain full efficacy for activation of Xchk1 but are significantly less potent. For example, the 774-1285 fragment is
33-fold less potent than full-length Claspin for half-maximal activation of Xchk1. By contrast, a fragment containing residues 470-1285 does not bind to chromatin stably but is nonetheless comparable to full-length Claspin in its potency for activation of Xchk1. Significantly, this fragment retains a substantial portion of the RFID, namely, BP2 (residues 470600) (Figure 7B). The presence of the BP2 region may allow the 470-1285 fragment to interact transiently with replication forks and thereby enhance the ability of Claspin to mediate the activation of Xchk1. Alternatively, it is possible that the BP2 region increases the activity of Claspin as a mediator by a mechanism that does not involve any interaction with chromatin. However, our mapping studies have clearly indicated that this region is important for optimal interaction with chromatin. For example, deletion of BP2 (residues 470600) from full-length Claspin impaired chromatin binding in egg extracts containing all of its endogenous Claspin, indicating that this mutant cannot compete effectively with normal Claspin. Furthermore, in Claspin-depleted extracts, the
BP2 mutant can bind to chromatin, but it displays significantly reduced ability to mediate the activation of Xchk1. Therefore, this mutant seems to associate with chromatin in an aberrant manner that is not compatible with normal activation of Xchk1.
Recently, it has been shown that human Claspin and its fission yeast relative Mrc1 possess a DBD (Sar et al., 2004
; Zhao and Russell, 2004
). The DBD in human Claspin (residues 149340) is highly homologous to residues 150331 in Xenopus Claspin and contains the BP1 region of the RFID that we have identified in this study. Our results indicate that the DBD region is not essential either for interaction with chromatin or for activation of Xchk1. We found that versions of Claspin that lack this region, such as the
(150-331) and 332-1285 constructs, bind very well to chromatin in Claspin-depleted extracts and display a comparable potency with full-length Claspin for mediating the activation of Xchk1. Nonetheless, these mutants do seem to have a lower affinity for replication forks in that they are unable to bind to chromatin in undepleted extracts containing the full complement of endogenous Claspin. The physiological role of the DBD in human Claspin is not known. Fission yeast harboring a version of Mrc1 with a mutated DBD displayed a modest increase in sensitivity to hydroxyurea and a partial defect in the DNA replication checkpoint. However, the abilities of this mutant to associate with chromatin in fission yeast cells and to mediate the activation of Cds1, the checkpoint effector kinase downstream of Mrc1, have not yet been described. We suspect that the DBD/BP1 region may have a role in some other function of Claspin besides mediating the activation of Xchk1.
Identification of a Minimal Chk1-activating Domain
Another finding of this work is that a very small fragment of Claspin (the CKAD), only 130 amino acids long, is fully sufficient at high concentrations to sustain the Xatr-dependent activation of Xchk1 in aphidicolin-treated extracts. We can detect little or no association of the CKAD with chromatin, which reinforces the concept that stable binding of Claspin to chromatin is not obligatory for checkpoint activation. Nonetheless, even this small fragment presumably interacts transiently with sites of replication to collaborate with replication fork-associated Xatr in the phosphorylation of Xchk1. Similarly, we can never detect binding of Xchk1 to chromatin (our unpublished data), which implies that Xchk1 would also interact only transiently with Xatr-Xatrip and Claspin at replication forks. Consistent with this idea, Claspin has a low affinity for the fully activated form of Xchk1, which presumably dissociates from Claspin immediately upon kinase activation (Jeong et al., 2003
). Together, these observations indicate that Xatr-Xatrip, Claspin, and Xchk1 associate evanescently with one another during the process that results in activation of Xchk1.
Stable Chromatin Binding of Claspin May Reflect an Additional Function
Our observations support the possibility that the RFID has another function in addition to initial activation of Xchk1. In the absence of Claspin, DNA replication in egg extracts occurs somewhat more slowly than normal (Lee et al., 2003
). Interestingly, overexpression of Claspin in human cells enhances the rate of cell proliferation (Lin et al., 2004
). Furthermore, it is well established that the budding yeast Mrc1 protein, the apparent functional counterpart of Claspin, has a role in DNA replication. Yeast mutants lacking Mrc1 replicate their DNA more slowly, accumulate DNA damage in S phase, and exhibit defects in sister chromatid cohesion (Alcasabas et al., 2001
; Osborn and Elledge, 2003
; Xu et al., 2004
). Although the exact role that Claspin/Mrc1 plays in S-phase regulation remains to be established, our data raise the possibility that the stable retention of Claspin on chromatin may be related to this function.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
The online version of this article contains supplemental material at MBC Online (http://www.molbiolcell.org). ![]()
Address correspondence to: William G. Dunphy (dunphy{at}cco.caltech.edu).
| REFERENCES |
|---|
|
|
|---|
Alcasabas, A. A., Osborn, A. J., Bachant, J., Hu, F., Werler, P. J., Bousset, K., Furuya, K., Diffley, J. F., Carr, A. M., and Elledge, S. J. ((2001). ). Mrc1 transduces signals of DNA replication stress to activate Rad53. Nat. Cell Biol. 3, , 958-965.[CrossRef][Medline]
Canman, C. E. ((2003). ). Checkpoint mediators: relaying signals from DNA strand breaks. Curr. Biol. 13, , R488-R490.[CrossRef][Medline]
Celeste, A., Fernandez-Capetillo, O., Kruhlak, M. J., Pilch, D. R., Staudt, D. W., Lee, A., Bonner, R. F., Bonner, W. M., and Nussenzweig, A. ((2003). ). Histone H2AX phosphorylation is dispensable for the initial recognition of DNA breaks. Nat. Cell Biol. 5, , 675-679.[CrossRef][Medline]
Chini, C. C., and Chen, J. ((2003). ). Human Claspin is required for replication checkpoint control. J. Biol. Chem. 278, , 30057-30062.
Cortez, D., Guntuku, S., Qin, J., and Elledge, S. J. ((2001). ). ATR and ATRIP: partners in checkpoint signaling. Science 294, , 1713-1716.
Ellison, V., and Stillman, B. ((2003). ). Biochemical characterization of DNA damage checkpoint complexes: clamp loader and clamp complexes with specificity for 5' recessed DNA. PLoS Biol. 1, , 231-243.[CrossRef]
Guo, Z., Kumagai, A., Wang, S. X., and Dunphy, W. G. ((2000). ). Requirement for Atr in phosphorylation of Chk1 and cell cycle regulation in response to DNA replication blocks and UV-damaged DNA in Xenopus egg extracts. Genes Dev. 14, , 2745-2756.
Hekmat-Nejad, M., You, Z., Yee, M., Newport, J. W., and Cimprich, K. A. ((2000). ). Xenopus ATR is a replication-dependent chromatin-binding protein required for the DNA replication checkpoint. Curr. Biol. 10, , 1565-1573.[CrossRef][Medline]
Huyen, Y., Zgheib, O., Ditullio, R. A., Jr., Gorgoulis, V. G., Zacharatos, P., Petty, T. J., Sheston, E. A., Mellert, H. S., Stavridi, E. S., and Halazonetis, T. D. ((2004). ). Methylated lysine 79 of histone H3 targets 53BP1 to DNA double-strand breaks. Nature 432, , 406-411.[CrossRef][Medline]
Jeong, S.-Y., Kumagai, A., Lee, J., and Dunphy, W. G. ((2003). ). Phosphorylated Claspin interacts with a phosphate-binding site in the kinase domain of Chk1 during ATR-mediated activation. J. Biol. Chem. 278, , 46782-46788.
Katou, Y., Kanoh, Y., Bando, M., Noguchi, H., Tanaka, H., Ashikari, T., Sugimoto, K., and Shirahige, K. ((2003). ). S-phase checkpoint proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature 424, , 1078-1083.[CrossRef][Medline]
Kumagai, A., and Dunphy, W. G. ((2000). ). Claspin, a novel protein required for the activation of Chk1 during a DNA replication checkpoint response in Xenopus egg extracts. Mol. Cell 6, , 839-849.[CrossRef][Medline]
Kumagai, A., and Dunphy, W. G. ((2003). ). Repeated phosphopeptide motifs in Claspin mediate the regulated binding of Chk1. Nat. Cell Biol. 5, , 161-165.[CrossRef][Medline]
Kumagai, A., Guo, Z., Emami, K. H., Wang, S. X., and Dunphy, W. G. ((1998). ). The Xenopus Chk1 protein kinase mediates a caffeine-sensitive pathway of checkpoint control in cell-free extracts. J. Cell Biol. 142, , 1559-1569.
Kumagai, A., Kim, S.-M., and Dunphy, W. G. ((2004). ). Claspin and the activated form of ATR-ATRIP collaborate in the activation of Chk1. J. Biol. Chem. 279, , 49599-49608.
Lee, J., Kumagai, A., and Dunphy, W. G. ((2003). ). Claspin, a Chk1-regulatory protein, monitors DNA replication on chromatin independently of RPA, ATR, and Rad17. Mol. Cell 11, , 329-340.[CrossRef][Medline]
Lin, S. Y., Li, K., Stewart, G. S., and Elledge, S. J. ((2004). ). Human Claspin works with BRCA1 to both positively and negatively regulate cell proliferation. Proc. Nat. Acad. Sci. USA 101, , 6484-6489.
Liu, Q., et al. ((2000). ). Chk1 is an essential kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint. Genes Dev. 14, , 1448-1459.
Marheineke, K., and Hyrien, O. ((2004). ). Control of replication origin density and firing time in Xenopus egg extracts: role of a caffeine-sensitive, ATR-dependent checkpoint. J. Biol. Chem. 279, , 28071-28081.
McGowan, C. H., and Russell, P. ((2004). ). The DNA damage response: sensing and signaling. Curr. Opin. Cell Biol. 16, , 629-633.[CrossRef][Medline]
Melo, J., and Toczyski, D. ((2002). ). A unified view of the DNA-damage checkpoint. Curr. Opin. Cell Biol. 14, , 237-245.[CrossRef][Medline]
Michael, W. M., Ott, R., Fanning, E., and Newport, J. ((2000). ). Activation of the DNA replication checkpoint through RNA synthesis by primase. Science 289, , 2133-2137.
Mimura, S., Masuda, T., Matsui, T., and Takisawa, H. ((2000). ). Central role for Cdc45 in establishing an initiation complex of DNA replication in Xenopus egg extracts. Genes Cells 5, , 439-452.[Abstract]
Mimura, S., and Takisawa, H. ((1998). ). Xenopus Cdc45-dependent loading of DNA polymerase alpha onto chromatin under the control of S-phase Cdk. EMBO J. 17, , 5699-5707.[CrossRef][Medline]
Moore, J. D., Kornbluth, S., and Hunt, T. ((2002). ). Identification of the nuclear localization signal in Xenopus cyclin E and analysis of its role in replication and mitosis. Mol. Biol. Cell 13, , 4388-4400.
Nakamura, T. M., Du, L. L., Redon, C., and Russell, P. ((2004). ). Histone H2A phosphorylation controls Crb2 recruitment at DNA breaks, maintains checkpoint arrest, and influences DNA repair in fission yeast. Mol. Cell. Biol. 24, , 6215-6230.
O'Connell, M. J., and Cimprich, K. A. ((2005). ). G2 damage checkpoints: what is the turn-on? J. Cell Sci. 118, , 1-6.
Osborn, A. J., and Elledge, S. J. ((2003). ). Mrc1 is a replication fork component whose phosphorylation in response to DNA replication stress activates Rad53. Genes Dev. 17, , 1755-1767.
Osborn, A. J., Elledge, S. J., and Zou, L. ((2002). ). Checking on the fork: the DNA-replication stress-response pathway. Trends Cell Biol. 12, , 509-516.[CrossRef][Medline]
Sancar, A., Lindsey-Boltz, L. A., Unsal-Kacmaz, K., and Linn, S. ((2004). ). Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu. Rev. Biochem. 73, , 39-85.[CrossRef][Medline]
Sanders, S. L., Portoso, M., Mata, J., Bahler, J., Allshire, R. C., and Kouzarides, T. ((2004). ). Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA damage. Cell 119, , 603-614.[CrossRef][Medline]
Sar, F., Lindsey-Boltz, L. A., Subramanian, D., Croteau, D. L., Hutsell, S. Q., Griffith, J. D., and Sancar, A. ((2004). ). Human Claspin is a ring-shaped DNA-binding protein with high affinity to branched DNA structures. J. Biol. Chem. 279, , 39289-39295.
Shechter, D., Costanzo, V., and Gautier, J. ((2004). ). ATR and ATM regulate the timing of DNA replication origin firing. Nat. Cell Biol. 6, , 648-655.[CrossRef][Medline]
Shevchenko, A., Sunyaev, S., Liska, A., Bork, P., and Shevchenko, A. ((2003). ). Nanoelectrospray tandem mass spectrometry and sequence similarity searching for identification of proteins from organisms with unknown genomes. Methods Mol. Biol. 211, , 221-234.[Medline]
Shevchenko, A., Sunyaev, S., Loboda, A., Bork, P., Ens, W., and Standing, K. G. ((2001). ). Charting the proteomes of organisms with unsequenced genomes by MALDI-quadrupole time-of-flight mass spectrometry and BLAST homology searching. Anal. Chem. 73, , 1917-1926.[Medline]
Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. ((1996). ). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68, , 850-858.[Medline]
Waga, S., Masuda, T., Takisawa, H., and Sugino, A. ((2001). ). DNA polymerase epsilon is required for coordinated and efficient chromosomal DNA replication in Xenopus egg extracts. Proc. Nat. Acad. Sci. USA 98, , 4978-4983.
Xu, H., Boone, C., and Klein, H. L. ((2004). ). Mrc1 is required for sister chromatid cohesion to aid in recombination repair of spontaneous damage. Mol. Cell. Biol. 24, , 7082-7090.
Yanow, S. K., Gold, D. A., Yoo, H. Y., and Dunphy, W. G. ((2003). ). Xenopus Drf1, a regulator of Cdc7, displays checkpoint-dependent accumulation on chromatin during an S-phase arrest. J. Biol. Chem. 278, , 41083-41092.
Yoo, H. Y., Kumagai, A., Shevchenko, A., and Dunphy, W. G. ((2004). ). Adaptation of a DNA replication checkpoint response depends upon inactivation of Claspin by the Polo-like kinase. Cell 117, , 575-588.[CrossRef][Medline]
You, Z., Kong, L., and Newport, J. ((2002). ). The role of single-stranded DNA and polymerase alpha in establishing the ATR, Hus1 DNA replication checkpoint. J. Biol. Chem. 277, , 27088-27093.
Zhao, H., and Russell, P. ((2004). ). DNA binding domain in the replication checkpoint protein Mrc1 of Schizosaccharomyces pombe. J. Biol. Chem. 279, , 53023-53027.
Zou, L., Liu, D., and Elledge, S. J. ((2003). ). Replication protein A-mediated recruitment and activation of Rad17 complexes. Proc. Nat. Acad. Sci. USA 100, , 13827-13832.
This article has been cited by other articles:
![]() |
J. Scorah, M.-Q. Dong, J. R. Yates III, M. Scott, D. Gillespie, and C. H. McGowan A Conserved Proliferating Cell Nuclear Antigen-interacting Protein Sequence in Chk1 Is Required for Checkpoint Function J. Biol. Chem., June 20, 2008; 283(25): 17250 - 17259. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Petermann, T. Helleday, and K. W. Caldecott Claspin Promotes Normal Replication Fork Rates in Human Cells Mol. Biol. Cell, June 1, 2008; 19(6): 2373 - 2378. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lee, A. Kumagai, and W. G. Dunphy The Rad9-Hus1-Rad1 Checkpoint Clamp Regulates Interaction of TopBP1 with ATR J. Biol. Chem., September 21, 2007; 282(38): 28036 - 28044. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Errico, V. Costanzo, and T. Hunt Tipin is required for stalled replication forks to resume DNA replication after removal of aphidicolin in Xenopus egg extracts PNAS, September 18, 2007; 104(38): 14929 - 14934. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. MacDougall, T. S. Byun, C. Van, M.-c. Yee, and K. A. Cimprich The structural determinants of checkpoint activation Genes & Dev., April 15, 2007; 21(8): 898 - 903. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shikata, F. Ishikawa, and J. Kanoh Tel2 Is Required for Activation of the Mrc1-mediated Replication Checkpoint J. Biol. Chem., February 23, 2007; 282(8): 5346 - 5355. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yoshizawa-Sugata and H. Masai Human Tim/Timeless-interacting Protein, Tipin, Is Required for Efficient Progression of S Phase and DNA Replication Checkpoint J. Biol. Chem., January 26, 2007; 282(4): 2729 - 2740. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. S. Chini and J. Chen Repeated Phosphopeptide Motifs in Human Claspin Are Phosphorylated by Chk1 and Mediate Claspin Function J. Biol. Chem., November 3, 2006; 281(44): 33276 - 33282. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Y. Yoo, S.-Y. Jeong, and W. G. Dunphy Site-specific phosphorylation of a checkpoint mediator protein controls its responses to different DNA structures Genes & Dev., April 1, 2006; 20(7): 772 - 783. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||