|
|
|
|
Vol. 16, Issue 12, 5528-5537, December 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









* Lung Biology Center, Cardiovascular Research Institute, University of CaliforniaSan Francisco, San Francisco, CA 94143;
Department of Medicine, University of CaliforniaSan Francisco, San Francisco, CA 94143;
¶ Department of Anatomy, University of CaliforniaSan Francisco, San Francisco, CA 94143;
Department of Immunology, University of Colorado Health Science Center, Denver, CO 80206;
National Jewish Medical Center and
Department of Medicine, University of Colorado Health Science Center, Denver, CO 80206; and
|| Epitomics, Burlingame, CA 94010
Submitted February 15, 2005;
Revised August 17, 2005;
Accepted September 15, 2005
Monitoring Editor: M. Bishr Omary
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
-casein, two of the most abundant milk proteins, serve as classical markers of epithelial cell differentiation and a developmental role has been suggested for whey acidic protein (Shamay et al., 1992
Milk fat globule-EGF- factor 8 (Mfge8) is a glycoprotein that makes up part of the MFGM (Stubbs et al., 1990
). Mfge8 found in mouse mammary gland milk consists of a long and short (Mfge8L and Mfge8S) isoform (Oshima et al., 1999
). Both isoforms have two N-terminal Notch-like EGF domains. The second EGF-like domain is highly conserved across species and contains an arginine-glycine-aspartic acid (RGD) sequence that has been shown to bind the
v
3 and
v
5 integrins (Hanayama et al., 2002
). The EGF-like domains are followed by two discoidinlike Factor 5/Factor 8 domains. The carboxyl-terminal discoidin domains bind phosphatidylserine residues expressed on the surface of apoptotic cells and are essential for Mfge8-mediated uptake of these cells (Hanayama et al., 2002
). Mfge8L contains an additional proline-threonine-rich domain inserted between the EGF-like and discoidin domains. Mammary gland Mfge8L transcripts increase with pregnancy and lactation suggesting a specific role for this isoform in the pregnant and lactating mammary gland (Oshima et al., 1999
).
Initial interest in Mfge8 focused on lactadherin, the human orthologue of Mfge8, and its potential role in mammary gland carcinomas (Larocca et al., 1991
; Carmon et al., 2002
). More recently, Mfge8 has been shown to facilitate in vitro phagocytosis of apoptotic T-cells by activated peritoneal macrophages and to enhance the in vivo clearance of apoptotic lymphocytes by splenic macrophages (Hanayama et al., 2002
, 2004
).
The importance of apoptosis throughout mammary gland development (Strange et al., 2001
) and the ability of Mfge8 to facilitate the clearance of apoptotic leukocytes suggests a potentially important function for Mfge8 in mammary gland development. Though apoptosis is critical in prepregnancy mammary gland development (Humphreys et al., 1996
, 1999), the tissue remodeling that takes place during mammary gland involution requires programmed cell death and removal of
90% of the mammary gland epithelium (Wiseman and Werb, 2002
). Despite this massive cell turnover, mammary gland involution is nearly complete by 10 d, at which time there is scant evidence of apoptotic cells (Fadok, 1999
). For involution to proceed in an orderly manner apoptotic cells must be cleared quickly and completely and milk remaining in the ductal lumen must be reabsorbed (Wilde et al., 1999
). As epithelial cells undergo apoptosis they are phagocytosed by adjacent epithelial cells or are shed into the ductal lumen where they are engulfed by phagocytic cells (Monks et al., 2005
). Mfge8 on the milk membrane and on the apical surface of viable epithelial cells is in close proximity with apoptotic epithelial cells and is in the ideal location to facilitate rapid and orderly clearance of these cells.
In this study we have generated mice homozygous for a gene trap mutation that disrupts Mfge8 and eliminates the carboxy terminal discoidin domain (Silvestre et al., 2005
). Here we report that despite normal mammary gland development during puberty, Mfge8 mutant mice fail to rapidly clear apoptotic cells and develop progressive inflammation during involution coupled with destruction of mammary gland architecture after successive pregnancies. These studies show that Mfge8 plays a central role in orchestrating postlactational mammary gland remodeling.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2.5-kb fragment for the mutant allele. Subsequent genotyping was done by PCR. A forward primer K2 (5' TTCTTTCCCTTCAATGGCAC) and the reverse primer R4 (5' CCATATTCCCACGTTTGACC) generated a 402-base pair product for the wild-type allele and the forward primer K2 and the reverse primer R73 (5' CGTGTCCTACAACACACACTCCAACC) from the gene trap-vector produced an
260-base pair product for the targeted allele.
Animal Husbandry
Mice were housed at the animal care facility at the University of California San Francisco and all studies were approved by the institutional review board. Mice were maintained on a mixed C57/BL6:129 OLA background. Mutant animals were generated from heterozygous intercrosses and from homozygous-heterozygous mating pairs. For studies of mammary gland development, 8-wk-old and 9-mo-old nulliparous females and age matched littermates at estrus (as determined by vaginal smear) were used. Age-matched littermates at first pregnancy were used for studies of pregnancy, lactation, and involution and litter size was normalized to four pups for studies of lactation and involution. Studies of apoptosis during involution were done on mice at first pregnancy with forced involution after 10 d of lactation. Heterozygote mice served as controls in these studies.
-Galactosidase Staining
Frozen sections, 5 µm, were air dried and fixed with 10% neutral buffered Formalin and incubated in X-gal solution in a humidity chamber at 37°C overnight. X-gal solution consisted of 1:30 dilution of X-gal stock (30x X-gal reagent, Pierce, Rockford, IL) in 5 mM potassium ferrocyanide crystalline, 5 mM potassium ferrocyanide trihydrate, and 2 mM magnesium chloride in phosphate-buffered saline (PBS). Slides were rinsed with PBS and immersed in 100% ethanol until all precipitate dissolved, counterstained with Eosin Y, and dehydrated and mounted.
Reverse Transcription-PCR
RNA was isolated from mouse mammary gland using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Single-stranded cDNA was transcribed from 3 µg of RNA using the superscript first-strand synthesis system (Invitrogen) and random hexamers. PCR was performed using primers covering exon 7 and 8 (forward primer 5'CGCAAGTTTGAGTTCATCCA, reverse primer 5'GCATTGATCTTGCCCTGATT).
Development of Monoclonal Antibody to Mfge8
The rabbit monoclonal antibody (mAb) 4F6 was generated by immunizing a rabbit with mouse mammary tumor cells from MMTV-PyVmT-transgenic mice. Splenocytes from immunized rabbits were fused with rabbit plasmacytoma 240E cells and the resultant hybridomas were screened by immunohistochemistry with tissue sections from mouse mammary tumors. The 4F6 antibody stained both normal and malignant mammary epithelium. Specificity for Mfge8 was demonstrated because, as shown by immunocytochemistry, the antibody strongly reacted with HEK-293 cells transfected with an Mfge8 cDNA expression vector, but not with mock-transfected HEK-293 cells (unpublished data). Antibody specificity was confirmed by Western blot analysis of mammary tumor cell lysates, showing a pattern of bands consistent with the previously described molecular forms of Mfge8.
Whole Mount Preparation
The inguinal mammary gland was removed and fixed overnight in Carnoy's solution (3:1 ratio of alcohol/glacial acetic acid), hydrated, and stained overnight with carmine alum (0.2% carmine dye and 0.5% aluminum potassium sulfate), dehydrated, defatted with xylene, mounted and photographed. For evaluation of ductal diameter, whole mounts from mice greater than 10 d postinvolution were photographed and the diameter of the largest primary duct along its course adjacent to the central lymph node (515 measurements per duct) was measured using NIH image 1.63.
Morphometry
For morphometric evaluation of epithelial and fat content of the mammary gland, 5-µm sections were stained with hematoxylin and eosin (H & E), and images were obtained from 10 randomly selected fields (Leica, Deerfield, IL; DM 5000 B, 100x) using SPOT software. A grid was superimposed on the digital images and the number of intersections that marked epithelium and adipocytes was counted and expressed as a percentage. The investigator was blinded to the genotype of the sections. For evaluation of the phagocytic index of epithelial cells, 5-µm sections from day 2 of involution were stained with H & E and the number of ingested particles within alveolar epithelial cells was counted from 10 randomly chosen high-powered fields using an oil objective (1000x). Ingestions were counted as apoptotic particles if a whole apoptotic cell or a round apoptotic body with a clear rim surrounding it (spacious phagosome) was observed within the cytoplasm of an epithelial cell lining the alveolar lumen (Monks et al., 2005
). The phagocytic index was calculated as the number of ingested particles multiplied by the proportion of epithelial cells with ingested particles. The investigator was blinded to the genotype of the sections.
Immunohistochemistry and Immunofluorescence
Mammary glands were removed and fixed in 4% paraformaldehyde overnight and then embedded in paraffin. For H & E staining, 5-µm sections were rehydrated and stained according to standard protocols. For immunohistochemistry, 5-µm sections were boiled for 15 min in 10 mM sodium citrate (pH 6) for antigen retrieval and blocked with H2O2 in methanol and subsequently 2% bovine serum albumin. Rabbit mAb (4F6) directed against Mfge8 was used at 1:20 dilution in PBS and 0.5% Tween, followed by a 1:200 biotinylated anti-rabbit secondary antibody (Vector, Burlingame, CA), ABC reagent (Vector), and liquid diaminobenzidine substrate (Sigma, St. Louis, MO). For CD45 staining, a rat anti-mouse mAb (BD Biosciences, San Diego, CA; 1:100 dilution) was used. TUNEL assay was done using a kit from Chemicon (Apoptag; Temecula, CA) and following manufacturer's instructions. For immunofluorescence, apoptotic cells obtained from mammary gland milk were washed with PBS and cytospin preparations were fixed with 3% PFA and 3% sucrose in PBS, blocked with 5% donkey serum, incubated overnight with anti-activated caspase 3 antibody (1:50 dilution, Cell Signaling, Beverly, MA) at 4°C, and incubated with a FITC-conjugated secondary antibody (1:100 dilution, Jackson Laboratories, West Grove, PA) and 4',6-diamidino-2-phenylindole (DAPI). For immunofluorescence staining of the mammary gland, 5-µm sections of mammary gland tissue frozen in OCT were air dried, fixed in 1% PFA and 3% sucrose, blocked in 5% goat serum, and incubated with anti-CD11b antibody (Serotec, Raleigh, NC; 1:100 dilution) for 1 h followed by 1-h incubation with a FITC-conjugated goat anti-rat antibody (1:100 dilution, Jackson Laboratories) and DAPI.
Quantification of Apoptotic and Inflammatory Cells
Apoptotic cells in the mammary gland were identified by TUNEL assay and morphological criteria. The percentage of apoptotic nuclei was quantified by combining the number of apoptotic cells in the alveolar lumens on H & E-stained sections and the number of TUNEL-positive cells on tissue sections from 14 randomly selected high-power fields (HPF, 400x). The number of CD45- and CD11b-positive cells per HPF (400x) was counted on 1014 randomly selected fields. Investigators were blinded to the genotype of the sections examined.
Cell Culture
Primary mammary gland epithelial cells (PMEC) were obtained from 3-moold Mfge8 mutant and heterozygous control mice during the third week of pregnancy. Mammary glands were minced and digested with 0.1% collagenase type 3 (Worthington, Lakewood, NJ) and 0.2% trypsin in DMEM/F12 supplemented with 5% fetal calf serum (FCS) and 100 U/ml penicillin and 100 µg/ml streptomycin for 12 h. The digests were passed through a 500-µm filter (Sefar, Buffalo, NY) and washed with DMEM/F12. Several 30-s centrifugation steps were used to remove single cells. Mammary gland organoids were plated on eight-well chamber slides (LabTek, Naperville, IL) precoated for 1 h with type 1 collagen (Sigma) in complete medium (DMEM/F12 supplemented with 5% FCS, 5 µg/ml insulin, Sigma; 100 ng/ml hydrocortisone, Sigma; 25 ng/ml EGF, R&D, Minneapolis, MN; and 100 U/ml penicillin and 100 µg/ml streptomycin). The organoids formed monolayers 7296 h after plating.
|
Western Blot Analysis
Freshly isolated mammary gland tissue was snap frozen in liquid nitrogen and subsequently homogenized in RIPA buffer (150 mM NaCl, 20 mM Tris-HCl, pH 7.6, 1% NP-40, 0.5% deoxycholate, and 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride, and complete mini protease inhibitor cocktail tablets, Amersham, Piscataway, NJ). The homogenates were centrifuged for 10 min at 4°C and the supernatant stored at 80°C. Eighty micrograms of protein was separated on 8, 10, or 12% polyacrylamide gels, transferred to an Immobilon membrane, and blocked overnight with 5% milk in TBST (20 mM Tris, pH 7.6, 150 mM NaCl, and 0.1% Tween). 4F6 antibody (1:50 dilution), anti-
-galactosidase antibody (AbCam, Cambridge, UK; 1:2000 dilution), anti-C/EBP
antibody (Santa Cruz Biotechnology, Santa Cruz, CA; 1:500 dilution), anti-
-actin (Sigma, 1:5000 dilution) or anti-epimorphin antibody (Stressgen, Victoria, British Columbia, Canada; 1:20,000 dilution) was followed by horseradish peroxidase-conjugated anti-rabbit or anti-mouse secondary antibody (Amersham) at 1:5000 dilution. Blots were developed using enhanced chemiluminescence reagents (Amersham).
| RESULTS |
|---|
|
|
|---|
-galactosidase protein.
-galactosidase protein expression was detected in the mammary gland epithelium (Figure 2, B and D) and also in the heart, lung, spleen, brain, kidney, skin, and skeletal muscle (unpublished data). RT -PCR using primers spanning exons 7 and 8 showed the expected 364 base pair product in heterozygote but not homozygote mutant mice (Figure 1B). Western blots using an antibody (4F6) directed against Mfge8 showed a band at
66 and 53 kDa representing Mfge8L and Mfge8S in heterozygote mice but no band in homozygous mice, suggesting that the epitope recognized by this antibody is in the carboxyl terminal region of Mfge8 deleted by this insertion (Figure 1C). Genotyping was performed initially by Southern Blot (Figure 1D) and subsequently by PCR (Figure 1E).
|
Mfge8 Fusion Protein Is Trapped Intracellularly
To evaluate whether the pGT1-pfs gene trap vector produced a fusion protein of the expected size (209 kDa), we performed Western blots on mammary gland lysates from day 2 of involution using an anti-
-galactosidase antibody. An
209-kDa band representing the fusion protein was found in heterozygous and homozygous females but not in wild-type females (Figure 2A). A second band at
170 kDa was present in heterozygous and homozygous females but not in wild-type females and likely represented a degradation product of the fusion protein. To determine whether the fusion protein was successfully trapped intracellularly, we stained for
-galactosidase expression in tissue sections from heterozygote females. The fusion protein, as seen here on day 10 of lactation, was restricted to the cell surface of the alveolar and ductal epithelium (Figure 2, B and D). In contrast, native Mfge8, detected using a mAb, showed the protein in the lumen and apical surface of alveolar and ductal epithelium (Figure 2, C and E).
Mfge8 Mutant Mice Have Normal Development during Puberty, Pregnancy, and Lactation
We first examined mammary gland morphology during various developmental stages. At 4 wk of age, the morphology of the ductal network was variable but we did not observe any consistent differences between homozygote mutants and heterozygote controls in ductal morphology or depth of penetration of the fat pad relative to the central lymph node (Figure 3, A and B). At 8 wk of age, homozygous mice at estrus occasionally had ductal ectasia and dilatation but the majority of mutants and controls had similar ductal and parenchymal morphology as heterozygous controls as assessed by whole mount and histological sections (unpublished data). Histological and whole mount analysis revealed no obvious differences on pregnancy day 18.5 (Figure 3, C and D, and unpublished data) and lactation day 10 (Figure 3, E and F, and unpublished data). Morphometric quantification of epithelial content revealed no differences between homozygous and heterozygous females at 8 wk of age, pregnancy day 18.5, or lactation day 10 (Figure 3G).
|
Alveolar Collapse and the Repopulation of Adipocytes during Involution Are Delayed in Mfge8 Mutant Mice
Mammary gland involution requires complete reorganization of the parenchyma at a time during which Mfge8 protein expression is maximal (unpublished data). We examined H & E-stained sections of days 15 of involution. On day 1 of involution, Mfge8 mutants had many more apoptotic bodies in the alveolar lumens (Figure 4, A and B). On day 2 there was a continued excess of apoptotic bodies coupled with a delay in alveolar collapse and fat cell repopulation of the mammary gland parenchyma (Figure 4, C, D, and G). By day 3, Mfge8 mutants and heterozygote controls had a similar histological appearance that persisted through day 5 (Figure 4, E, F, and G, and unpublished data).
|
|
|
Epithelial Cells from Mfge8 Mutant Mice Have Impaired Apoptotic Cell Clearance In Vitro
To further evaluate the role of Mfge8 in epithelial cell-mediated apoptotic cell clearance, we evaluated the ability of primary mammary gland epithelial cells (PMEC) from Mfge8 mutants and control mice to ingest apoptotic cells in vitro. We used apoptotic cells isolated from the milk of involuting Mfge8 mutant and control mice as targets for phagocytosis in this assay. Apoptotic cells obtained by this method (milked apoptotic cells) were
90% Annexin V-positive by FACS analysis (unpublished data) and virtually 100% apoptotic when stained with an anti-activated caspase 3 antibody (Figure 6C). PMEC from Mfge8 mutant mice incubated with milked apoptotic cells from Mfge8 mutant mice had a significantly lower phagocytic index then heterozygous PMEC incubated with milked apoptotic cells from heterozygous controls (Figure 6, D and E).
Mfge8 Mutants Develop Inflammation during Involution
Given the increase in apoptotic cells, we hypothesized that Mfge8 mutants may develop inflammation during involution. We therefore stained for CD45 antigen, a pan-leukocyte marker and counted the number of inflammatory cells in tissue sections. An increase in the number of CD45-positive cells was evident on day 4 and persisted on days 5 and 10 of involution (Figure 7A). To further characterize the inflammatory infiltrate, we stained frozen sections from day 1 and day 4 of involution with an anti-CD11b antibody (Figure 7, B and D), a marker found on activated phagocytes. As with the CD45 staining, we saw an increase in the number of cells expressing CD11b on day 4 of involution in homozygous mice.
|
Mfge8 Mutant Mice Develop Progressive Mammary Gland Ductal Dilatation
We next evaluated the long-term consequences of the alterations in mammary gland involution on mammary gland morphology. Homozygous females developed progressive ductal dilatation with successive pregnancies compared with heterozygote controls (Figure 8, AD). Ductal dilatation was evident after one pregnancy but became much more dramatic after multiple pregnancies and was apparent in the primary ducts as well as the secondary and tertiary branches (Figure 8, FH). Ductal dilatation did not occur due to aging because 9-mo-old virgin Mfge8 mutant mice had normal ductal caliber (Figure 8, A and H). To assess whether heterozygous females had an intermediate phenotype compared with wild-type and homozygous females, we quantified ductal caliber in multiparous wild-type females (Figure 8H). Wild type females had similar ductal diameter after multiple pregnancies as compared with heterozygous females and significantly smaller ductal caliber as compared with homozygous females.
|
and Epimorphin Expression Is Unchanged in Mfge8 Mutant Mice
is a nuclear transcription factor that plays a key role in mammary gland morphogenesis (Robinson et al., 1998
null mice have dilated mammary gland ducts (Seagroves et al., 1998
isoforms LAP and LIP. We hypothesized that Mfge8 could act upstream of these factors and that loss of Mfge8 might alter the expression or ratio of C/EBP
isoforms or up-regulate epimorphin expression. However, C/EBP
isoform expression and ratio and epimorphin protein levels were unchanged in Mfge8 mutant mice during involution, pregnancy, and lactation (unpublished data).
| DISCUSSION |
|---|
|
|
|---|
Mammary gland involution is made up of an early stage (stage I, the first 48 h) and late stage (Wiseman and Werb, 2002
). Stage I of involution is regulated by milk stasis within mammary gland parenchyma and is characterized by apoptosis of the secretory epithelium (Lund et al., 1996
; Li et al., 1997
; Furth, 1999
; Wilde et al., 1999
). During the first 48 h of involution the basement membrane remains intact and lactation can resume if suckling is reinitiated (Li et al., 1997
; Furth, 1999
; Wilde et al., 1999
). As epithelial cells undergo apoptotic cell death during involution, they are shed into the alveolar lumen where they are rapidly removed by phagocytosis. During involution Mfge8 is present on the milk membrane inside the alveolar and ductal lumens and on the apical surface of the epithelium (unpublished data). Both locations place Mfge8 in close apposition to apoptotic epithelial cells. Mfge8 mutants had increased numbers of apoptotic cells in the alveolar lumens on day 1 and day 2 of involution, but no increase in the number of apoptotic cells in the remaining viable alveolar epithelium. These data suggest that the number of cells undergoing apoptosis in the mammary gland epithelium is unchanged in Mfge8 mutants. However, the number of cells that have undergone apoptosis have been shed into the alveolar lumens and are available for engulfment is increased in Mfge8 mutants, implicating an impairment in the ability of phagocytes to clear these cells. Impaired phagocytosis in Mfge8 mutants is further supported by the decrease in the phagocytic index of the viable epithelial cells in vivo at the time when there is the greatest difference in the number of apoptotic cells within the alveolar lumens. In addition, primary mammary gland epithelial cells from Mfge8 mutant mice have impaired phagocytosis in vitro. Therefore, it appears that mammary gland Mfge8 binds apoptotic epithelial cells shed into the alveolar lumen and targets these cells for engulfment. Without functional Mfge8, phagocytosis of apoptotic epithelial cells is impaired.
As involution progresses past 48 h, proteases are released that cleave the basement membrane and irreversible remodeling of the mammary gland takes place (Lund et al., 1996
). On day 3 and day 4 of involution there is continued programmed cell death of the remaining secretory epithelium (Strange et al., 2001
). The proportion of apoptotic cells in our Mfge8 mutants was not significantly different from controls on day 3 or day 4 of involution despite the fact that the total proportion of apoptotic nuclei was greatest at this time. One possible explanation is that the failure to rapidly clear apoptotic cells in the first 48 h of involution triggers compensatory pathways that augment clearance on days 3 and 4. Another possibility is that though the greatest proportion of apoptotic nuclei was seen on day 3 of involution, the size and epithelial content of the mammary gland is significantly less at this time than on day 1 or day 2 (unpublished data). Therefore, the absolute number of mammary gland epithelial cells undergoing apoptosis is greatest between 24 and 48 h after the onset of involution, the time at which Mfge8 mutants had the greatest excess of apoptotic cells.
The cells primarily responsible for clearance of apoptotic cells within the mammary gland are largely unknown. Some researchers favor nonprofessional phagocytes such as epithelial cells in stage 1 of involution and professional phagocytes such as macrophages in the second stage (Fadok, 1999
; Stein et al., 2004
), whereas others discount a substantial role for inflammatory cells (Monks et al., 2002
, 2005
). Mfge8 mutants had a threefold excess of apoptotic nuclei on day 2 of involution, but clearance had apparently caught up with that in heterozygotes by day 3. It would be tempting to speculate that the increase in inflammatory cells that we observed in involuting Mfge8 mutant mammary glands was responsible for this effect, but this increase was not apparent until day 4 of involution. The paucity of immune cells in the mammary glands at the time of impaired apoptotic cell clearance in combination with the impaired phagocytic capacity of mammary gland epithelial cells suggest that epithelial cells utilize Mfge8 for apoptotic cell clearance. Therefore, our data suggest that epithelial cells utilizing Mfge8 mediate a significant proportion of apoptotic cell clearance during the first 48 h of involution. As the number of immune cells infiltrating the mammary gland increases with involution, the relative contribution of professional phagocytes to apoptotic cell clearance likely predominates.
The orderly removal of apoptotic cells is necessary to avoid the inflammatory response that accompanies the release of antigens by dying cells (Savill and Fadok, 2000
; Hengartner, 2001
; Geske et al., 2002
). Our line of Mfge8 mutants developed inflammation during involution that persisted at least until day 10. After involution, Mfge8 mutants developed distortion of the mammary gland architecture and with multiple cycles of pregnancy, involution, and inflammation developed dramatic dilatation of the mammary gland ductal network. On the basis of the data in the present study we cannot determine whether these progressive abnormalities in ductal architecture were a consequence of delayed clearance of apoptotic cells, increased numbers of inflammatory cells or both.
Mammary gland ductal dilatation is a rare phenotype seen in a few other genetically altered mice (Hirai et al., 1998
; Seagroves et al., 1998
; Vogel et al., 2001
). Transgenic mice that express epimorphin in the mammary gland epithelium under the whey acidic protein promoter have ductal dilatation and an abnormal ratio of the C/EBP
isoforms (Hirai et al., 2001
). C/EBP
null mice also have pubertal ductal dilatation (Seagroves et al., 1998
). However we found no differences in LAP/LIP and epimorphin expression during pregnancy, lactation, and involution in Mfge8 mutants or controls. Thus, the ductal dilatation seen in Mfge8 mutant mice appeared not to be mediated by the C/EBP
isoforms LAP or LIP or epimorphin.
Our line of Mfge8 mutants were generated using a gene trapping vector that disrupts Mfge8 and produces a fusion protein that is retained in the endoplasmic reticulum and is rapidly degraded (Mitchell et al., 2001
; Silvestre et al., 2005
). Though we cannot exclude the possibility that the fusion protein may have had deleterious effects on the mammary gland, our comparison of multiparous wild-type and heterozygous females revealed minimal differences in ductal morphology. This suggests that the fusion protein was not responsible for the phenotype we observed in the mammary glands of homozygous females. In addition, our mutants had phenotypes similar to traditional Mfge8 knockouts described in the literature (Ensslin and Shur, 2003
; Hanayama et al., 2004
; Silvestre et al., 2005
), and our fusion protein was trapped intracellularly and not secreted into the alveolar or ductal lumens, the locations where we found impaired apoptotic cell clearance and architectural distortion with progressive pregnancies.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| Footnotes |
|---|
Address correspondence to: Dean Sheppard (dean.sheppard{at}ucsf.edu).
| REFERENCES |
|---|
|
|
|---|
Ensslin, M. A., and Shur, B. D. ((2003). ). Identification of mouse sperm SED1, a bimotif EGF repeat and discoidin-domain protein involved in sperm-egg binding. Cell 114, , 405417.[CrossRef][Medline]
Fadok, V. A. ((1999). ). Clearance: the last and often forgotten stage of apoptosis. J. Mammary Gland Biol. Neoplasia 4, , 203211.[CrossRef][Medline]
Furth, P. A. ((1999). ). Introduction: mammary gland involution and apoptosis of mammary epithelial cells. J. Mammary Gland Biol. Neoplasia 4, , 123127.[CrossRef][Medline]
Geske, F. J., Monks, J., Lehman, L., and Fadok, V. A. ((2002). ). The role of the macrophage in apoptosis: hunter, gatherer, and regulator. Int. J. Hematol. 76, , 1626.[Medline]
Hanayama, R., Tanaka, M., Miwa, K., Shinohara, A., Iwamatsu, A., and Nagata, S. ((2002). ). Identification of a factor that links apoptotic cells to phagocytes. Nature 417, , 182187.[CrossRef][Medline]
Hanayama, R., Tanaka, M., Miyasaka, K., Aozasa, K., Koike, M., Uchiyama, Y., and Nagata, S. ((2004). ). Autoimmune disease and impaired uptake of apoptotic cells in MFG-E8-deficient mice. Science 304, , 11471150.
Hengartner, M. O. ((2001). ). Apoptosis: corralling the corpses. Cell 104, , 325328.[CrossRef][Medline]
Hirai, Y., Lochter, A., Galosy, S., Koshida, S., Niwa, S., and Bissell, M. J. ((1998). ). Epimorphin functions as a key morphoregulator for mammary epithelial cells. J. Cell Biol. 140, , 159169.
Hirai, Y., Radisky, D., Boudreau, R., Simian, M., Stevens, M. E., Oka, Y., Takebe, K., Niwa, S., and Bissell, M. J. ((2001). ). Epimorphin mediates mammary luminal morphogenesis through control of C/EBPbeta. J. Cell Biol. 153, , 785794.
Humphreys, R. C. ((1999). ). Programmed cell death in the terminal endbud. J. Mammary Gland Biol. Neoplasia 4, , 213220.[CrossRef][Medline]
Humphreys, R. C., Krajewska, M., Krnacik, S., Jaeger, R., Weiher, H., Krajewski, S., Reed, J. C., and Rosen, J. M. ((1996). ). Apoptosis in the terminal endbud of the murine mammary gland: a mechanism of ductal morphogenesis. Development 122, , 40134022.[Abstract]
Ikeda, K., Kato, M., Yamanouchi, K., Naito, K., and Tojo, H. ((2002). ). Novel development of mammary glands in the nursing transgenic mouse ubiquitously expressing WAP gene. Exp. Anim. 51, , 395399.[Medline]
Larocca, D., Peterson, J. A., Urrea, R., Kuniyoshi, J., Bistrain, A. M., and Ceriani, R. L. ((1991). ). A Mr 46,000 human milk fat globule protein that is highly expressed in human breast tumors contains factor VIII-like domains. Cancer Res. 51, , 49944998.
Li, M., Liu, X., Robinson, G., Bar-Peled, U., Wagner, K.U., Young, W.S., Hennighausen, L., and Furth, P.A. ((1997). ). Mammary-derived signals activate programmed cell death during the first stage of mammary gland involution. Proc. Natl. Acad. Sci. USA 94, , 34253430.
Lonnerdal, B. ((2003). ). Nutritional and physiologic significance of human milk proteins. Am. J. Clin. Nutr. 77, , 1537S1543S.
Lund, L. R., Romer, J., Thomasset, N., Solberg, H., Pyke, C., Bissell, M. J., Dano, K., and Werb, Z. ((1996). ). Two distinct phases of apoptosis in mammary gland involution: proteinase-independent and -dependent pathways. Development 122, , 181193.[Abstract]
Mather, I. H. ((1987). ). The mammary Gland, Development, Regulation, and Function, New York: Plenum Publishing.
Mitchell, K. J. et al. ((2001). ). Functional analysis of secreted and transmembrane proteins critical to mouse development. Nat. Genet. 28, , 241249.[CrossRef][Medline]
Monks, J., Geske, F. J., Lehman, L., and Fadok, V. A. ((2002). ). Do inflammatory cells participate in mammary gland involution? J. Mammary Gland Biol. Neoplasia 7, , 163176.[CrossRef][Medline]
Monks, J., Rosner, D., Geske, F. J., Lehman, L., Hanson, L., Neville, M. C., and Fadok, V. A. ((2005). ). Epithelial cells as phagocytes: apoptotic epithelial cells are engulfed by mammary alveolar epithelial cells and repress inflammatory mediator release. Cell Death Differ. 12, , 107114.[CrossRef][Medline]
Oshima, K., Aoki, N., Negi, M., Kishi, M., Kitajima, K., and Matsuda, T. ((1999). ). Lactation-dependent expression of an mRNA splice variant with an exon for a multiply O-glycosylated domain of mouse milk fat globule glycoprotein MFG-E8. Biochem. Biophys. Res. Commun. 254, , 522528.[CrossRef][Medline]
Robinson, G. W., Johnson, P. F., Hennighausen, L., and Sterneck, E. ((1998). ). The C/EBPbeta transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland. Genes Dev. 12, , 19071916.
Savill, J., and Fadok, V. ((2000). ). Corpse clearance defines the meaning of cell death. Nature 407, , 784788.[CrossRef][Medline]
Seagroves, T. N., Krnacik, S., Raught, B., Gay, J., Burgess-Beusse, B., Darlington, G. J., and Rosen, J. M. ((1998). ). C/EBPbeta, but not C/EBPalpha, is essential for ductal morphogenesis, lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes Dev. 12, , 19171928.
Shamay, A., Pursel, V. G., Wilkinson, E., Wall, R. J., and Hennighausen, L. ((1992). ). Expression of the whey acidic protein in transgenic pigs impairs mammary development. Transgenic Res. 1, , 124132.[CrossRef][Medline]
Silvestre, J. S. et al. ((2005). ). Lactadherin promotes VEGF-dependent neovascularization. Nat. Med. 11, , 499506.[CrossRef][Medline]
Stein, T., Morris, J. S., Davies, C. R., Weber-Hall, S. J., Duffy, M. A., Heath, V. J., Bell, A. K., Ferrier, R. K., Sandilands, G. P., and Gusterson, B. A. ((2004). ). Involution of the mouse mammary gland is associated with an immune cascade and an acute-phase response, involving LBP, CD14 and STAT3. Breast Cancer Res. 6, , R75R91.[CrossRef][Medline]
Strange, R., Metcalfe, T., Thackray, L., and Dang, M. ((2001). ). Apoptosis in normal and neoplastic mammary gland development. Microsc. Res. Tech. 52, , 171181.[CrossRef][Medline]
Stubbs, J. D., Lekutis, C., Singer, K. L., Bui, A., Yuzuki, D., Srinivasan, U., and Parry, G. ((1990). ). cDNA cloning of a mouse mammary epithelial cell surface protein reveals the existence of epidermal growth factor-like domains linked to factor VIII-like sequences. Proc. Natl. Acad. Sci. USA 87, , 84178421.
Vogel, W. F., Aszodi, A., Alves, F., and Pawson, T. ((2001). ). Discoidin domain receptor 1 tyrosine kinase has an essential role in mammary gland development. Mol. Cell Biol. 21, , 29062917.
Wilde, C. J., Knight, C. H., and Flint, D. J. ((1999). ). Control of milk secretion and apoptosis during mammary involution. J. Mammary Gland Biol. Neoplasia 4, , 129136.[CrossRef][Medline]
Wiseman, B. S., and Werb, Z. ((2002). ). Stromal effects on mammary gland development and breast cancer. Science 296, , 10461049.
This article has been cited by other articles:
![]() |
E. F. Nandrot, M. Anand, D. Almeida, K. Atabai, D. Sheppard, and S. C. Finnemann Essential role for MFG-E8 as ligand for {alpha}vbeta5 integrin in diurnal retinal phagocytosis PNAS, July 17, 2007; 104(29): 12005 - 12010. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Ensslin and B. D. Shur The EGF repeat and discoidin domain protein, SED1/MFG-E8, is required for mammary gland branching morphogenesis PNAS, February 20, 2007; 104(8): 2715 - 2720. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||